ID: 902350028

View in Genome Browser
Species Human (GRCh38)
Location 1:15847647-15847669
Sequence GCGCGCGCGCCCGCGGCGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 251}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902350017_902350028 23 Left 902350017 1:15847601-15847623 CCGGCTGGGAGGAACTCAGCTTC 0: 1
1: 0
2: 2
3: 9
4: 174
Right 902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG 0: 1
1: 0
2: 4
3: 35
4: 251
902350024_902350028 -4 Left 902350024 1:15847628-15847650 CCTTGGCAGGCGGGAGGACGCGC 0: 1
1: 0
2: 0
3: 10
4: 115
Right 902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG 0: 1
1: 0
2: 4
3: 35
4: 251
902350023_902350028 -1 Left 902350023 1:15847625-15847647 CCGCCTTGGCAGGCGGGAGGACG 0: 1
1: 0
2: 0
3: 11
4: 107
Right 902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG 0: 1
1: 0
2: 4
3: 35
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902350028 Original CRISPR GCGCGCGCGCCCGCGGCGAG GGG Intergenic
900088764 1:910245-910267 GAGGCCGCGCCCGCGGAGAGGGG + Intergenic
900162827 1:1232420-1232442 GCGCGCGCGGGCGCGGGGGGAGG - Exonic
900971242 1:5993329-5993351 GAGAGCGTGCCCGCGGGGAGAGG - Intronic
901011798 1:6206451-6206473 GCGCGGGCGCCCGGGCAGAGGGG + Intronic
901641370 1:10694691-10694713 GCGCGCGCGGCGGGGGCGCGCGG - Intronic
902348428 1:15835918-15835940 GCGCGCGCGCGCTCGCCGTGCGG + Intergenic
902348430 1:15835920-15835942 GCGCGCGCGCTCGCCGTGCGGGG + Intergenic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
903078099 1:20787319-20787341 GCGCGCGGGGCCGCGGGTAGGGG - Intronic
903724586 1:25431193-25431215 GGGCCCGCGCCCGCGGAGTGGGG - Intronic
904500154 1:30908594-30908616 GCGCGGGCGCGGGCGGCGGGCGG + Exonic
904652086 1:32013544-32013566 GCGCGCGGGCCCGCGGAGTGTGG - Intergenic
906320597 1:44813255-44813277 GCGCGCGTGGGCGCGGTGAGTGG + Exonic
906637076 1:47416835-47416857 GCGCACGCGGCCGCGGCGCCAGG + Exonic
906961321 1:50421007-50421029 GCGGGAGCGCCCGCGGGGACCGG - Exonic
907429835 1:54405659-54405681 GCGCGGGGGCCCGCGGTGAGTGG - Intronic
907430036 1:54406295-54406317 GCGCGCGAGCGAGCGGAGAGCGG - Exonic
908796128 1:67833058-67833080 GCGCGCGCGCCCTCGACGGGCGG - Intronic
912568654 1:110606571-110606593 GCGCTAGCGGCCGCGGCCAGCGG - Intronic
914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG + Intronic
914869178 1:151458981-151459003 GCGCCCCCGCCCACCGCGAGTGG - Intronic
914870970 1:151473484-151473506 GCGCGGGGGCCCGCGGCGCGTGG + Intergenic
915517438 1:156421475-156421497 GCCCGCGCGTCCGCCACGAGGGG - Intronic
916497244 1:165356734-165356756 GCGTGCGCGGCGGCGGAGAGGGG + Intergenic
916694597 1:167221894-167221916 GCCCGCGCGCCCCCGGCCGGCGG + Intronic
