ID: 902359251

View in Genome Browser
Species Human (GRCh38)
Location 1:15933211-15933233
Sequence CTCTTGTTCGGAAAGACAAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902359246_902359251 11 Left 902359246 1:15933177-15933199 CCAGAAGCCAAAGGGTCTAAAGA 0: 1
1: 0
2: 1
3: 12
4: 167
Right 902359251 1:15933211-15933233 CTCTTGTTCGGAAAGACAAAGGG 0: 1
1: 0
2: 0
3: 12
4: 121
902359243_902359251 25 Left 902359243 1:15933163-15933185 CCTCACACTCAGTGCCAGAAGCC 0: 1
1: 0
2: 0
3: 29
4: 269
Right 902359251 1:15933211-15933233 CTCTTGTTCGGAAAGACAAAGGG 0: 1
1: 0
2: 0
3: 12
4: 121
902359248_902359251 4 Left 902359248 1:15933184-15933206 CCAAAGGGTCTAAAGAAGTGGAA 0: 1
1: 0
2: 0
3: 15
4: 136
Right 902359251 1:15933211-15933233 CTCTTGTTCGGAAAGACAAAGGG 0: 1
1: 0
2: 0
3: 12
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902359251 Original CRISPR CTCTTGTTCGGAAAGACAAA GGG Exonic
901327194 1:8374217-8374239 CTCTTCTGGGGAAAGGCAAAGGG + Intronic
901781023 1:11594603-11594625 CTCTTGTAGGGAAAGAGAACAGG - Intergenic
902359251 1:15933211-15933233 CTCTTGTTCGGAAAGACAAAGGG + Exonic
903138182 1:21322738-21322760 CTCTTGTCAGGAAGGACAAGAGG + Intronic
903783180 1:25835834-25835856 GTTTTATTAGGAAAGACAAATGG - Exonic
905469464 1:38180954-38180976 CTCTAGATTGGAGAGACAAAGGG - Intergenic
906426108 1:45714109-45714131 TTCTTCTTTGGAAAGAAAAAAGG + Intronic
907144227 1:52218380-52218402 CCCTTGTTGTGAAAGACACAAGG + Intronic
911223915 1:95283284-95283306 CTCTTGGTTGGAAAGGCAAAGGG - Intergenic
911904831 1:103553864-103553886 CTCTTGTTTAGAAAAAGAAAGGG - Exonic
912096701 1:106153392-106153414 GTCTTGTCCCGCAAGACAAAAGG - Intergenic
913610586 1:120506142-120506164 CTCCTGCTAGGAAATACAAAGGG - Intergenic
913984210 1:143550671-143550693 CTCCTGCTAGGAAATACAAAGGG + Intergenic
914580604 1:149016097-149016119 CTCCTGCTAGGAAATACAAAGGG + Intronic
918238352 1:182600939-182600961 CTCTTCTTCTGAAAGACATGAGG - Intronic
918742030 1:188143882-188143904 CTTTTGATCTGAAAGAAAAAGGG - Intergenic
918821268 1:189257821-189257843 CTTTTTTTTGGAAAGACACATGG + Intergenic
920295025 1:204950750-204950772 CTCTTGCTGGGAAAGACAGAAGG + Intronic
920503947 1:206503259-206503281 CTCTTGTCCAGATTGACAAAGGG + Intergenic
920797889 1:209158285-209158307 CTCTAGTTCCTAAAGTCAAAGGG + Intergenic
920963585 1:210684364-210684386 CTCTTGAAGGGAATGACAAAGGG - Intronic
921221967 1:212979829-212979851 CTGTGGTTCGTAAAGAGAAAGGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921707318 1:218338382-218338404 CTCTTCTCTGGAAAGAAAAATGG + Intergenic
