ID: 902357589

View in Genome Browser
Species Human (GRCh38)
Location 1:15916834-15916856
Sequence ATGAAGCAGCAGGCTGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 591
Summary {0: 1, 1: 4, 2: 4, 3: 50, 4: 532}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902357586_902357589 23 Left 902357586 1:15916788-15916810 CCTGTGGATTGAAAGGAAAATCT 0: 1
1: 0
2: 1
3: 39
4: 3634
Right 902357589 1:15916834-15916856 ATGAAGCAGCAGGCTGAGCATGG 0: 1
1: 4
2: 4
3: 50
4: 532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902357589 Original CRISPR ATGAAGCAGCAGGCTGAGCA TGG Intronic
901266386 1:7914059-7914081 AGGAAGCCACAGGGTGAGCAGGG - Intergenic
901907287 1:12424587-12424609 ATGAAGGAGCCAGGTGAGCAGGG + Intronic
902281630 1:15378950-15378972 AGCAAGCAGCCGGCTGAGCAGGG + Intronic
902357589 1:15916834-15916856 ATGAAGCAGCAGGCTGAGCATGG + Intronic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
902606507 1:17572268-17572290 ATGGAGCAGGGGGCTGAGGAGGG - Intronic
902826020 1:18974830-18974852 AGGTAGCAGGAGGCAGAGCAAGG + Intergenic
903024395 1:20417150-20417172 ATGAAGAAGCAGGCTGAGAGAGG - Intergenic
903147785 1:21386616-21386638 AGGATGCAGTAGGCTGGGCACGG + Intergenic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903905536 1:26683353-26683375 AGGAAGAAGCAGGCTGGGCATGG - Intergenic
903933227 1:26876506-26876528 ATGAAAGAGAAGGCCGAGCACGG - Exonic
903985329 1:27223419-27223441 ATGATGCTAGAGGCTGAGCACGG - Intergenic
904389482 1:30172528-30172550 GTGGGCCAGCAGGCTGAGCATGG + Intergenic
904497012 1:30892768-30892790 ATGAAGCTGGAGGGTGACCATGG - Intronic
904619079 1:31764549-31764571 AAGAAGCAGCGGGCTGGGCGGGG - Intronic
904938859 1:34151014-34151036 TTAAAGCAGCAGGCTGTGCTTGG - Intronic
905227808 1:36491305-36491327 ATGAGGCTGCAGGGTGAGGAAGG - Intergenic
905407005 1:37740593-37740615 ATAAAGCAACTGGCTGGGCACGG - Intronic
905481406 1:38264508-38264530 CTGAAGCAACAGCCTGGGCATGG + Intergenic
906179631 1:43807124-43807146 GTGAAGTAGGAGGCTGGGCACGG + Intronic
906557082 1:46722368-46722390 ATGAAGCAGAAGACTGGGCTAGG - Intergenic
906645958 1:47475275-47475297 ATGAAGCTGGAGCATGAGCAGGG - Intergenic
906647211 1:47483786-47483808 ATGACCAAGCAGGCTGAGGATGG + Intergenic
906651331 1:47515209-47515231 CTGGAGCAGAGGGCTGAGCAAGG - Intergenic
907184509 1:52599624-52599646 AAGAAGGAGCAGGATGGGCAGGG + Intergenic
908113898 1:60922865-60922887 CTTAAGCAGGAGTCTGAGCAAGG + Intronic
908916347 1:69130602-69130624 ATGAATGAACAGGCTGGGCACGG - Intergenic
909274976 1:73671618-73671640 ATCACACAGAAGGCTGAGCATGG - Intergenic
909895339 1:81061924-81061946 ATGAGACAGCATGCTAAGCATGG + Intergenic
910039937 1:82838117-82838139 ATGACAAAGCAGGCAGAGCAAGG - Intergenic
910428351 1:87137945-87137967 ATGGAACAGCGGGATGAGCATGG + Intronic
910867737 1:91803451-91803473 CAGAAGCAGCATGCTGAGGAGGG + Intronic
910965787 1:92806774-92806796 ATGAAAAAGCAGGCTGGGCTTGG + Intergenic
911724907 1:101233157-101233179 AGGAAGCAGCATGCTGACCTGGG + Intergenic
912643390 1:111368867-111368889 CTGAACCAAGAGGCTGAGCAAGG - Intergenic
913315814 1:117550323-117550345 ATCCAGCAGCAGCCTGAGAAGGG - Intergenic
914693593 1:150054515-150054537 AAGAAGCTGCAGGCAGGGCATGG + Intergenic
915062725 1:153199554-153199576 AAGAGGCAGCTGGGTGAGCAAGG + Intergenic
915968213 1:160330881-160330903 AAGAAACAACAGGCTGGGCATGG + Intronic
916008200 1:160680864-160680886 CTGAAACATCAGGGTGAGCAGGG - Intronic
916554348 1:165880879-165880901 ATGATGTAGCAGGCTGGGCGTGG + Intronic
917199374 1:172499040-172499062 TTGCAGCTGCAGGCTGAGCCTGG - Intergenic
917834433 1:178930152-178930174 ATGAAGCAGCAGAGAGAGCCTGG + Intergenic
918121456 1:181544737-181544759 GGGAAGCAGCAGGCTGACCCCGG + Intronic
918345179 1:183601565-183601587 ATGGTGAATCAGGCTGAGCACGG + Intergenic
919350566 1:196448122-196448144 ATGAAAAAGAAGGCAGAGCATGG + Intronic
919642663 1:200060507-200060529 CTGAGGCTGCAGGCTTAGCAAGG + Intronic
919983407 1:202656734-202656756 ATGAAGCAGGAGGTTGGGCTGGG - Intronic
920044093 1:203122351-203122373 GTGAATGAGCAGCCTGAGCAAGG - Intronic
920528993 1:206688045-206688067 GAGAAGCAGCAGGGTGAGCTGGG - Intronic
920534064 1:206726093-206726115 ATGAAGTTGAAGGCTGGGCATGG + Intronic
920563599 1:206956789-206956811 ATGAGGGAGCAGGCTCTGCAAGG - Intergenic
921828482 1:219700702-219700724 ATCAATCAGCAGGCTTTGCATGG - Intronic
921861222 1:220044432-220044454 ATGTATCAGGAGGCTGGGCATGG + Intronic
921862790 1:220056716-220056738 ATACAGAAGCAGGCTGAGCGTGG + Intergenic
921931401 1:220757190-220757212 AAGAGGCTTCAGGCTGAGCACGG - Intronic
922100609 1:222474601-222474623 GGGAAGCAGGAGGCTGGGCATGG + Intergenic
923329035 1:232905732-232905754 CTGAGGCAGGAGGCTGAGCAGGG - Intergenic
924253983 1:242163798-242163820 ATCAAAGAGCAGGATGAGCAGGG + Intronic
924615885 1:245611749-245611771 ATGAGGCTGCAGGCTGAGGAGGG - Intronic
1062819094 10:520619-520641 AAGGAGCTGCAGGCAGAGCAGGG - Intronic
1063128754 10:3159367-3159389 ACGGAGCTGCAGGCTGAGCACGG + Intronic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1064404776 10:15051990-15052012 ATGTGGCTGCAGGCTGGGCATGG + Intronic
1064681307 10:17813101-17813123 ATGAAGCACCAGGCTCAGGGAGG + Intronic
1065612318 10:27484347-27484369 GTTAAGTAGCTGGCTGAGCATGG + Intergenic