917974790 1:180231547-180231569 GCGCGCGCGCGCGCGACGACTGG - Intronic
920027229 1:203007653-203007675 GCTCGCGTGCCCGCGGCTGGAGG + Intronic
920600599 1:207320870-207320892 GCGCGCGCGCGCGCGCCTCGGGG - Intergenic
920922641 1:210311135-210311157 GTGCGCGCGCACGTGGCGGGGGG - Intergenic
921217728 1:212951448-212951470 GTGCGCGCGGGCGCGGCGAGGGG - Exonic
921355447 1:214281068-214281090 TCGCGCGCCCCCGCGGGGAGGGG - Intergenic
923490486 1:234479214-234479236 GGGCGCGCGGCCGCAGAGAGGGG + Intergenic
1062843862 10:689920-689942 GCGCGCGCGCGCGGGGCGCGAGG + Intergenic
1063459091 10:6204052-6204074 GTGCGTGCGCCCGGGGCGCGTGG - Intronic
1063624804 10:7679005-7679027 GTGCGCGCGCGCGCGGAGGGAGG - Intergenic
1063995180 10:11611831-11611853 GCGCGCGTCCCCGAGGCGGGCGG - Intergenic
1065099107 10:22316329-22316351 CCGCGCGCGCACGCGGCTCGGGG - Exonic
1069651680 10:70053646-70053668 GCACGCCCGCCCGCGGCGCCCGG - Intronic
1071532365 10:86400252-86400274 ACACGCGCGCTCACGGCGAGTGG + Intergenic
1071676366 10:87659678-87659700 GAGCGCGCGCCCGCGAGTAGGGG + Intronic
1072169788 10:92848412-92848434 GCGCTCGGGCCGGCGGCGCGGGG - Intronic
1073049664 10:100659419-100659441 ACGCGCAGGCCCGCGGGGAGCGG - Intergenic
1073503841 10:103967036-103967058 GCGCGCGTGCGCGGGGCCAGAGG + Intergenic
1074815417 10:117138243-117138265 GCGCGCGGGTCAGCGGCGACGGG + Intronic
1075370175 10:121928496-121928518 GCGCTGGGGCCCGCGGCGGGAGG + Intronic
1075748545 10:124744466-124744488 GCAGGCGCGAGCGCGGCGAGCGG - Intronic
1077074862 11:695765-695787 GCGCGAGCGCGCGGGCCGAGAGG + Exonic
1077124323 11:925745-925767 GCGCGCGCGTCCGCGGCACGGGG - Intronic
1077495796 11:2885978-2886000 GGGCGCGCGGCCGGGGCGCGCGG + Intergenic
1080283818 11:30586140-30586162 GGGCGCGCGGGGGCGGCGAGGGG + Intronic
1080779755 11:35419341-35419363 GGGCTCGCGGGCGCGGCGAGTGG + Intronic
1081528279 11:43942078-43942100 GCGCGCGCGCCTGCGGAGGGGGG + Intronic
1082035552 11:47642563-47642585 GCGTGCGCGCGCGCCGCGGGCGG - Exonic
1082928849 11:58579068-58579090 GCGCGCGCGCGCGCCGCCAGCGG + Intergenic
1083170608 11:60922111-60922133 GCGCTGGCGCCAGAGGCGAGCGG + Exonic
1083571563 11:63764383-63764405 GGGCGCGGCCCCGCGGCGACCGG + Exonic
1083883092 11:65557989-65558011 GCGCGCCCGGGCGGGGCGAGGGG + Exonic
1089078844 11:115760063-115760085 GCCCGAGAGCCCGCGGCCAGTGG + Intergenic
1089543629 11:119206188-119206210 GCGCGCGAGCCCGGGGCGGGCGG - Exonic
1090385538 11:126355862-126355884 GCGCGGGGGCCCGCGGGGCGGGG + Intronic
1091718419 12:2795545-2795567 GCGCGCGGGGCGGCGGAGAGGGG + Intronic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1096101296 12:48971832-48971854 GCGCGCGCGCGCGCGCTGGGAGG - Intergenic
