ID: 902343717

View in Genome Browser
Species Human (GRCh38)
Location 1:15800739-15800761
Sequence ACTCTTGGACTGAGCACCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902343712_902343717 1 Left 902343712 1:15800715-15800737 CCGCGGACACCAAGACACCAGGG No data
Right 902343717 1:15800739-15800761 ACTCTTGGACTGAGCACCAGAGG No data
902343714_902343717 -8 Left 902343714 1:15800724-15800746 CCAAGACACCAGGGAACTCTTGG No data
Right 902343717 1:15800739-15800761 ACTCTTGGACTGAGCACCAGAGG No data
902343710_902343717 16 Left 902343710 1:15800700-15800722 CCGCAGGGTGGGACTCCGCGGAC No data
Right 902343717 1:15800739-15800761 ACTCTTGGACTGAGCACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902343717 Original CRISPR ACTCTTGGACTGAGCACCAG AGG Intergenic