1066633758 10:37481115-37481137 AAAAAGCTGCAGGCTGGGCATGG + Intergenic
1067154030 10:43759955-43759977 ACCAATCAGCAGGCTGTGCATGG - Intergenic
1070084872 10:73227373-73227395 ATGACCAAGCAGGCTGGGCATGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070462182 10:76681261-76681283 ATCAAGCAGCAGGCAAGGCAGGG + Intergenic
1070571308 10:77640890-77640912 ATGAAAAAGAAGGCTGGGCATGG + Intergenic
1070614001 10:77955015-77955037 AATATGCATCAGGCTGAGCACGG - Intergenic
1070828818 10:79406441-79406463 GTGAAGAAGCAGGGTCAGCAGGG - Intronic
1070832191 10:79424886-79424908 ACGAAGCTCCAGGCTGAGCTGGG + Intronic
1071214396 10:83382968-83382990 ATTCAGAAGCAGGCTGGGCACGG + Intergenic
1072136630 10:92553131-92553153 AAGAAAAAGCAGGCTGGGCATGG + Intronic
1072537304 10:96373429-96373451 ATGAAGCATCAAGCTGGGCGTGG - Intronic
1072633856 10:97164910-97164932 AGGAAGCAGTGGGGTGAGCAGGG + Intronic
1073122213 10:101129396-101129418 ACTAAGCAGAAGGCTGGGCATGG - Intronic
1074524345 10:114251257-114251279 ATGAAGCAGCTGCCTGTTCAGGG + Intronic
1075580903 10:123617606-123617628 CTGAAGTGGCAGGGTGAGCAAGG + Intergenic
1076236282 10:128865638-128865660 AGGAAGCAGCATGCTGTGAAAGG + Intergenic
1076242639 10:128921401-128921423 AGAAAGTTGCAGGCTGAGCAGGG - Intergenic
1077059144 11:610131-610153 ATGAAACAGCATTCTGGGCAGGG + Intronic
1077545619 11:3168364-3168386 ATGAACCAGGTGGCAGAGCACGG - Intergenic
1077728028 11:4696275-4696297 ATGAAGCAGGAGGAAGAGCCAGG - Intronic
1078856614 11:15210555-15210577 GGGATGCAGCAGGCTTAGCAGGG + Intronic
1079198289 11:18351135-18351157 ATTAAGCCGGAAGCTGAGCATGG + Intronic
1079285469 11:19126638-19126660 AAGGAACAGCAGGCTGGGCATGG - Intronic
1080486198 11:32709584-32709606 ATCCAACAGCAGGCTGTGCATGG - Intronic
1080561055 11:33463117-33463139 AAGAAAAAGCTGGCTGAGCATGG - Intergenic
1080929931 11:36799395-36799417 ATGAAGCATCAGGATCAGAATGG - Intergenic
1082066656 11:47906277-47906299 AGGTGGCAGCAGGCTGGGCATGG + Intergenic
1083440912 11:62675948-62675970 ATAAAGCAGCAGGCCGGGCGTGG + Intergenic
1083488963 11:63000877-63000899 ATGAGGCCACAGGCTGAGCATGG - Intronic
1083904324 11:65660271-65660293 AGGAAGGAGCAGGCTGGGCAAGG - Intronic
1083957077 11:65990106-65990128 ACGAAGCACCAGGCCGGGCACGG + Intergenic
1084041234 11:66543828-66543850 ATGAAGCAGCAGGCACAGGAAGG + Exonic
1084082845 11:66840286-66840308 ATGAAGCAGGAGGCAGAGACTGG - Intronic
1084489955 11:69472819-69472841 AAGGAGCAGCAGGCTGTGAAAGG + Intergenic
1084556480 11:69879129-69879151 ATGATGGAGGAGGTTGAGCAGGG + Intergenic
1084912354 11:72401037-72401059 ATGAAGAAACAGGCTGTCCATGG + Intronic
1085080692 11:73631440-73631462 ATGAGACAGCAGGCCCAGCATGG - Intergenic
1085415372 11:76315919-76315941 ATGAAGCTGCAGGCTGGGCATGG + Intergenic
1085517785 11:77121576-77121598 AGGAAGCAGCAGGCTCACCCAGG - Intronic
1086040817 11:82476054-82476076 ATAAAAGAGCAGGCTGGGCAGGG - Intergenic
1086759950 11:90616208-90616230 ATGAAGAAGCAGCATGAACATGG - Intergenic
1087126726 11:94635205-94635227 AAGAAGCAGCAGACACAGCATGG - Intergenic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1089343299 11:117774121-117774143 ATAAGACAGCAGGCTGGGCATGG - Intronic
1089351365 11:117823450-117823472 AGGAAGCAGGGGGCTGAGAATGG + Intronic
1090387812 11:126366712-126366734 ATCAAGCACCAGGCTGACCATGG + Intronic
1091235316 11:134018249-134018271 GTGGATCAGCAGGCTGAGAAGGG - Intergenic
1091563522 12:1631353-1631375 CAGCAGCAGCAGGCTGGGCATGG - Exonic
1091902396 12:4154836-4154858 ATAAAGCTGCTGGCTGGGCACGG - Intergenic
1092216070 12:6683726-6683748 AGGAAGGAGGAGGCTGAGCACGG + Intronic
1092273515 12:7041600-7041622 AGGAAGCAGCAGGCTCACCAAGG - Intronic
1092372789 12:7931090-7931112 CTGAAGAAGCAGGCTGAGGCCGG - Intronic
1093732572 12:22582702-22582724 ATGAAGGGTCAGGCTGGGCATGG + Intergenic
1094581830 12:31740418-31740440 AAGTAGCAGGAGTCTGAGCATGG + Intergenic
1095480425 12:42629138-42629160 ATGAAGCTCTAGGCTGCGCACGG - Intergenic
1095747412 12:45675193-45675215 CTAAAGGAGCAGGGTGAGCAGGG + Intergenic
1096783222 12:54002676-54002698 CTGAGGCAGCAGGCTGGGTAGGG - Exonic
1096866227 12:54565214-54565236 ATGAAGCAGAAGGCTGGGGTGGG + Intronic
1096887069 12:54728737-54728759 ATAGAGCATCAGGCTGGGCATGG + Intergenic
1098571219 12:71989433-71989455 AGGAAGCAGGAGGATGAGCTGGG - Intronic
1099944077 12:89224341-89224363 TTGAATCAGTAGGCTGAGAAAGG + Intergenic
1100478723 12:94957754-94957776 ATGATGCTGTAGGCTGGGCATGG + Intronic
1100725442 12:97403591-97403613 ATGCAGCAGGAGGCTGAGGCAGG + Intergenic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1102119327 12:110428761-110428783 ATGCTGCAGCAGAGTGAGCAAGG - Intergenic
1103322787 12:120101661-120101683 ATGAGGCAGGAGGCCCAGCAGGG - Intronic
1103411577 12:120715821-120715843 ATGAATCAGAGGGCTGGGCACGG - Intronic
1104044619 12:125153099-125153121 ATGACCCAGCTGGCTGAGCCAGG - Intergenic
1104047506 12:125173547-125173569 ATGGAGCAGCAAGCACAGCATGG - Intergenic
1105305005 13:19161977-19161999 AGGAAGCAGCAGGCTGAGCAGGG + Intergenic
1106080910 13:26499788-26499810 AAGATGCAGCAGGCGGAGCGTGG + Intergenic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1106373044 13:29155544-29155566 ATGAAGAGGCAGGCTCAGGATGG + Intronic
1106643922 13:31613066-31613088 ATGAAACAAAAGGCTGAGTAAGG - Intergenic