1096284145 12:50283548-50283570 GTGCGCGCCCCCGCGGCGGTGGG - Intergenic
1096647620 12:53047275-53047297 CCGCCCGTGCCCGCGCCGAGCGG - Intronic
1096994614 12:55830808-55830830 GCGCGCGTGCGCGCGGTGGGGGG - Intronic
1097019148 12:56007699-56007721 GCGCGCGCGCAGGCTGTGAGGGG - Exonic
1098369190 12:69739079-69739101 GCGGGCGCGCGGGCGCCGAGGGG - Intronic
1100540000 12:95548734-95548756 GGGCGCGCGGCCGCGGCGATTGG - Intronic
1100632162 12:96400048-96400070 CCGCGGACGCCCGCGGCGACCGG + Exonic
1103749743 12:123150754-123150776 GAGCCCGCGGCCGCGCCGAGCGG - Intergenic
1103775579 12:123364538-123364560 GAGCGCGCGGCCGCGAGGAGCGG + Intronic
1104568284 12:129903892-129903914 GCGCGCGCGCCCGAGCCCCGAGG - Intergenic
1104929376 12:132329787-132329809 GGGCGCGCGGGCGCGGGGAGCGG + Intergenic
1107770933 13:43786985-43787007 GCGCGCGCGCCCACGGGGTGGGG + Intergenic
1110119537 13:71865567-71865589 GCCCGCGCGCCCGGGGCAGGGGG + Intronic
1112271807 13:97976203-97976225 GCGGGCCCGGCCGCGGCAAGGGG - Intronic
1113724520 13:112588182-112588204 GCACGCGCGGCCGCGGCGCAGGG - Intergenic
1118019357 14:61695448-61695470 GCGCTCGGGCGCGCGGGGAGGGG - Intergenic
1118323159 14:64765042-64765064 GCGCGCGCGCGCGCGGGTGGTGG + Intronic
1118749026 14:68793387-68793409 GCCCGCGCGGCCCCGGAGAGGGG - Intronic
1118749484 14:68795639-68795661 GCCCGCGCCCCCGGGGAGAGGGG - Intronic
1118749486 14:68795641-68795663 GAGCCCGCGCCCCCGGGGAGAGG - Intronic
1118925547 14:70187869-70187891 GCACGCGGGCGCGCGCCGAGTGG + Intronic
1119296505 14:73537608-73537630 GAGCGCGCGCCCGCGCTGGGCGG + Exonic
1119300750 14:73569613-73569635 GAGCGCGCGCCCGCGCTGGGCGG + Exonic
1119306590 14:73612758-73612780 GAGCGCGCGCCCGCGCTGGGAGG + Intronic
1122300159 14:100726953-100726975 GGGCGCGGGCGCGCAGCGAGGGG - Exonic
1122689122 14:103523188-103523210 GCCCCCGCGGCGGCGGCGAGGGG + Intergenic
1122905717 14:104800656-104800678 GCGCGCGCGCGAGCGGCGACCGG + Intronic
1124109529 15:26773152-26773174 GCGCGCGCGGGCGCGGGGCGGGG + Intronic
1125503353 15:40252854-40252876 GGGCGGGCGCCCGCGGAGGGAGG - Exonic
1126736619 15:51737535-51737557 GCGAGCGCGGCGGCGGCGAGGGG + Exonic
1127674818 15:61228963-61228985 GAGCGGGCGCCCGGGGCGCGGGG - Intronic
1128067880 15:64775644-64775666 GGGCGGGCGCCGGCGGCGGGGGG + Intergenic
1128791138 15:70434707-70434729 GCGCGCGCGCGCGGGTGGAGCGG - Intergenic
1129052846 15:72796992-72797014 GCGAGAGCGGCCGCGGCGCGGGG + Intergenic
1129503207 15:76059798-76059820 GGGCGCGCGCGCGCGGCCGGCGG + Intergenic
1129503209 15:76059802-76059824 GCGCGCGCGCGGCCGGCGGGAGG + Intergenic
1130002613 15:80060055-80060077 GCGCGGGCGCCCGCGGCCGGGGG + Intronic
