ID: 902359383

View in Genome Browser
Species Human (GRCh38)
Location 1:15933953-15933975
Sequence TAGAGTCAACTGGCGGGGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902359383 Original CRISPR TAGAGTCAACTGGCGGGGGC GGG (reversed) Exonic
901429280 1:9202745-9202767 TAAATTCAACCGGCGGGGGGCGG - Intergenic
902359383 1:15933953-15933975 TAGAGTCAACTGGCGGGGGCGGG - Exonic
902369586 1:15997447-15997469 TGGAGGCAGCTGGTGGGGGCAGG - Intergenic
905433363 1:37940615-37940637 GAGAGTCAACTGGGGTGGGTAGG + Intronic
913682878 1:121203664-121203686 AAGAGTGAACTGGGAGGGGCAGG - Intronic
914034719 1:143991289-143991311 AAGAGTGAACTGGGAGGGGCAGG - Intergenic
914154733 1:145076679-145076701 AAGAGTGAACTGGGAGGGGCAGG + Intronic
914323877 1:146592066-146592088 TAGACTCAACTGGCAAGGCCAGG - Intergenic
916823584 1:168423730-168423752 AAAAGTCAACTGGAGGGGCCGGG + Intergenic
920122875 1:203672002-203672024 TAGTGGCAGCTGGTGGGGGCTGG + Intronic
920470188 1:206222177-206222199 AAGAGTGAACTGGGAGGGGCAGG - Intronic
922152995 1:223021048-223021070 TAGGGACAACTGGAGAGGGCTGG + Intergenic
922937857 1:229434812-229434834 GATAGACAACTGGCGGGGGGAGG + Intergenic
1064659589 10:17592910-17592932 TGGAGACATCTGCCGGGGGCAGG + Intronic
1066318679 10:34277352-34277374 TAGATTCACCTGGCAGGGGGAGG - Intronic
1070487374 10:76943642-76943664 TAGAGTCAGCTGGTGGGAGATGG - Intronic
1070644624 10:78193111-78193133 TGGATGCAACTGGCTGGGGCTGG - Intergenic
1070895991 10:79983179-79983201 CAGCTTCAACTGGCTGGGGCGGG + Intergenic
1075450264 10:122546424-122546446 TTGAGCCAACTGGCCTGGGCAGG + Intergenic
1075484048 10:122806374-122806396 TAGAGACAACAGGCTGGGGAGGG + Intergenic
1076353234 10:129832816-129832838 TAGAGCCAACTGGGGTGGGGTGG + Intergenic
1076568227 10:131413209-131413231 CAGAGTCAGCTGGTGGAGGCTGG + Intergenic
1079808820 11:24969164-24969186 TAGAGTCTACTTGAGTGGGCAGG - Intronic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1082062450 11:47872395-47872417 AAGAGTGAACTGTCAGGGGCTGG + Intergenic
1083460240 11:62806279-62806301 TAGAGACAACAGTCAGGGGCTGG - Exonic
1088814634 11:113412773-113412795 GAGAGTCAGCTGGTGGTGGCTGG + Exonic
1090809106 11:130221188-130221210 CATAGGCAAGTGGCGGGGGCGGG + Intergenic
1094508209 12:31079625-31079647 TAGAGTCACATGGCGGGGTTAGG + Intronic
1100289715 12:93202168-93202190 TAGAGTCATGTGGCGAGGGCTGG - Intergenic
1106640039 13:31574477-31574499 TAGATTTCACTAGCGGGGGCTGG + Intergenic
1109415492 13:62034101-62034123 TAGAGTGAGCAGGCGGGAGCTGG + Intergenic
1115376568 14:32683288-32683310 TAGATTCACCTGGGAGGGGCTGG - Intronic
1120710626 14:87789493-87789515 TACAGTCACGTTGCGGGGGCAGG + Intergenic
1123035872 14:105471722-105471744 TAGAGTTGGCTGGTGGGGGCTGG - Intergenic