1106800154 13:33248107-33248129 AAGAAGAAGAAGGCTGGGCATGG + Intronic
1106833921 13:33613797-33613819 ATTTAGCAGCAGGGTGAGGAAGG + Intergenic
1107442128 13:40437424-40437446 ATTAAACAGGAGGCTGGGCAAGG + Intergenic
1107626008 13:42284867-42284889 TTGAAGCAGCAGCATGAGAAAGG - Intronic
1107840235 13:44450214-44450236 ATGAAGCAGCATGCTGAGTTTGG + Intronic
1108354367 13:49617086-49617108 CTGAGGCAGGAGGCTGAGCTTGG + Intergenic
1108604926 13:52027965-52027987 ATAAAGCAGCAGGCTGGGTGTGG + Intronic
1108671552 13:52694976-52694998 ATCTACCAGCAGGCTGGGCATGG - Intronic
1108859215 13:54832946-54832968 ATGAAGCAGCATCCTGAACCAGG - Intergenic
1109210006 13:59524248-59524270 CTGAAGCAGCTGGCTGTCCAGGG + Intergenic
1109266320 13:60204979-60205001 AGGAAGCAGAAGGCTGGACATGG + Intergenic
1110204964 13:72901396-72901418 AAAAAGCAGTAGGCTGGGCACGG + Intronic
1112070303 13:95842913-95842935 ATGAAGCAGAACACTGAGCTAGG + Intronic
1112321214 13:98409455-98409477 ATTCAGCAGCGGGCTGATCAAGG - Exonic
1112391935 13:98993004-98993026 ATGAAGCAGCACCCCCAGCATGG + Intronic
1112566296 13:100553553-100553575 AAGAAGTAGCAGGCCGGGCATGG + Intronic
1112870860 13:103969047-103969069 AGGAAGCAGGAGGGTGAGGAGGG + Intergenic
1113630813 13:111882389-111882411 ATGAAGCCACAGGCCGGGCACGG - Intergenic
1113766983 13:112887909-112887931 GGGAAGCAGGTGGCTGAGCAGGG - Intergenic
1113826326 13:113257213-113257235 ATGACAAAGCAGGCTGGGCATGG - Intronic
1114433545 14:22684101-22684123 ACGATGAAGCAGGCTGGGCATGG + Intergenic
1114633335 14:24173287-24173309 AGGAAGCAGCAGGCTGGGTCTGG - Exonic
1116039953 14:39674003-39674025 ATGGAGTAGTAGGATGAGCATGG - Intergenic
1116655742 14:47651449-47651471 ATGAGGCAGCAGAGTGGGCAGGG + Intronic
1116897950 14:50335449-50335471 TTTAAACAGCAGGCTGAGAAGGG - Intronic
1117740251 14:58811348-58811370 AAGCAGCATAAGGCTGAGCAGGG + Intergenic
1118302022 14:64624730-64624752 ATCAAGCAAGAGGCTGAGCGTGG + Intergenic
1118594182 14:67423359-67423381 ATGAAGAAGCTGGCTGTGGAGGG - Intergenic
1118683209 14:68264665-68264687 ACGAAGTAGGAGGTTGAGCAGGG + Intronic
1119393164 14:74305039-74305061 AAGAAGTAGCAGGCTGGGCACGG + Intronic
1119449698 14:74698731-74698753 ATGAGTAAGCAGGCTGAGCATGG + Intronic
1121171097 14:91855084-91855106 ATGAAGAAACAAGTTGAGCAGGG + Intronic
1121456404 14:94041542-94041564 AAGAAGATGCAGGCTGAGGAGGG - Intronic
1122045205 14:99018009-99018031 ATGAGGAAACAGGCTCAGCAAGG - Intergenic
1122077651 14:99246268-99246290 ATGGAGCAGCTGCCTGAGCCGGG - Intronic
1122385724 14:101345280-101345302 ATGTAGCAAAAGGCTGGGCATGG + Intergenic
1123759609 15:23422341-23422363 TTGAAGCAGCCCTCTGAGCAAGG + Intergenic
1123828935 15:24113698-24113720 ATGAAGAATGAGGCTGGGCATGG + Intergenic
1124500721 15:30224998-30225020 ATGGTGCAGCAGGCCGAGCTGGG + Intergenic
1124552022 15:30690332-30690354 AGGAAGCAGCAGGCTGTGTGTGG + Intronic
1124679221 15:31715340-31715362 AGGAAGCAGCAGGCTGTGTGTGG - Intronic
1124742849 15:32313669-32313691 ATGGTGCAGCAGGCCGAGCTGGG - Intergenic
1125758124 15:42079598-42079620 CTGGAGCTGCGGGCTGAGCAGGG - Exonic
1125878907 15:43175291-43175313 ATGAAGTGTTAGGCTGAGCAAGG + Intronic
1126632302 15:50749574-50749596 GTGAAGAAGGAGGCTGGGCACGG - Intronic
1127112046 15:55684801-55684823 ATGAAGGAACAGGATGAGAAAGG + Intronic
1127495044 15:59502872-59502894 AAAAAGAAGCAGGCTGGGCAGGG - Intronic
1128871258 15:71156951-71156973 ATGATGCAGCAGAGTAAGCAGGG - Intronic
1129423142 15:75445946-75445968 ACAAAGCAGTATGCTGAGCATGG - Intronic
1130612329 15:85372591-85372613 AAGAAACACCAGGCTGGGCATGG - Intergenic
1131165147 15:90136772-90136794 TTGAAGCTGGAGGCTGAGCTTGG - Intergenic
1131852106 15:96554529-96554551 TAGAAGCAGCAGGCTGAGTCTGG - Intergenic
1132659552 16:1055292-1055314 CTGAAGAATCAGGCGGAGCACGG - Intergenic
1132756834 16:1489505-1489527 AGGAGGCAGGAGGCTGAGGAAGG - Intergenic
1132761138 16:1509162-1509184 CTGAAGCACCAGGAGGAGCAGGG + Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1135764730 16:25167600-25167622 ATTAGGCAACAAGCTGAGCATGG - Intronic
1135984463 16:27173881-27173903 CTGCAGCAGCGGGCTGGGCAGGG - Intergenic
1136392953 16:29976923-29976945 ATAAAGAAACAGGCTCAGCAAGG - Intronic
1137494164 16:48956837-48956859 AGGTAGCACTAGGCTGAGCAGGG - Intergenic
1137662205 16:50218045-50218067 AGTAAGGTGCAGGCTGAGCATGG - Intronic
1138195717 16:55050682-55050704 ATGAATCAGGTGTCTGAGCATGG - Intergenic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1138637454 16:58352415-58352437 AAGAATCAGCAGGCTGTGAAAGG - Intronic
1138778122 16:59749877-59749899 TCAAAGCAGCAGGCTGATCAGGG + Intronic
1139330961 16:66189555-66189577 ATGGAGCAGCAGCCAGAGCTGGG - Intergenic
1139345796 16:66302838-66302860 ATGATGCAGTAGGCAGAGCAAGG + Intergenic
1139633846 16:68246235-68246257 ATCAAGGAGCGGGGTGAGCAGGG - Intronic
1139656855 16:68393112-68393134 ATGGACCAGGAGGCTGGGCATGG + Intronic
1139803683 16:69545405-69545427 ATGAAACAGAAGGCTGGGCACGG + Intergenic
1141000450 16:80302666-80302688 ATGGACAAGCAGGCTGGGCATGG - Intergenic
1142424795 16:89995994-89996016 ATGACTCAGCAGACTCAGCAGGG + Intergenic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1143509025 17:7385072-7385094 ATGAAGCCGCAGGCCGGGCGCGG + Intronic
1143838245 17:9710087-9710109 ATGGAGCTGCTGGCTGACCAGGG - Exonic
