ID: 902350069

View in Genome Browser
Species Human (GRCh38)
Location 1:15847799-15847821
Sequence GGCAGCGCATGCGCCCGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 165}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902350069_902350077 -1 Left 902350069 1:15847799-15847821 CCTGCCCGGGCGCATGCGCTGCC 0: 1
1: 0
2: 1
3: 14
4: 165
Right 902350077 1:15847821-15847843 CGGAGCGCGAGGGTCGGCTTCGG 0: 1
1: 0
2: 0
3: 1
4: 35
902350069_902350080 10 Left 902350069 1:15847799-15847821 CCTGCCCGGGCGCATGCGCTGCC 0: 1
1: 0
2: 1
3: 14
4: 165
Right 902350080 1:15847832-15847854 GGTCGGCTTCGGGTGTGTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 106
902350069_902350078 0 Left 902350069 1:15847799-15847821 CCTGCCCGGGCGCATGCGCTGCC 0: 1
1: 0
2: 1
3: 14
4: 165
Right 902350078 1:15847822-15847844 GGAGCGCGAGGGTCGGCTTCGGG 0: 1
1: 0
2: 0
3: 5
4: 69
902350069_902350075 -7 Left 902350069 1:15847799-15847821 CCTGCCCGGGCGCATGCGCTGCC 0: 1
1: 0
2: 1
3: 14
4: 165
Right 902350075 1:15847815-15847837 CGCTGCCGGAGCGCGAGGGTCGG 0: 1
1: 0
2: 0
3: 5
4: 72
902350069_902350079 7 Left 902350069 1:15847799-15847821 CCTGCCCGGGCGCATGCGCTGCC 0: 1
1: 0
2: 1
3: 14
4: 165
Right 902350079 1:15847829-15847851 GAGGGTCGGCTTCGGGTGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 90
902350069_902350081 13 Left 902350069 1:15847799-15847821 CCTGCCCGGGCGCATGCGCTGCC 0: 1
1: 0
2: 1
3: 14
4: 165
Right 902350081 1:15847835-15847857 CGGCTTCGGGTGTGTGGTGGCGG 0: 1
1: 0
2: 1
3: 9
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902350069 Original CRISPR GGCAGCGCATGCGCCCGGGC AGG (reversed) Intergenic