ID: 902343190

View in Genome Browser
Species Human (GRCh38)
Location 1:15797997-15798019
Sequence TGACCTTCACCCAGTGTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902343186_902343190 19 Left 902343186 1:15797955-15797977 CCAAGTAGGAAGAGGATGGTGAG No data
Right 902343190 1:15797997-15798019 TGACCTTCACCCAGTGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902343190 Original CRISPR TGACCTTCACCCAGTGTGAG TGG Intergenic
No off target data available for this crispr