1143877475 17:10003109-10003131 ATGAAGCAGAAGGCTGGGGCTGG + Intronic
1143910194 17:10242619-10242641 AAGAAAAGGCAGGCTGAGCATGG + Intergenic
1144065761 17:11622764-11622786 AAGCAGCAGCAGCCTGAGAAAGG - Intronic
1146089835 17:29865808-29865830 ATGAGGGAGCAGGCTGGGCATGG + Intronic
1146287168 17:31581796-31581818 ATGAGGCAACAGGCTCAGCAGGG - Intergenic
1146326107 17:31887669-31887691 ATTAAATAGCAGGCTGGGCACGG + Intronic
1146610243 17:34298653-34298675 AGGAAGAAAAAGGCTGAGCATGG - Intergenic
1147296422 17:39486554-39486576 AAGAAAAATCAGGCTGAGCATGG - Intronic
1147846186 17:43405437-43405459 ATGAAGAAACTGGCTGGGCACGG + Intergenic
1148222991 17:45877696-45877718 ATGAGGCAGCATGCTAAGGATGG + Intergenic
1148563837 17:48621580-48621602 ATGAAGCAGGAGGCCAAGCCCGG + Exonic
1148624642 17:49059694-49059716 AGTAAGAATCAGGCTGAGCACGG + Intergenic
1148990339 17:51660627-51660649 ATGGAGCATCACGCTGAGAAAGG - Intronic
1150218030 17:63481032-63481054 ATGAAGAAGCAGGCACAGCCAGG + Intergenic
1151993924 17:77596763-77596785 ATGAAGGTGCAGGCTGCGGAAGG - Intergenic
1152221762 17:79072636-79072658 ATGAAGGAGGAGGCAGAGGAAGG + Intergenic
1152496976 17:80680094-80680116 AAGAGCCAGCAGGCTGAGGAGGG - Intronic
1152928056 17:83096897-83096919 CTGAAGCAGCAGGCTGGGGCTGG + Intergenic
1153101310 18:1473144-1473166 AAGTAGCAGCAGCCTGAGCCAGG - Intergenic
1153115727 18:1653137-1653159 ATTAGGGAGCAGGGTGAGCAGGG - Intergenic
1153319135 18:3754290-3754312 TTGAAGTAGGAGGCTGAGTACGG - Intronic
1156472007 18:37383264-37383286 GTGAAGCAGGAGGCTCAGGAAGG + Intronic
1156571478 18:38258423-38258445 ATGAAGCAGAAAACTGAGCCTGG + Intergenic
1157522496 18:48355033-48355055 ATGAAGCTGCAGGCAGAGCAGGG - Intronic
1157616920 18:48992499-48992521 ATGAGGCAGGAGGCAGAGGAGGG - Intergenic
1157687868 18:49657361-49657383 AGGCAGCAGCAGGGTGAGGATGG - Intergenic
1157884271 18:51351327-51351349 ATGAAGAAGCTGGCTGGGCATGG - Intergenic
1158162087 18:54496537-54496559 ATGAGCCAACAGGCTGAGAATGG - Intergenic
1158376354 18:56873662-56873684 ATGAAGCAGCTGCTGGAGCACGG - Intronic
1158416944 18:57256971-57256993 AGGGAGCAGGAGGCTGGGCAGGG + Intergenic
1158463256 18:57665839-57665861 AAGTAGCAACAGGCTGGGCACGG - Intronic
1158572248 18:58606371-58606393 TTAAAGTAACAGGCTGAGCATGG - Intronic
1158625165 18:59064607-59064629 ATAATGCTGCAGGCTGGGCATGG - Intergenic
1159105605 18:63999780-63999802 ATGTTGCACCAGGCTGAGTAAGG + Intronic
1159538139 18:69741159-69741181 TTTAAACAGCAGGCTCAGCAAGG + Intronic
1159856476 18:73595773-73595795 ATGAAGACGCAGGCTGAGACTGG + Intergenic
1160384179 18:78485071-78485093 AGGAGGCTGCAGGCAGAGCATGG - Intergenic
1160384246 18:78485407-78485429 AGGAGGCTGCAGGCAGAGCATGG - Intergenic
1160384281 18:78485573-78485595 AGGAGGCTGCAGGCAGAGCATGG - Intergenic
1160384475 18:78486497-78486519 AGGAGGCTGCAGGCAGAGCATGG - Intergenic
1160513268 18:79464383-79464405 ATGAAACAGCAGGCCGGGCGCGG - Intronic
1160567479 18:79796166-79796188 ATGAATCAGCAGGGTGGGCGTGG + Intergenic
1160583750 18:79901570-79901592 AGGAAGCAGGAGGCCGAGGAGGG - Intergenic
1160725371 19:615905-615927 ATGGTGCAGCAGGCCGAGCTGGG + Exonic
1160807940 19:1000814-1000836 CCGCCGCAGCAGGCTGAGCACGG - Exonic
1161356834 19:3823698-3823720 ATGAAGTATCAGGCGGACCAAGG + Intronic
1161427576 19:4212405-4212427 ATGAAGCAGGAGGTGGGGCAGGG + Intronic
1161886364 19:6999265-6999287 ATGATGCAGCAGGCTGGGCGCGG - Intergenic
1162353938 19:10169118-10169140 ATGCAGCCTCAGGCTGGGCATGG - Intronic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1162947023 19:14050209-14050231 ATGAAGCAAGGGGCTGGGCAAGG + Intronic
1163100202 19:15091233-15091255 AAGTAACAGCAGGCTGCGCATGG + Intergenic
1163785187 19:19271295-19271317 AGGAAGAAACAGCCTGAGCAAGG - Intronic
1166226886 19:41401530-41401552 ATGAAGGAGTGGGCAGAGCAGGG - Intronic
1166233496 19:41439764-41439786 GTGAGGCAGCAGGCTAAGCCTGG - Intronic
1166388077 19:42393111-42393133 AGGAAACAGCAGGTTGAGGAAGG - Intergenic
1166544895 19:43628133-43628155 AGTAAGCAGGAGGCTGAGCGCGG + Intronic
1167188368 19:47964468-47964490 CTGATCCTGCAGGCTGAGCAAGG + Intergenic
1168054205 19:53852562-53852584 AAGAAGAAGAAGGCTGGGCACGG - Intergenic
1168717569 19:58538438-58538460 ATGAAGGGGCAGGCTGGGCGTGG + Intronic
926772498 2:16390978-16391000 AGGAAGGAGAAGGCTGAGAAGGG + Intergenic
926895117 2:17678475-17678497 GAAAAGCAGCAGGCTGGGCATGG + Intronic
927225077 2:20756323-20756345 ATGAGGCACCAGGCTGGGCACGG - Intronic
927356140 2:22175617-22175639 ATGAAGCATCAGGCAAAGCCTGG + Intergenic
927553723 2:24018550-24018572 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
928461066 2:31473091-31473113 ACAAAGGAGCAAGCTGAGCAAGG + Intergenic
928612572 2:33005077-33005099 TTAATGCAGCAGGCTCAGCATGG + Intronic
928859980 2:35846105-35846127 ATGCAGCTGCAGGATGTGCACGG - Intergenic
929053488 2:37857045-37857067 ATTAATTAACAGGCTGAGCACGG + Intergenic
929450501 2:42033754-42033776 GTAAAGGAGCAGGCTGGGCACGG + Intergenic
929905799 2:46045586-46045608 ATGAAGCATATGGCTGGGCATGG + Intronic
930846905 2:55916398-55916420 ATGAAGCAAGGGGCTGGGCACGG - Intronic
931117718 2:59182525-59182547 AGGAAGCAGCTGGGGGAGCAGGG + Intergenic
931209258 2:60177202-60177224 TTGAATCAGTAGGCTGAGTAAGG + Intergenic