1131160429 15:90101868-90101890 CCGCGCGCTCCCCTGGCGAGAGG - Intronic
1132483972 16:180831-180853 GCACGCGTGCCAGCTGCGAGTGG + Exonic
1132586027 16:706043-706065 GTGCGGGTGCCCGCGGCGAGCGG - Intronic
1133097685 16:3458321-3458343 GCGCCCGCGCCCCCGGCGCACGG + Intronic
1133241235 16:4415901-4415923 GAGCTTGCGCCAGCGGCGAGAGG + Intronic
1133340666 16:5033677-5033699 GCGCGCGCGCGCGCGTGGATAGG + Exonic
1136141601 16:28292410-28292432 GCGCGAGGGCGCGCGCCGAGCGG + Intergenic
1136365000 16:29805912-29805934 GCGAGCGCGCGCGTGGCCAGCGG - Intergenic
1136592223 16:31224418-31224440 GTGCAGGCGCCCGCGGCGGGGGG - Exonic
1136724731 16:32348713-32348735 GCGCCGACGCCCGCGGCGACTGG + Intergenic
1136843057 16:33554753-33554775 GCGCCGACGCCCGCGGCGACTGG + Intergenic
1137787757 16:51151892-51151914 GCGCGCCGGCCCGCGGGGGGAGG + Intergenic
1138379279 16:56589272-56589294 GCGCGCACAGCGGCGGCGAGTGG + Intronic
1139866454 16:70065867-70065889 TCCCCCGCGCCCGCGGCCAGCGG + Intergenic
1140046122 16:71441613-71441635 GCGAGCGCGCCGGCCGCCAGGGG + Intergenic
1141694456 16:85613091-85613113 GCGCGCGCGCGCGCACCGACGGG - Intronic
1203001699 16_KI270728v1_random:169042-169064 GCGCCGACGCCCGCGGCGACTGG - Intergenic
1203133303 16_KI270728v1_random:1705448-1705470 GCGCCGACGCCCGCGGCGACTGG - Intergenic
1203153222 16_KI270728v1_random:1855051-1855073 GCGCCGACGCCCGCGGCGACTGG + Intergenic
1143099729 17:4498664-4498686 CCGCGAACGCCCGCGGGGAGCGG - Intergenic
1144211318 17:13017849-13017871 GCGCGGCCGCTCGCGGCGGGCGG + Exonic
1146794272 17:35770148-35770170 GCGCGCGCGGCGCGGGCGAGTGG + Exonic
1148842587 17:50508470-50508492 GCGCACGCGCCCGCCGCCGGCGG - Exonic
1149431455 17:56597653-56597675 GCGGGCGGGCCCGCGGAGGGAGG - Intergenic
1150643394 17:66964408-66964430 GCGCGCGCGGGCGCGGGGAGGGG + Intergenic
1152356466 17:79810006-79810028 GGGAGCGCGGCGGCGGCGAGTGG + Intergenic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1153051921 18:908167-908189 GCGCGCGCCCCCTCGGCGGCCGG - Intronic
1153457519 18:5296231-5296253 GCGCGCACGCGCGCGGCTTGGGG + Intronic
1153805649 18:8706477-8706499 GGACAGGCGCCCGCGGCGAGGGG - Intronic
1154241563 18:12657973-12657995 GCGCGCGCGGCCGCGTTGGGCGG - Exonic
1156171559 18:34493247-34493269 GCGTGCGCGCCCGCGGAGAGAGG + Intergenic
1157609987 18:48950174-48950196 GCGCCGGCGCCCGCGGCTGGCGG + Exonic
1160164114 18:76495320-76495342 GGGCGCGCGCGGGCGGCGCGAGG - Intergenic
1160592366 18:79951615-79951637 GCGCGCGGGTCAGCGGCGCGGGG - Exonic
1160597592 18:79988083-79988105 GAGCGCTCGACCGCAGCGAGGGG + Intronic
1160778325 19:866795-866817 GGGTGCGGGCCCGCGGCGGGTGG - Intergenic
1161643072 19:5436364-5436386 GCGCGCGCGCGTGCGGGGAGGGG + Intergenic