924417930 1:243878438-243878460 CTCTTGTAAGGAAGGATAAAAGG - Intergenic
1062847771 10:720961-720983 TTCTTGTTGGCAAACACAAATGG - Intergenic
1067334933 10:45353342-45353364 GTCTTGTTCTGAAAGGCACAAGG + Intergenic
1071491566 10:86139940-86139962 CTCTTTTTGGGAAAGCCAAATGG - Intronic
1071836715 10:89425457-89425479 CTGTTTTTCAGAAAGAAAAAGGG + Intergenic
1071883502 10:89924948-89924970 TTCTTGTTTGGAAAAACAAAAGG - Intergenic
1074475120 10:113766058-113766080 CTCTTGTTTGCTAAGCCAAAGGG + Intronic
1078917292 11:15791263-15791285 CTCTTTTTCTGAAAGAAACAGGG - Intergenic
1081284907 11:41255970-41255992 CTCATTTTAGGAAAAACAAAAGG + Intronic
1083536195 11:63468822-63468844 CTCTTGTACTGCAAGACAAAGGG + Intronic
1083775318 11:64891743-64891765 CTCTGGTTGGGAAAGAAACAAGG - Intergenic
1086572025 11:88296056-88296078 CTGTTGTTGGCAAAGGCAAAAGG - Intronic
1086922344 11:92601767-92601789 CTCTGGTGCAGAAGGACAAACGG - Intronic
1089254495 11:117187147-117187169 CTCTCCTTAGGGAAGACAAAGGG + Intronic
1093136179 12:15454174-15454196 CTGTTGTTGGGAATGAAAAATGG - Intronic
1094530095 12:31266152-31266174 CCATTTTTCGGAAAGAAAAAGGG + Intergenic
1095333521 12:40998749-40998771 CTCTAGTTTGGAAAACCAAAAGG - Intronic
1099566124 12:84248719-84248741 CTGTTGTTGGAAAAGAAAAAAGG - Intergenic
1102202304 12:111065998-111066020 CTCTAGTTTGGAAAACCAAAAGG - Intronic
1103957093 12:124583236-124583258 CTCAGGGTCAGAAAGACAAAGGG + Intergenic
1106206630 13:27602772-27602794 TTCTTGTTAGGGAAGTCAAATGG - Intronic
1110031727 13:70623889-70623911 CTCTTGTACAGAAAGAATAAGGG + Intergenic
1112035341 13:95492240-95492262 CCCTGGTAGGGAAAGACAAAGGG - Intronic
1115506341 14:34097701-34097723 CACTTGTCCAGAGAGACAAATGG + Intronic
1119004869 14:70915292-70915314 GTCTTATTTGGAAAGAGAAAAGG - Intronic
1120935917 14:89894609-89894631 GTCTTGTTCTGAAACTCAAAGGG - Intronic
1123807773 15:23892565-23892587 CTTTTATTAGGAAAGACAGATGG + Intergenic
1127131660 15:55870965-55870987 CTCTTGTCTAGAAAGACAAAGGG - Intronic
1127446707 15:59070685-59070707 CTCAAGTTGGGAAAGAGAAAAGG - Intronic
1127685440 15:61338880-61338902 CTTTTGCTTGGAAAGACAAAGGG + Intergenic
1133511130 16:6458567-6458589 CTCTTGCTCTGAAACACCAATGG - Intronic
1133871516 16:9691808-9691830 CTTTTATTCGGAAAGAATAAAGG - Intergenic
1138915927 16:61464266-61464288 CAGTTATTAGGAAAGACAAAAGG + Intergenic
1141909542 16:87049244-87049266 CTCTTGTTTGAAAAGCCAAATGG - Intergenic
1143903752 17:10194157-10194179 CTCTTTTTAGGAAAGAGAAAAGG + Intronic
1144938356 17:18918269-18918291 CTCTTTTTCAGAAAAACAACAGG - Intronic
1148629370 17:49094955-49094977 GTCTTGTTTAGAAAGAAAAAAGG - Intergenic