1124960367 15:34389281-34389303 CAGGGACAACTGGCGAGGGCGGG + Intronic
1124976996 15:34535502-34535524 CAGGGACAACTGGCGAGGGCGGG + Intronic
1127770072 15:62224118-62224140 TAGGGCCAGATGGCGGGGGCTGG - Intergenic
1129272250 15:74425104-74425126 TAGGGAGAACTGGCAGGGGCTGG + Intronic
1133170691 16:3980941-3980963 TGGAGGCAACGGGCGGGGCCTGG + Intronic
1138449067 16:57082294-57082316 TAGAGTTACCTGGCAGAGGCAGG - Intronic
1139303876 16:65967072-65967094 CAGCTTCAACTGGCTGGGGCAGG + Intergenic
1139478130 16:67213377-67213399 CAGAGGAAACTGGCTGGGGCAGG + Intronic
1140009686 16:71118778-71118800 TAGACTCAACTGGCAAGGCCAGG + Intronic
1142888722 17:2929381-2929403 CACAGTCACCTGGCGGGGCCAGG - Intronic
1151540850 17:74763919-74763941 CAGAGTCCAGTGACGGGGGCCGG + Intronic
1152132955 17:78488294-78488316 TATAGGCAACTGCCAGGGGCAGG - Intronic
1152321162 17:79609624-79609646 CGGAGTCCACTGGTGGGGGCGGG - Intergenic
1155556001 18:27020070-27020092 TAGAGGGCACTGGCGGGGGTGGG + Intronic
1161307528 19:3576247-3576269 TCGAGTCTTCTGGCGGGGGAGGG - Exonic
1162395618 19:10416793-10416815 AATAGGCAAGTGGCGGGGGCGGG + Intronic
1163574821 19:18104520-18104542 TACAGCCAATTGGAGGGGGCCGG - Intronic
1166339476 19:42129127-42129149 TAGAATCACCAGGAGGGGGCTGG - Intronic
1166871892 19:45876402-45876424 TAGAGAGAAAAGGCGGGGGCCGG - Intergenic
1167499144 19:49835813-49835835 GAGGGGCACCTGGCGGGGGCTGG - Exonic
924985296 2:264578-264600 GGGAGTCACCTGGAGGGGGCGGG - Intronic
927911547 2:26903502-26903524 TAGAGTCAACTGGGCTGGGCTGG - Intronic
928065332 2:28159270-28159292 TAGAGTCTACTGGCAGAGTCAGG + Intronic
928410744 2:31052178-31052200 TAGAGTCCACGGGAGGGGGTAGG - Intronic
930033731 2:47073063-47073085 GAGAGTCAGATGGCGGGGGATGG - Intronic
933943392 2:87264031-87264053 TAGCTTCAACTGCAGGGGGCTGG - Intergenic
934046079 2:88173404-88173426 TAGACTGAGCTGGCAGGGGCTGG - Intronic
936336824 2:111597530-111597552 TAGCTTCAACTGCAGGGGGCTGG + Intergenic
939917403 2:148064409-148064431 TAAAGACAGCTGGTGGGGGCCGG - Intronic
940220547 2:151346920-151346942 AAGAATCAACTGGGGGAGGCTGG - Intergenic
948085174 2:235241370-235241392 CACACTCAAATGGCGGGGGCAGG + Intergenic
948131040 2:235600780-235600802 TTGAGTCAACGGGCTGGGGAAGG - Intronic
1169087716 20:2837806-2837828 TACAGTCAACTGGCAGGGTGTGG - Intronic
1170412583 20:16107199-16107221 AAGAGTCAATGGGCGGTGGCAGG + Intergenic
1173346527 20:42205595-42205617 TCCAGCCAACTGGTGGGGGCAGG + Intronic
1178707607 21:34888666-34888688 TAGAGCCAGCGGGCGCGGGCGGG - Intronic
1179943170 21:44652864-44652886 TAGAGTCTTCTGGCGGGGTGTGG + Intronic
1181410240 22:22713352-22713374 TAGAGACTCCTGGAGGGGGCTGG - Intergenic
1181417794 22:22772735-22772757 TAGAGACTCCTGGAGGGGGCTGG - Intronic