1161956950 19:7501402-7501424 GAGCGCGCGCCCGGGCTGAGTGG + Intronic
1162412990 19:10517603-10517625 GAGCGCGCCCCGGCGGCGACTGG + Intronic
1162485964 19:10960853-10960875 GCGCGCACGCGCGCCGGGAGCGG + Intergenic
1162753232 19:12841308-12841330 GCGCGTGCGCCCTGGGCGCGGGG + Intronic
1162940379 19:14005868-14005890 GCTCGCAGGCCCGCGGCGAGTGG - Intronic
1163427067 19:17245669-17245691 GCGCGGCCGCCCGTGGCGGGGGG + Exonic
1163631322 19:18419363-18419385 GCGGGGGCGCGCGCGGCGGGAGG + Exonic
1163708632 19:18832393-18832415 GCGCCCGCGCCCGCGCCGCCCGG - Exonic
1165428433 19:35758090-35758112 GTGCCCGCGCCGGAGGCGAGCGG - Intergenic
1165838012 19:38771079-38771101 GCACGCGCGCCAGCGGCAGGCGG + Exonic
1165841553 19:38791618-38791640 GCACGCGCGCCAGCGGCAGGCGG - Exonic
1165939875 19:39409752-39409774 GGGCGCGCGCCCAGAGCGAGCGG + Intergenic
1166094449 19:40530440-40530462 GGGCGCGCGGCCGCCGCGCGGGG + Intronic
1166888257 19:45973957-45973979 GCGCGGGCGGCGGCGGCGACGGG + Intergenic
1167072771 19:47230534-47230556 GGGCGCGCGCCCGCTGGGGGCGG - Intronic
1167134522 19:47608976-47608998 GGGCGCGGGCCCGGGGCGCGCGG + Intronic
1167347326 19:48954886-48954908 GCCCGCGCGGACCCGGCGAGAGG + Intronic
1167495810 19:49818245-49818267 GCGCGCGCGCTCGCGTCGGGCGG - Intergenic
1167579641 19:50333918-50333940 GCGCGCTCGCCCTCGCGGAGCGG - Intronic
925730706 2:6917886-6917908 GCGCGGGCGCCGCCTGCGAGAGG - Intronic
926020184 2:9487836-9487858 GCGCGCGCGCGCGCGCTGTGGGG + Intronic
926020186 2:9487838-9487860 GCGCGCGCGCGCGCTGTGGGGGG + Intronic
927472209 2:23385220-23385242 GCTGGCGCGGCCGCGGCGCGGGG - Exonic
928186471 2:29115486-29115508 GCGCGCGCGCCCACCCCGCGTGG + Exonic
928278300 2:29921621-29921643 GCGCGAGCGCGCGCAGGGAGGGG + Intergenic
928420949 2:31137707-31137729 GCGCGCTCGCCTGCGGAGCGGGG - Intronic
931614570 2:64143773-64143795 CCGCGCGCTCCGGCTGCGAGAGG - Intronic
934177135 2:89585597-89585619 GCGCGGGCGCAGGCGCCGAGAGG - Intergenic
934287442 2:91659956-91659978 GCGCGGGCGCAGGCGCCGAGAGG - Intergenic
934566852 2:95346236-95346258 CCGCGCGGGCCAGCGGCGCGGGG + Intronic
935301665 2:101698150-101698172 GCGAGCGGGCGCGCGGGGAGCGG + Intronic
935591887 2:104852548-104852570 GCGGGCGCACCCGCAGCTAGGGG + Intergenic
936279009 2:111122081-111122103 ACGTGCGCGTCCGCGGCCAGGGG + Intronic
937045003 2:118846593-118846615 GCGCCCGCGCCGGCGGCGGCTGG + Exonic
942023909 2:171894307-171894329 ACGCGCGCGGCGCCGGCGAGAGG - Intronic
944114245 2:196170958-196170980 CCGCGCGGGCCCGCCGCGAAGGG + Intronic
944632584 2:201642682-201642704 GCGCGCGCGACCGAGCCGGGAGG - Intronic
946219960 2:218217547-218217569 GAGCGCGCGCCCGGGGCCGGGGG + Intronic