1148781684 17:50125713-50125735 CTCTTGTTCAGAAAGGCAGGTGG - Intronic
1155306599 18:24484615-24484637 CTCTTAATCGGATAGAAAAAGGG + Intergenic
1157005771 18:43582227-43582249 CTCCTGTTCTGAAAGATAACAGG + Intergenic
1159293701 18:66454174-66454196 CTCTTGTTCGGACAGAGGACTGG - Intergenic
1160536742 18:79598461-79598483 CTCTCGTTCTCAGAGACAAAGGG - Intergenic
1161698332 19:5782506-5782528 CTCTTGTTCAGACAGACAGGTGG - Intergenic
1163299567 19:16435361-16435383 CTGCTGTTCTGAAAGACATAGGG + Intronic
1164713271 19:30374613-30374635 CTCTTTTGCGCAAAGACAAAGGG + Intronic
925376037 2:3386921-3386943 CTGTTGGTGGGAATGACAAACGG + Intronic
926140495 2:10365166-10365188 CTCATGTACGGAAGGAGAAATGG + Intronic
927131872 2:20066945-20066967 CTCTTATTTTGAAAGTCAAAAGG - Intergenic
931812291 2:65866473-65866495 CTCTAGTTCGGAGAGAAAAAAGG + Intergenic
932116676 2:69056555-69056577 CTCTGGTGAGGAAAGAGAAATGG - Intronic
934108222 2:88715962-88715984 CTCTTATTTGGAAAGAAAATAGG - Intronic
935335447 2:102011335-102011357 CTGTTGTTGGGAATGAAAAATGG - Intronic
940431364 2:153593495-153593517 CTCTGGTAGTGAAAGACAAAGGG + Intergenic
941743975 2:169066711-169066733 CTCTTGTTGGGTAAGCTAAAAGG + Exonic
947772985 2:232685703-232685725 CACTTGTCCAGAAAGGCAAACGG - Intergenic
1170130112 20:13010267-13010289 CTCCTGTTTGGAAAGAGAAGTGG + Intronic
1172749767 20:37242626-37242648 CTCTTTTACAGAAACACAAAAGG - Intergenic
1174719161 20:52792665-52792687 CTCTTGGGAGGAGAGACAAAGGG + Intergenic
1175813373 20:61870681-61870703 ATCTGGTTCAGAAAGTCAAAGGG - Intronic
1178491912 21:33057866-33057888 CTCTTGTTCTGGAAGCCATATGG - Intergenic
1178698256 21:34812522-34812544 CTCTGATTCAGAAAGGCAAATGG + Intronic
1180501743 22:15935996-15936018 CTCTTGTGCTGAAAAACTAACGG - Intergenic
1184375426 22:44109089-44109111 ATTTTCTTCGGAGAGACAAAGGG - Intronic
957161102 3:76610526-76610548 CTCTTGCTCGGAAAGTCCCAAGG + Intronic
959609761 3:108280112-108280134 CTCCTGTTCTGAAAAACATAAGG + Intergenic
964183976 3:153920336-153920358 CCCTTGTGCTGAAAGATAAAGGG - Intergenic
964556981 3:157950600-157950622 ATTTTGTTGAGAAAGACAAAAGG + Intergenic
965486875 3:169288955-169288977 CTTTTTTTATGAAAGACAAAAGG + Intronic
966160986 3:176968154-176968176 CTCCTGTCAGGAAAGACAAAAGG + Intergenic
966618966 3:181943555-181943577 CTCTCCTTTGGAAAGATAAAGGG + Intergenic
973225381 4:47777949-47777971 CTCTGGTTCTGAAAGAAAATTGG - Intronic
974986975 4:69040258-69040280 CTGTTGGTGGGAATGACAAATGG - Intronic
977766930 4:100809751-100809773 CTCTACTTCGGAAAGAAAAGAGG + Intronic