931325839 2:61221759-61221781 ATAAAGCAGCAGGATCAGCGAGG + Intronic
932144350 2:69305499-69305521 CTAAGACAGCAGGCTGAGCAAGG + Intergenic
933182787 2:79245950-79245972 ATGAAGAAGCAGGCTGGGTTTGG - Intronic
935179314 2:100675881-100675903 TTGCAGGAGCTGGCTGAGCAGGG + Intergenic
936087543 2:109479565-109479587 AGGAAGCAGCAGCCAGGGCAGGG + Intronic
936351215 2:111714042-111714064 ATGACAAAGCAGGCTGGGCACGG + Intergenic
937176927 2:119947281-119947303 ATGAACCAGCAGCCTGAGAGAGG + Intronic
937867432 2:126763609-126763631 ATGAGGCAGCAGGCTCAGTGAGG + Intergenic
937962118 2:127468097-127468119 TTGAAGAAGCAGGCTCAGAAAGG - Intronic
938050949 2:128170935-128170957 GGGAAGCAGCAGGCAGATCATGG - Intronic
938254431 2:129844292-129844314 ATGTTGAAGCAGGCTGGGCATGG - Intergenic
938293816 2:130164313-130164335 AAGAAGCAGCAGGCTGAGCAGGG + Intronic
938462728 2:131508649-131508671 AAGAAGCAGCAGGCTGAGCAGGG - Intergenic
939250188 2:139672673-139672695 ATGAGGCTGCAGGCTTATCAAGG + Intergenic
939402661 2:141714676-141714698 AGGAAGCTGCATTCTGAGCAGGG + Intronic
939698437 2:145357917-145357939 ATAAAGCAGCAAGCGGGGCAAGG + Intergenic
940467348 2:154048020-154048042 ATGATTCAGCAGGCTGTTCAGGG + Intronic
942242471 2:173975691-173975713 ATCAAGAAGCAGGCTAAGCATGG + Intergenic
944691650 2:202164146-202164168 ATGAAGCTGTGGGTTGAGCAGGG + Intronic
945013066 2:205485593-205485615 ATGAAGCAGAACTCTGAGGATGG + Intronic
945927049 2:215816517-215816539 CAGAAGCTGCAGGCTGGGCACGG - Intergenic
946853398 2:223929476-223929498 GTTAAGCAGGAGGCTGGGCACGG - Intronic
947251000 2:228103587-228103609 AGCAAGCAGCAGGCTGCGGAGGG - Intronic
947527199 2:230886016-230886038 TTCAGGCAGAAGGCTGAGCACGG - Intergenic
947998071 2:234545062-234545084 ATGCAGCATCAGGCAGCGCAGGG + Intergenic
948102533 2:235386325-235386347 ATTAAGCAGCAGGCTGGGCACGG - Intergenic
948880891 2:240856616-240856638 ATGCAGCAGCAGGCTCAGCATGG + Intergenic
949081272 2:242101818-242101840 ATAAAGAAACAGGCTGGGCACGG - Intergenic
1168749676 20:273583-273605 ATGCAGAATCAGGCTGGGCATGG + Intronic
1169354083 20:4893353-4893375 GTAAAGTTGCAGGCTGAGCAAGG - Intronic
1169435341 20:5582596-5582618 ATGAGGATGCAGGCTGGGCATGG + Intronic
1169573068 20:6927403-6927425 ATGAAGCAGATGTCTGAGAAAGG - Intergenic
1169958158 20:11129252-11129274 AAGAAGAAGCCGGCTGGGCATGG + Intergenic
1171072778 20:22091443-22091465 ATTCAGTAGCAGGCTAAGCATGG - Intergenic
1171157855 20:22892859-22892881 AAGAAGCACTAGGATGAGCATGG - Intergenic
1171400637 20:24871225-24871247 ATGCAGGGACAGGCTGAGCATGG + Intergenic
1171415746 20:24979421-24979443 CTGAAGCAGGAGCCTGAGCTGGG + Intronic
1171466129 20:25329172-25329194 ATGAAGCAGGGGCCTGGGCAGGG - Intronic
1171992403 20:31706887-31706909 ATGAGGCAACAGGCAGAGCTTGG + Intronic
1172006218 20:31820398-31820420 AAGAAGCCCAAGGCTGAGCAGGG + Exonic
1172610701 20:36249725-36249747 ATGAGGAAGCAGGCTCAGGAAGG + Intronic
1174302520 20:49592799-49592821 TTGAACCAGCAGGCTGAGCTGGG + Intergenic
1174454174 20:50638006-50638028 AAAAACCAGCAGGCTGGGCATGG - Intronic
1174462686 20:50694010-50694032 AGAAAGAAACAGGCTGAGCATGG + Intergenic
1174472665 20:50772039-50772061 AAAAACCAGCAGGCTGGGCATGG + Intergenic
1175366839 20:58461520-58461542 ATGAGGCCACAGGCTGGGCACGG + Exonic
1175800539 20:61798699-61798721 AGGAAGAAGCAGGCTGTCCAGGG - Intronic
1178321450 21:31609201-31609223 GTGAGGGAGCAGGCTGGGCAGGG + Intergenic
1178431505 21:32522211-32522233 AAGGAGCAGCAGGCTGAGTGTGG - Intergenic
1178558913 21:33619447-33619469 ATGAAGCAGGAGGATAGGCAAGG - Intronic
1178598568 21:33976518-33976540 ATGAAGCAGGAAGTGGAGCAGGG - Intergenic
1179147698 21:38782942-38782964 ATGAAAAAGGAGGCTGAGCACGG - Intergenic
1179536795 21:42058157-42058179 AGGAAGCAGCAGGCAGAAGAGGG - Intergenic
1180679224 22:17613008-17613030 ATTAAACTGCAGGCTGGGCAAGG - Intronic
1181100509 22:20535847-20535869 AGAAAGAAGCAGGCTGAGCACGG - Intronic
1181113162 22:20613600-20613622 AAGAAGCAGCAGGCTGAGCATGG + Intergenic
1181483121 22:23213530-23213552 AGGAGGCAGCAGGCTGAGCGTGG + Intronic
1181645765 22:24231269-24231291 ATGGAGGAGGAGGCTGAGCTGGG + Intronic
1181839043 22:25638748-25638770 CTGAATCAGCAGGCAGAGAAGGG - Intronic
1181982845 22:26778315-26778337 ATGAAGATGGAGGCTGGGCATGG - Intergenic
1182553469 22:31115386-31115408 ATGATGCAGCAGGCTGGGCGTGG + Intronic
1182626338 22:31649441-31649463 ATGAGGTTGCAGGCTGGGCATGG + Intronic
1183207661 22:36430848-36430870 TTGAAGAAACTGGCTGAGCACGG - Intergenic
1183902522 22:41017269-41017291 ATGCAGAAGCAGGCTGGGCACGG - Intergenic
1183948376 22:41339334-41339356 ATGAAGCTGCACACTGGGCACGG + Intronic
1184184990 22:42858335-42858357 AGGAAGCAGCTGGCTGAACTGGG - Intronic
1184441817 22:44521577-44521599 TTGAAGCTGCCGGCTGAGAAAGG - Intergenic
1184497633 22:44851532-44851554 ATGAAGACCCAGGCTGGGCATGG + Intronic
1185308929 22:50142093-50142115 ATGACGGACCAAGCTGAGCATGG + Exonic
949747908 3:7316116-7316138 ATGAAGGAGCACACTGGGCATGG + Intronic
950756301 3:15175676-15175698 ATTAAGCAACATGCTGAGAAAGG + Intergenic
952066154 3:29573405-29573427 ATGAAAAAGGAAGCTGAGCATGG - Intronic
952309324 3:32173294-32173316 AAGAAGGATGAGGCTGAGCATGG - Intergenic
952323457 3:32299081-32299103 TTGAAGCAGCAATCTGAGCGGGG - Intronic
952887144 3:38018811-38018833 GTGTGGCAGCAGGCTGAGCTGGG + Intronic
