ID: 902355541

View in Genome Browser
Species Human (GRCh38)
Location 1:15896555-15896577
Sequence TGATTAATTTATTACTTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 410}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902355539_902355541 -7 Left 902355539 1:15896539-15896561 CCTAAATCTTACCTATTGATTAA 0: 1
1: 0
2: 3
3: 20
4: 297
Right 902355541 1:15896555-15896577 TGATTAATTTATTACTTAAGTGG 0: 1
1: 0
2: 3
3: 30
4: 410
902355538_902355541 17 Left 902355538 1:15896515-15896537 CCATCAACACTAAATCTAGTTAA 0: 1
1: 0
2: 1
3: 15
4: 174
Right 902355541 1:15896555-15896577 TGATTAATTTATTACTTAAGTGG 0: 1
1: 0
2: 3
3: 30
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902355541 Original CRISPR TGATTAATTTATTACTTAAG TGG Intronic