978323898 4:107528928-107528950 CTCTTTGTTGGAAAGTCAAAAGG - Intergenic
979087836 4:116436331-116436353 CTTTTGTTCTGAAGGAGAAATGG + Intergenic
983653003 4:170052238-170052260 CTTTTGTTCGCAAATAAAAATGG + Intergenic
983997014 4:174194663-174194685 CTCTTAATCTGAAAGAGAAAAGG + Intergenic
985631213 5:1015022-1015044 GTCCTGTGAGGAAAGACAAAAGG + Intronic
987767875 5:22258295-22258317 CTATAGTTTTGAAAGACAAAAGG + Intronic
989739351 5:44751907-44751929 CTATTGTTCTGAAAATCAAATGG + Intergenic
991463209 5:66881436-66881458 CTTGTGTTAGGAAAGAGAAATGG - Intronic
992759066 5:79935534-79935556 CTCTTTTTCAGGAAGAGAAATGG - Intergenic
993106438 5:83605864-83605886 ATCTTTTTCAGAAACACAAAAGG - Intergenic
994030296 5:95133863-95133885 TTCTTCTACGGAAAGAAAAAAGG + Intronic
994335234 5:98557095-98557117 CTCTGGTTCGGTAATTCAAAAGG - Intergenic
994949768 5:106446589-106446611 GTCTTGTTCAGAGAGACTAAAGG + Intergenic
995539545 5:113171194-113171216 CTCTTGAACCTAAAGACAAAAGG + Intronic
1013260487 6:108436627-108436649 CTCTTGCTTGGATACACAAAAGG - Intronic
1014304669 6:119726022-119726044 GTCTTTTTCAGAAAAACAAATGG - Intergenic
1015754331 6:136592489-136592511 CTCTTGTTTTGAAAGAGAAGGGG + Exonic
1021916157 7:25434417-25434439 CTCTTATTGAGAAAGCCAAAAGG - Intergenic
1024446484 7:49485293-49485315 CTCTTGTTCTGAATGACAGCAGG - Intergenic
1026649797 7:72206264-72206286 CTCTTCTTCGAAAATATAAATGG + Intronic
1034178371 7:149118301-149118323 CTCTTGTTCCGAAAAATATAAGG + Exonic
1037049484 8:14352642-14352664 AGCTTGTTCCCAAAGACAAATGG + Intronic
1038320694 8:26524117-26524139 CTGTTGTTGGGAATGTCAAATGG - Intronic
1041169982 8:55131519-55131541 CTCTTATCTAGAAAGACAAAAGG - Intronic
1042600356 8:70493542-70493564 GTCTTTTTTGGAAAGACTAAGGG - Intergenic
1045595807 8:103654606-103654628 CTGTGGTTCAGAAAGATAAAAGG - Intronic
1047572297 8:126112302-126112324 CTGTTGTTGGGAAAGTAAAATGG - Intergenic
1049301016 8:141870396-141870418 CTCTTATCAGGAAAAACAAAAGG - Intergenic
1052627667 9:30998633-30998655 CTGTTGCTGGGAAAGAAAAATGG + Intergenic
1055346964 9:75349944-75349966 CCCTGGTAGGGAAAGACAAAGGG - Intergenic
1056905086 9:90639757-90639779 TTCTTTATCAGAAAGACAAAAGG - Intronic
1058145333 9:101404470-101404492 CAATTTTTCTGAAAGACAAAAGG - Intronic
1187235097 X:17459653-17459675 CTCTTGGTCAGAAAGGAAAAAGG - Intronic
1190318469 X:49165738-49165760 GTCTAGTTCTGAAAAACAAAGGG + Intronic
1190827616 X:54032047-54032069 CTCTTGTGAGGATAGACTAAAGG - Intronic
1194821825 X:98517737-98517759 CTTTTGTTCATAACGACAAAGGG + Intergenic
1199784013 X:151088034-151088056 CTCTGGTTGGAGAAGACAAACGG - Intergenic