953386630 3:42509984-42510006 TTGAAGCAGGAGACTGAGGATGG - Intronic
953551553 3:43907340-43907362 AGGAAGCAGGAGGCAGAGCGGGG - Intergenic
954632700 3:52055890-52055912 CTGTAGGAGCAGGCCGAGCACGG + Exonic
954676162 3:52316598-52316620 AGGAAGCAGAAGCCTGTGCAAGG + Intronic
954873237 3:53783897-53783919 AAGAAGCAGGAGACTGAGTAAGG + Intronic
955842058 3:63123199-63123221 ATGAAGCAGGAGCCAGACCATGG + Intergenic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
957829699 3:85500805-85500827 AAAAAGTAGCAGGCTGGGCACGG - Intronic
959090977 3:101902347-101902369 ATCAGGAAGCAGGCAGAGCAAGG + Intergenic
959244333 3:103845340-103845362 AACAAACAGCAGGCTGGGCATGG - Intergenic
960579556 3:119264582-119264604 AAGAAGAAATAGGCTGAGCACGG + Intergenic
962649881 3:137477804-137477826 ATGAAGCAGCAATATTAGCAGGG + Intergenic
963308258 3:143678114-143678136 ATGAAGAGGCAGGCTGGGCGCGG - Intronic
963848302 3:150181861-150181883 ATGTAGCCCCTGGCTGAGCAGGG + Intergenic
963933184 3:151025468-151025490 ATCATGCAGCTGGCTGGGCATGG - Intergenic
964616573 3:158672728-158672750 AGGAACCAGCAGGCGGAGTAAGG - Intronic
964709369 3:159655597-159655619 AAGAAACAGCAGGCCGAGCGTGG + Intronic
965034966 3:163426160-163426182 ATGAAGCAGTGGGCTGGGAAAGG - Intergenic
965464816 3:169015330-169015352 ATTCAGCAATAGGCTGAGCATGG - Intergenic
966313934 3:178624976-178624998 AAAAAGCAGCAGGCTGCCCAGGG + Intronic
967226791 3:187299578-187299600 TTGAACCAGCGGGCTGAGTATGG + Intergenic
967563596 3:190946944-190946966 TTGAAGCAGAAGCCTGAGCTCGG - Intergenic
968312327 3:197694377-197694399 ATGTACCAGGAGGCTGAGCACGG - Exonic
968760154 4:2438612-2438634 AAGAAGTAGCAAGCTGGGCATGG + Intronic
968764206 4:2459614-2459636 ATGGAGCAGGAGGTTGAGGAGGG + Intronic
968913416 4:3486867-3486889 GGGCAGCAGGAGGCTGAGCAGGG + Intronic
968919771 4:3516507-3516529 CTGAAGCAGGAGGCAGAGGATGG + Intronic
968929620 4:3571889-3571911 GTGAAGGAGAAGGCCGAGCAAGG - Intergenic
969274092 4:6123528-6123550 AAGAAGCCTCAGGCTGGGCATGG + Intronic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
970220811 4:13808806-13808828 ATGAAGCAGCTGGCTTGGTAAGG - Intergenic
970304523 4:14717988-14718010 ATGCAGAAACAGGCTGGGCACGG - Intergenic
970454037 4:16204047-16204069 GTACAGCAGGAGGCTGAGCAAGG + Intronic
971021705 4:22543532-22543554 AAGAAGCAGTAGGCTGAGGCAGG + Intergenic
971373566 4:26037967-26037989 ATGAAGCTCCAGGCTGGACATGG + Intergenic
972145080 4:36013940-36013962 AAGTAGCAACTGGCTGAGCACGG + Intronic
972170044 4:36334648-36334670 ATTAAGCAGTGTGCTGAGCATGG - Intronic
972364087 4:38357356-38357378 ATGAGGAAGCAGGCCGGGCATGG + Intergenic
972550398 4:40127503-40127525 AAGATGCAGCTGGCTGGGCATGG - Intronic
972720449 4:41691454-41691476 ATGGAACAGCAGGCTGGGCACGG + Intronic
974034619 4:56807033-56807055 AAGAAGAAACAGGCTGGGCACGG + Intergenic
975122015 4:70738650-70738672 ATGAAACATCTGGCTGGGCACGG - Intronic
975329850 4:73100310-73100332 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
975937595 4:79600476-79600498 GTGAAGCAGCAGGATCAGAATGG - Intergenic
977920703 4:102639465-102639487 TTGCAACAGCAGGCTAAGCATGG - Intronic
979720946 4:123899842-123899864 ATGATGTGACAGGCTGAGCAGGG - Intergenic
980701462 4:136437577-136437599 TTGAATCAGCAGACTGAGGAAGG + Intergenic
981394339 4:144229525-144229547 ATGAAGCAACAAGCTGGGGAGGG - Intergenic
982678538 4:158403208-158403230 ATGGGGCAGCAGGTTGAGCAGGG + Intronic
983867641 4:172788053-172788075 GAGAAGGAGCAGGCTGGGCATGG + Intronic
984115165 4:175671151-175671173 TTGAAGCAGCAGGCCGGGCGTGG - Intronic
984726834 4:183029717-183029739 ATAAGGCAGTAGGCTCAGCATGG - Intergenic
984983914 4:185308995-185309017 ATGAAGCTGCAATCTGGGCAGGG + Intronic
985413331 4:189710004-189710026 TTGAATCTGAAGGCTGAGCAGGG + Intergenic
985984611 5:3504246-3504268 AAGAGGCAGCCGGCTGAGCGCGG - Intergenic
986065283 5:4229095-4229117 AGGAAGAAGCAGGCTGCACAGGG + Intergenic
986131686 5:4937873-4937895 CTGAAGGAGCAGGTGGAGCATGG - Intergenic
987172023 5:15269125-15269147 ATGAAGAAACAGGCTAAGCAGGG + Intergenic
989800719 5:45535305-45535327 ATAGAGAAGCAGGCTGGGCATGG + Intronic
990146428 5:52766136-52766158 ATAAAAAAGCTGGCTGAGCATGG + Intergenic
990220850 5:53586811-53586833 AGGAAGAAACAGGCTGGGCACGG - Intronic
990446324 5:55897138-55897160 ATAAAGAAACAGGCTGGGCATGG - Intronic
990978515 5:61580205-61580227 ATGATGGAGCATGATGAGCAAGG + Intergenic
992296286 5:75330167-75330189 TGGAAGCTGCATGCTGAGCATGG + Intergenic
992510241 5:77425633-77425655 ATGAAGAAATAGGCTCAGCAAGG - Intronic
995017481 5:107327376-107327398 TTGGAGCTGCAGGCTGAGAAGGG + Intergenic
995349303 5:111156661-111156683 CTGAAGCAGCAGCCCTAGCAGGG - Intergenic
995910361 5:117179612-117179634 ATGAAGAAGCAGGGGAAGCAGGG + Intergenic
995914524 5:117228506-117228528 ATGCAGATGCAGGCTGGGCACGG + Intergenic
997584665 5:135037271-135037293 CTGAAGCAGCAGGCAGAGTCCGG - Intronic
997725115 5:136113839-136113861 AGGAAGCAACAGGCTGAGACTGG + Intergenic
999273967 5:150316257-150316279 ATGAAGAAGTCGGCTGGGCATGG - Intronic
999796621 5:154994797-154994819 ATGAAAAATCAGGCTGGGCAAGG - Intergenic
999993565 5:157070460-157070482 ATGAATAAGAAGGCTGGGCATGG - Intergenic
1001120002 5:168972203-168972225 AGGAAGCACCAGGCAGAGAATGG + Intronic