948206921 2:236167415-236167437 GCGCGCGCAGCCGGGACGAGGGG - Intronic
1172109417 20:32536531-32536553 GCGTGCGCCCCGGCGGGGAGGGG + Intronic
1172118436 20:32584541-32584563 GCGCGCGCGGCGGCCGCGGGCGG - Intronic
1175429600 20:58891944-58891966 GAGCGCGCGCCCGGGGCGGGGGG - Intronic
1175911502 20:62407312-62407334 GCGCGCGGGCGCGCGGGCAGGGG - Intergenic
1176178521 20:63739484-63739506 GCGAGCGCGCCCGTGGGGAACGG + Intronic
1176380613 21:6110763-6110785 GCGGGCGCGCCCTCGGCGGTGGG + Intergenic
1176550108 21:8217233-8217255 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1176569036 21:8400268-8400290 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1176576950 21:8444503-8444525 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1178493651 21:33070155-33070177 GCGCGCAGGTCCGCGGGGAGGGG + Exonic
1179742859 21:43427477-43427499 GCGGGCGCGCCCTCGGCGGTGGG - Intergenic
1180110188 21:45643825-45643847 GCCCGCGGGCCGGCGGGGAGAGG - Exonic
1180614771 22:17120231-17120253 GCGGGGGCGCCGGCGGCGCGGGG - Exonic
1180699655 22:17774384-17774406 GCCCGCGCCCCCGCGGCTGGAGG - Intronic
1182222973 22:28773093-28773115 CTGCCCGCGCCCGCCGCGAGGGG - Intronic
1182236898 22:28883462-28883484 GCAGGCGCGCCTGCGGCGAGAGG - Intergenic
1183586501 22:38755894-38755916 GCGCGCGGGCACGCGAAGAGCGG + Exonic
1184593820 22:45502726-45502748 GGGCGCGCGCCCACGGCTGGGGG - Intronic
1184680709 22:46071117-46071139 GCCCGCGCGGCCGAGGCGGGCGG - Intronic
1184680781 22:46071328-46071350 GCGCGCGCGGGCGGGGCGGGCGG - Intronic
1185351750 22:50343259-50343281 GCGCGCACGCTCGCGGCCGGGGG - Intergenic
1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
949860646 3:8501738-8501760 GCGCGAGCGCCGGCGCGGAGTGG + Exonic
950683872 3:14602880-14602902 GTGAGCGCGCGCGCGGCGCGGGG - Intergenic
952867232 3:37862128-37862150 GCGCGCGGGGGCGCGGCGCGGGG - Intronic
954392682 3:50275781-50275803 CCACGCGCGCCTGCAGCGAGCGG - Exonic
961545275 3:127629063-127629085 GGGGGCGCGCCCGCGGCACGCGG + Intergenic
961827329 3:129606029-129606051 CCCCCCGCGCCCGCGGCGGGAGG + Exonic
965590558 3:170357368-170357390 GGGCGCGCGCCTGGGGGGAGGGG + Intergenic
968775483 4:2537117-2537139 GCGCTCGCGCCCGCGCCGAGAGG - Intronic
969344744 4:6563682-6563704 GAGCGCGGGCCCGGGGCGGGGGG + Intergenic
972312035 4:37890983-37891005 GCGAGCGCGCTGGAGGCGAGGGG - Intergenic
973931067 4:55793688-55793710 CCGCGCCCGCCCGGGGCGAGGGG - Intergenic
974000371 4:56505818-56505840 GCACGCGGGCACGCGGCGGGAGG + Intronic
977908461 4:102502365-102502387 GCGCGCGCGCGCACGGAGGGGGG - Intronic
977908463 4:102502367-102502389 GCGCGCGCGCGCGCACGGAGGGG - Intronic
