ID: 902345222

View in Genome Browser
Species Human (GRCh38)
Location 1:15811734-15811756
Sequence GCTCCAAGGAAGTGCCTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902345222_902345224 -3 Left 902345222 1:15811734-15811756 CCATCTAGGCACTTCCTTGGAGC No data
Right 902345224 1:15811754-15811776 AGCTGACTAGAGAACAGATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902345222 Original CRISPR GCTCCAAGGAAGTGCCTAGA TGG (reversed) Intergenic
No off target data available for this crispr