1002331028 5:178440905-178440927 ATGAAACAGTAGGCCGGGCATGG - Intronic
1002398394 5:178976017-178976039 ATGGAGGAGTAGGGTGAGCAGGG - Intergenic
1002569500 5:180132136-180132158 ATGAAGCACCAGGCCGTGCTGGG + Intronic
1002617291 5:180463872-180463894 ATGCAGCAGCAGGATGGGCCTGG - Intergenic
1003273615 6:4629030-4629052 ATGAAGATGTAGGCTGGGCATGG - Intergenic
1003412373 6:5876877-5876899 ATCAACCAGCAGGCAGAGAAGGG - Intergenic
1003648411 6:7935475-7935497 ATGAAAGAGCAGGCCGGGCATGG + Intronic
1004053563 6:12112627-12112649 AGGAGGCTGCAAGCTGAGCAGGG - Intronic
1004185631 6:13419062-13419084 ATTAAGCAGAAGGCTTGGCATGG + Intronic
1004453971 6:15774150-15774172 CTGAGGCAGGAGGATGAGCAAGG - Intergenic
1005436874 6:25821456-25821478 ATGAAGCAGAATGCTCAGCCAGG + Intronic
1005596435 6:27382827-27382849 ATTGAAAAGCAGGCTGAGCACGG + Intronic
1005725339 6:28642294-28642316 ATGAAACAGCAGGCCGGGCGCGG + Intergenic
1005970138 6:30754372-30754394 ATGAAACTACAGGCTGGGCAAGG + Intergenic
1006352122 6:33528685-33528707 AAGAAGCCACAGGCTGAGGATGG + Intergenic
1006416697 6:33908581-33908603 CCCAAGCAGCAGGCTGAGCAGGG + Intergenic
1006474599 6:34246062-34246084 ATGCTGCAGCAGAGTGAGCAAGG + Exonic
1006812580 6:36829520-36829542 AAGAAACAGAAGGCTGGGCACGG + Intronic
1006873608 6:37276253-37276275 ATGAAAGAGAAGGCTGGGCATGG - Intronic
1007104362 6:39273400-39273422 AAGAAGTAGCTGGCCGAGCAGGG - Intergenic
1007754238 6:44088538-44088560 ATGAAGAAGGAGGCTGGGCACGG - Intergenic
1007808223 6:44466880-44466902 ATGCAGGAGTAGGCTGGGCATGG - Intergenic
1008084398 6:47229040-47229062 ATGCAGCCTCAGGCTGGGCATGG + Intergenic
1008725201 6:54409069-54409091 ATGAAGAAACAGGCTCAACATGG + Intergenic
1009231770 6:61071628-61071650 AGGAAGCAGCAGGTAGTGCAGGG - Intergenic
1010030459 6:71266541-71266563 ATGGAGCGGCTGGCTGGGCAGGG + Intergenic
1010072112 6:71755575-71755597 AGGAAGAAGCAGGATAAGCAGGG - Intergenic
1010451800 6:76012437-76012459 GTGAAGCAGGAGGCTGAAGATGG - Intronic
1011153750 6:84305001-84305023 ATGAAGCTGCAGGCAGAACATGG - Intergenic
1011847328 6:91582328-91582350 AGGATGCAGAAGGCTGAACAGGG - Intergenic
1012121254 6:95369983-95370005 TTGAATCAGCAGACTGAGTAAGG + Intergenic
1012181065 6:96153307-96153329 ATGAAGCAGCTGGCTCAGGGAGG - Intronic
1013789709 6:113822913-113822935 AAGAAGAATCAGGCTGGGCATGG + Intergenic
1014161264 6:118171319-118171341 AGTAAGCTGCAGGCTGGGCATGG - Intronic
1015886156 6:137920832-137920854 CTGAAGGAGAAGGCTGAGCTAGG - Intergenic
1015985132 6:138876976-138876998 AGGAAGCTGCAGCCTCAGCAGGG + Intronic
1016480307 6:144473771-144473793 ATGAAACAGCAGGCTGCCCAAGG + Exonic
1016541849 6:145174655-145174677 AAGAAGCATCTGGCTGGGCATGG - Intergenic
1016728360 6:147401087-147401109 CTGAAGCAACAGCCTGAGCAGGG + Intergenic
1017384049 6:153861936-153861958 TGGCAGCAGCAGGCTGAGCATGG - Intergenic
1018267802 6:162043768-162043790 AGGAAGCAGCAGGAAGAGAAAGG + Intronic
1018565703 6:165149722-165149744 ATGTCACAACAGGCTGAGCACGG - Intergenic
1018888487 6:167962663-167962685 AAGAAGCACGAGGCAGAGCAGGG + Exonic
1018988890 6:168658531-168658553 CTGTAGCACCAGGCTGAGGAGGG - Intronic
1019678562 7:2330691-2330713 ATCAAGCAGCAGGCACAGCTGGG - Intronic
1020005611 7:4782494-4782516 ATGACGCTGCAGGCTGGGAACGG - Intronic
1020026769 7:4905070-4905092 ATGAAGGAGCAGGCTGTCCTGGG + Intergenic
1020157438 7:5737797-5737819 ATTTACCACCAGGCTGAGCACGG + Intronic
1020422262 7:8021691-8021713 ATTAAACAATAGGCTGAGCATGG - Intronic
1020578389 7:9963482-9963504 ATCAGGAAGCAGGCTGGGCATGG + Intergenic
1021675076 7:23072310-23072332 ATGAACCAGCAGCCACAGCAGGG - Intergenic
1022342908 7:29485818-29485840 CAGAAGCAGCAGGCTGAGTGGGG - Intronic
1022471784 7:30686059-30686081 ATGAAGCAGGAGGGTGAGGATGG - Intronic
1022480544 7:30740593-30740615 AGGAAGCAGCAGGCGGAGGCTGG - Intronic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1023040775 7:36171211-36171233 ATGAAGCATGGGGCTGGGCATGG - Intronic
1023290623 7:38665258-38665280 AAAAAGCAGCCGGCTGGGCAAGG + Intergenic
1024244944 7:47462345-47462367 TTGTAGCAGCCTGCTGAGCAAGG + Intronic
1024595487 7:50931709-50931731 AGGAAAAAGCAGGCTGGGCATGG - Intergenic
1025805637 7:64830611-64830633 ATGAAGATACAGGCTGGGCATGG - Intronic
1025829389 7:65036695-65036717 AAGAAGCAGCAGGCTTACCCCGG - Intergenic
1026105537 7:67417930-67417952 ATGAAGCAAGAGGCAGAGCAGGG - Intergenic
1027392676 7:77721030-77721052 AAAAAGCAGTAGGCTGGGCACGG - Intronic
1027586955 7:80069996-80070018 AAGAAGCAGCTGGCCGGGCATGG + Intergenic
1027818198 7:83006494-83006516 ATGAAACAGCAGTATGAGAAAGG - Intronic
1028604253 7:92638304-92638326 AGGAGGCTGCAGGCTGAGCATGG + Intronic
1028915334 7:96252801-96252823 ATGAATGGGCAGGCTGGGCACGG + Intronic
1029298577 7:99560579-99560601 AGGAAGCAGCAGGGTCACCAAGG + Exonic
1029559491 7:101293125-101293147 CTCAAGCACCAGGCTGGGCACGG - Intergenic
1030232548 7:107223379-107223401 ATGAAGCAGGAGGCTGATTTGGG + Intronic
1031439026 7:121770199-121770221 ATTAAGTGGCAGGCTCAGCAGGG + Intergenic
1031741105 7:125432037-125432059 ATGAAACAGAAGGCCGAACAGGG - Intergenic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032141471 7:129335089-129335111 GTAAAGCAGCAGGCCGGGCATGG + Intronic
1032327583 7:130945702-130945724 ATGAGGTAGGAGGCTCAGCACGG - Intergenic