978576809 4:110197088-110197110 GCGCTCGCGCACGCGGCGGGCGG + Intronic
985537939 5:475016-475038 GCGTGCGGGCCCTCTGCGAGGGG + Exonic
985897111 5:2755238-2755260 TCGTGCGCGCGGGCGGCGAGGGG + Exonic
986402853 5:7396226-7396248 ACGCGGGCGGCCGCGGCGAGCGG + Exonic
993901162 5:93584945-93584967 GCGCGCGGGCGCGCTGGGAGGGG - Exonic
994525434 5:100900859-100900881 GCCAGAGCGCCGGCGGCGAGGGG - Intronic
996765277 5:127030022-127030044 GCCTCCGCGCCCGCGGCGTGCGG - Intronic
997317499 5:132949706-132949728 GCGCGCGCGCGCCAGGCGTGAGG + Intronic
998018907 5:138753596-138753618 GCTCGCCCGCCCGCGGCTCGCGG - Intronic
998280055 5:140797140-140797162 GCGCGCGCACCCTCGGTGGGTGG - Exonic
998288230 5:140884444-140884466 GCGCACGCGCCCTCGGTGGGCGG - Exonic
1001577072 5:172771386-172771408 GCGAGCCAGCGCGCGGCGAGCGG - Intergenic
1002487732 5:179550923-179550945 GCGCCCGCGCCGGCGGCCAGCGG - Intronic
1002521758 5:179796260-179796282 GCGCGCGCGCTCGCGTACAGCGG - Exonic
1002692433 5:181059580-181059602 GCGCGTGCCCCCGCGGCGCCTGG + Exonic
1003187974 6:3849393-3849415 TCGCGAGAGCCCGGGGCGAGTGG + Exonic
1004272886 6:14211084-14211106 GTGCGTGCGCCCGCCGCGCGCGG - Intergenic
1004561803 6:16759967-16759989 GCGCGCGCGCGCCGGGCGGGGGG - Intronic
1005554181 6:26956623-26956645 GCGCGGGAGCCCGCGGCTGGGGG + Intergenic
1006271989 6:32972084-32972106 GCGAGCGCGCGCGCGCGGAGGGG + Exonic
1007451311 6:41941772-41941794 GCGCGCGCGCGGGCGGCGGGCGG - Exonic
1007644465 6:43369536-43369558 GAGCGCGCCCCCGCGGCTGGCGG + Intergenic
1012245789 6:96924497-96924519 GCGAGCGCGCTGGCGGCGGGCGG + Intergenic
1016340893 6:143060762-143060784 GGGCGCGCGCCCCCGGGGACTGG - Intronic
1017880551 6:158559992-158560014 GGCCGCGGGCGCGCGGCGAGGGG - Intronic
1019343498 7:519215-519237 GAGTGCGCGCCCGCAGCGCGGGG + Exonic
1019395812 7:816978-817000 GCGCGGGAGGCCGCGGCGGGCGG + Intronic
1019659514 7:2216149-2216171 GAGCGCGCACCTGCGGTGAGGGG - Exonic
1019828210 7:3301223-3301245 GCGAGCGCGACCGCGACGTGCGG + Intergenic
1020278219 7:6637276-6637298 CCGCCCGCGCCCGCGGGGGGAGG - Intergenic
1021998338 7:26201638-26201660 GCGGGCGCGCGCCCGGCGGGGGG - Intronic
1022715188 7:32891997-32892019 GCGCGCGCGCGCGAGGCGGGAGG - Intronic
1023405814 7:39833274-39833296 GCGCGCGAGCGAGCGGAGAGCGG + Intergenic
1025033059 7:55572618-55572640 GTGCGCGCGCCCCGGGCGGGAGG + Intronic
1025916841 7:65873122-65873144 GCGCGCGCGGGCGCGGAGGGAGG - Intergenic
1027250139 7:76393724-76393746 GCGCACAGGCCCGCGGCCAGAGG + Intronic
1029536997 7:101162952-101162974 GCGCGCGCGGCGGGGGCGCGCGG + Exonic
1029640441 7:101816484-101816506 GTGCGCGCGCGAGCGGGGAGCGG + Intronic
1031899486 7:127393001-127393023 GCGTGCGCGCCCACGGAGACGGG + Intronic
