ID: 902355541 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:15896555-15896577 |
| Sequence | TGATTAATTTATTACTTAAG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 444 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 30, 4: 410} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 902355539_902355541 | -7 | Left | 902355539 | 1:15896539-15896561 | CCTAAATCTTACCTATTGATTAA | 0: 1 1: 0 2: 3 3: 20 4: 297 |
||
| Right | 902355541 | 1:15896555-15896577 | TGATTAATTTATTACTTAAGTGG | 0: 1 1: 0 2: 3 3: 30 4: 410 |
||||
| 902355538_902355541 | 17 | Left | 902355538 | 1:15896515-15896537 | CCATCAACACTAAATCTAGTTAA | 0: 1 1: 0 2: 1 3: 15 4: 174 |
||
| Right | 902355541 | 1:15896555-15896577 | TGATTAATTTATTACTTAAGTGG | 0: 1 1: 0 2: 3 3: 30 4: 410 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 902355541 | Original CRISPR | TGATTAATTTATTACTTAAG TGG | Intronic | ||