1032847642 7:135765490-135765512 ATAAGGCAGAAGGCTGGGCATGG - Intergenic
1032963762 7:137071688-137071710 ATGAAGCAAGAGGCTGGGCATGG + Intergenic
1033252578 7:139773809-139773831 ACAAGGCAGCAGGCTGGGCAAGG - Intronic
1033553744 7:142470391-142470413 AGGAAGCAGCATGCTCACCAGGG - Intergenic
1033959932 7:146902172-146902194 ATGGAGCATATGGCTGAGCACGG - Intronic
1034077631 7:148247942-148247964 CTGAAGAAAGAGGCTGAGCATGG - Intronic
1034088092 7:148338583-148338605 ATGAACCAGGAGGCAGAGCAAGG + Intronic
1035123531 7:156590379-156590401 AAGAAGCAGCAGGCGGCACATGG + Intergenic
1036674552 8:10819114-10819136 TGGAAGCAGCAGGCTGGGAAAGG - Intronic
1037346048 8:17902397-17902419 ATGATGCAGCAGGCTGGACATGG - Intronic
1037458632 8:19087042-19087064 ATGATGCTGCATGCAGAGCAAGG - Intergenic
1037497639 8:19455717-19455739 CTGGAGCAGGAGGCTGAGTAGGG - Intronic
1037640580 8:20738532-20738554 ATGAAGCAGCAGGTTCAGTCAGG - Intergenic
1040934315 8:52766993-52767015 ATGAGGCAGCATCCTGAGAAAGG + Intergenic
1041446558 8:57957712-57957734 ATGGATCAGAATGCTGAGCATGG + Intergenic
1041986413 8:63926140-63926162 TTAAATCAGCAGGCTGAGAAGGG + Intergenic
1042376138 8:68055226-68055248 TTGAAACTGCAGGTTGAGCAAGG + Intronic
1042929900 8:74002862-74002884 ATGGAGCTGAAGGCTGGGCACGG - Intronic
1043377505 8:79667189-79667211 ATGAAGAAGCAGGCCGGGCACGG + Intergenic
1044183641 8:89225398-89225420 ATTAAACAACAGGCTGGGCACGG - Intergenic
1044365656 8:91342218-91342240 ATAAAGAAGCTGGCTGAGCACGG - Intronic
1045472577 8:102525418-102525440 ATGAAACACGAGGCTGGGCATGG - Intergenic
1045852082 8:106713960-106713982 ATCAAGCAGCAGCCAGAGAATGG + Exonic
1047523842 8:125615893-125615915 ATGAAACAGGTGGCTGGGCACGG + Intergenic
1047689329 8:127335331-127335353 ATGAGTCAGCAGTCTGAGCATGG + Intergenic
1048853921 8:138670298-138670320 GTGAAGGAGGAGGCTGAGGAAGG - Intronic
1050270126 9:3934697-3934719 ATCAAACAGAAGGCTGGGCACGG - Intronic
1050394223 9:5178163-5178185 TTAAAGCAGCAGTCTGAGCGTGG - Intronic
1051295095 9:15587101-15587123 AGGAAGCTGGGGGCTGAGCATGG - Intronic
1051595641 9:18822012-18822034 TTCAAGCAGCAGGGAGAGCATGG + Intronic
1052492343 9:29185749-29185771 ATGAAGCAGCAAGATGTGGAAGG - Intergenic
1052583209 9:30388783-30388805 GTGATGGAGTAGGCTGAGCATGG - Intergenic
1052734909 9:32331770-32331792 ATGACTCAGGAGGCTGGGCAAGG - Intergenic
1054460660 9:65460582-65460604 GTGAAGGAGAAGGCCGAGCAAGG + Intergenic
1055602243 9:77931763-77931785 ATGAAGAAGCAGGCTTAGAGAGG - Intronic
1056085976 9:83149562-83149584 ATGAGGCAGCAGGGTAGGCAGGG + Intergenic
1056759231 9:89403339-89403361 AGGAAGCATCTGGCAGAGCAGGG - Intronic
1056781800 9:89556038-89556060 ATGAAACAGCTGGCTGACTAGGG + Intergenic
1056787030 9:89600663-89600685 AAGAAGCAGGAAGCTGAGAAAGG - Intergenic
1057588258 9:96348706-96348728 AGGAAGAGCCAGGCTGAGCATGG + Intronic
1057723136 9:97548714-97548736 ATGAAAAACCAGGCTGACCAAGG + Intronic
1057839019 9:98470110-98470132 ACAAAGGAACAGGCTGAGCATGG + Intronic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1059096759 9:111424877-111424899 AAGATACAGCAGGCTGGGCATGG + Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1060264522 9:122102820-122102842 AACAAGCAGGAGGCTGGGCACGG + Intergenic
1060989402 9:127839457-127839479 AAGAAGCAGCAGGAGGAGGAAGG + Intronic
1061106282 9:128533131-128533153 ATGATGAAACAGGCTGGGCATGG + Intronic
1061193188 9:129094052-129094074 ATGAGGAAGCAGGCTTAGCGAGG - Intergenic
1061601461 9:131673000-131673022 CTGAAGCAGAAGGAAGAGCAGGG - Intronic
1185705354 X:2262696-2262718 AAGAAGCACCGGGCTGTGCAGGG - Intronic
1185873834 X:3685932-3685954 GTTACGCAGGAGGCTGAGCAGGG + Intronic
1186186696 X:7027233-7027255 CTGATGCAGCAGGCTCAGCTGGG - Intergenic
1186343899 X:8671065-8671087 ATGATGAAGAAGGCTGAGAATGG - Intronic
1187386009 X:18849125-18849147 TTTTAGCAGAAGGCTGAGCAGGG + Intergenic
1188039769 X:25358216-25358238 ATGAAGAGGCAGAGTGAGCAAGG - Intergenic
1188690113 X:33118890-33118912 GTGAAGAAGCATGCTGAGAAAGG - Intronic
1188917645 X:35932540-35932562 AAAATGGAGCAGGCTGAGCATGG - Intronic
1189058464 X:37726343-37726365 ATGAAGCAGCAGGCATGGAAGGG + Intronic
1189478920 X:41377994-41378016 ATGCTGCACCAGGCTGACCAGGG + Intergenic
1190087687 X:47409937-47409959 ATGAAGAAGGAGGCTGGGCGCGG - Intronic
1191126279 X:56957658-56957680 AAGAAGAACCAGGCTGGGCACGG + Intergenic
1191171420 X:57451182-57451204 AGGAAACAGGAGGCTGAACAGGG + Intronic
1192130217 X:68542873-68542895 AAGAAGAAGAAGGCTGGGCATGG - Intergenic
1193344948 X:80394682-80394704 ATAAATAAGCAGGCTGGGCATGG - Intronic
1193380885 X:80814664-80814686 ATGAAGTATAAGGCTGAGCATGG + Intergenic
1193384455 X:80854285-80854307 ATGAAGAAAGAGGCTGGGCATGG - Intergenic
1196731717 X:118947582-118947604 ATGGAGAATCAGGCTGGGCATGG + Intergenic
1198550461 X:137739990-137740012 ATCAATTAGCAGGCTGGGCATGG + Intergenic
1199503151 X:148531519-148531541 ATGAAGTAGAAGGAGGAGCATGG + Intronic
1200115048 X:153766245-153766267 AGGCAGCCGCGGGCTGAGCAAGG - Exonic
1200241827 X:154500199-154500221 GTGAAGAAGCTGGCTGGGCACGG + Intergenic
1200790469 Y:7295067-7295089 GTTACGCAGGAGGCTGAGCAGGG - Intergenic
1201193353 Y:11468364-11468386 TTGAGTCAGCGGGCTGAGCAAGG + Intergenic
1201920443 Y:19228164-19228186 CTGAAGCAGCAACCTGAGCCTGG - Intergenic