1033300018 7:140177054-140177076 GCGCGCGAGGCCGCGGCGGCTGG + Intergenic
1033662003 7:143408732-143408754 GCGCGCGCCCCCGGGGGCAGCGG + Exonic
1034306654 7:150049081-150049103 GCCCGAGAGCGCGCGGCGAGTGG - Intergenic
1034800191 7:154051562-154051584 GCCCGAGAGCGCGCGGCGAGTGG + Intronic
1034951235 7:155298117-155298139 GTGCGCCCGCCCGGGGCCAGCGG - Intronic
1035683535 8:1507235-1507257 GCGCGGGAGCCCACCGCGAGGGG + Intronic
1036163038 8:6406741-6406763 CCGAGTGCGCCCGCGACGAGGGG - Intronic
1037878413 8:22560873-22560895 GCGCGCGCGCACGCGCCGTGGGG + Intronic
1037900478 8:22685429-22685451 GCGCGCGCGCGCGCGCGGGGAGG + Intergenic
1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG + Intergenic
1038008842 8:23457709-23457731 GTGCGCGCTCCCGCCGCCAGCGG - Intergenic
1038554039 8:28494279-28494301 GCGCGGCCGCCCGCGGCAGGCGG + Exonic
1038767911 8:30446845-30446867 GCGCGCGCGCGCGCGGTGGAGGG + Intronic
1047998579 8:130358598-130358620 GCGCACACTCCCGCGGCGGGCGG + Intronic
1048576002 8:135690536-135690558 GCACGGGAGCCCGCCGCGAGGGG + Intergenic
1049212182 8:141391917-141391939 GGGCGCGCGGCCGCGGCGTGGGG + Intergenic
1049212236 8:141392102-141392124 CCGCGCGCCCCCGCCCCGAGCGG - Intronic
1049396441 8:142403190-142403212 GCGCGCACGCCGGCGGCGGGAGG - Intronic
1049724320 8:144138441-144138463 GCGCCCGCGCGGGCGGGGAGGGG + Intronic
1051206406 9:14693403-14693425 GCCCGCGCGCCCGCGTGGGGAGG + Exonic
1057995609 9:99819940-99819962 GGGCGCGAGCCCGCCGCGTGAGG - Intergenic
1058058549 9:100473238-100473260 GCGGGCGCGCGCGCGGCGGGCGG - Exonic
1060283373 9:122228490-122228512 GCGCGCGCGCGAGCGGGGGGGGG - Intronic
1060952265 9:127612017-127612039 CCGCGCGCGCCCGGGGCGCAGGG - Intergenic
1061108792 9:128552528-128552550 ACGCGCGCTCCCGCGGCGGGCGG - Intergenic
1061540900 9:131277469-131277491 GCGAGCGCGCCCGACGCGTGGGG - Intergenic
1061976103 9:134068539-134068561 GAGCGCGCGCGCGGGGCGGGGGG + Intergenic
1062230874 9:135480554-135480576 GTGAGCGCGCCCTCGGGGAGGGG + Intronic
1203471401 Un_GL000220v1:116705-116727 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1189310602 X:40014816-40014838 GCGCGCGCGCTCGTGGAGCGGGG - Intergenic
1189310604 X:40014818-40014840 GCGCGCGCGCGCTCGTGGAGCGG - Intergenic
1189473635 X:41333221-41333243 GCGCGCGCGCACACGTCGGGGGG + Intergenic
1189821326 X:44872779-44872801 CCGCTCGCGCCCGCCGCGGGCGG + Intergenic
1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG + Intronic
1198531289 X:137551101-137551123 GCGCCCGCGCTTTCGGCGAGCGG - Intergenic
1199086452 X:143634722-143634744 GCGCGCGCACGCGAGCCGAGGGG - Intronic
1200128999 X:153830913-153830935 GCGAGCGCGCCCACGGCGGCGGG + Intergenic