1183266283 22:36827962-36827984 TAGAGACAAAAAGCGGGGGCTGG + Intergenic
1184977883 22:48075960-48075982 TAGAATAAACAGGCAGGGGCAGG + Intergenic
955478118 3:59360386-59360408 TAGACTCCACTGTTGGGGGCAGG - Intergenic
967378061 3:188827679-188827701 CAGAGCCAAATGGTGGGGGCAGG + Intronic
976990148 4:91355742-91355764 TAGAGTCACTTTGCAGGGGCTGG + Intronic
977021704 4:91768525-91768547 TAGGGGCAACAGGCTGGGGCTGG + Intergenic
979093389 4:116516253-116516275 TAGGGTAACCTGGAGGGGGCTGG + Intergenic
979533617 4:121795183-121795205 AAGAATCACCTGGAGGGGGCTGG + Intergenic
980849657 4:138365662-138365684 TAGAGACATTTGCCGGGGGCGGG - Intergenic
983980318 4:173987607-173987629 GGGAGTAAACTGGCGGTGGCAGG - Intergenic
985003286 4:185506464-185506486 TAGAGGCCACTGCAGGGGGCGGG - Intronic
985855493 5:2421425-2421447 TAGAGTCCACTGGCAGGTGCCGG - Intergenic
993849590 5:92990396-92990418 AGGAGTCAACTGGGTGGGGCAGG - Intergenic
995799531 5:115979063-115979085 TAGAGCCACCTGGAGGAGGCTGG - Intronic
996124177 5:119706292-119706314 TCGGGGCTACTGGCGGGGGCAGG - Intergenic
1003143022 6:3487354-3487376 CCGAGTCAACTGGCTGGGGCAGG - Intergenic
1006071943 6:31504953-31504975 TAGTGTCCACTGGGGTGGGCAGG - Intronic
1007600195 6:43076514-43076536 CAGAGGCAACCGGCGGGGTCTGG - Intronic
1007761497 6:44136019-44136041 CAGAGTTGACTGGCAGGGGCCGG - Intronic
1008596113 6:53043731-53043753 TAGAGTCTCCTGGCAGGGGATGG + Intronic
1022197392 7:28082373-28082395 TAGAGTGAACGGGCAGAGGCGGG - Intronic
1028982841 7:96985848-96985870 TAGAGTCTAGTGGCGGTGGGGGG - Intergenic
1030526586 7:110661666-110661688 CATAGTCGACTGGTGGGGGCAGG - Intergenic
1032732850 7:134661051-134661073 TAGAGTCAGCTGCTGGGAGCTGG + Intronic
1033656794 7:143380729-143380751 CAGAGTCAGCTGGGGGGTGCTGG + Intergenic
1039508200 8:38067676-38067698 TAGAGTCAGCTGGCGGCTGCTGG - Intergenic
1040767041 8:50924721-50924743 TTCAGTCAACTGCGGGGGGCGGG - Intergenic
1047332958 8:123908989-123909011 TATAGTCAACTGGAGGGGCATGG + Intronic
1049615185 8:143572824-143572846 TAGCGTGAGCTTGCGGGGGCTGG + Exonic
1052192631 9:25677533-25677555 AAGTGTCCACTGGTGGGGGCGGG + Exonic
1054915671 9:70493338-70493360 TAGAGTCAACAGGCGCTTGCGGG + Intergenic
1059407677 9:114111957-114111979 TAGAGTCACCTGGAGTGGGCTGG - Intergenic
1060127294 9:121060665-121060687 TAGAGTCAGCTGGGTGGGGTGGG - Intergenic
1060188922 9:121580099-121580121 TAGAGTCACCTGGTGGGGCAGGG - Intronic
1062196050 9:135274794-135274816 TAGAGCAAAATGGCTGGGGCAGG + Intergenic
1062637302 9:137498360-137498382 GAGAGACCACTGGCAGGGGCTGG + Intronic
1186388568 X:9134891-9134913 GAGAGTCAAGGGGTGGGGGCGGG - Intronic
1187495567 X:19792764-19792786 TGGAGGGATCTGGCGGGGGCGGG + Intronic
1189301530 X:39955975-39955997 TGGAGTCAACTGACGGGAGCTGG - Intergenic
1192822925 X:74663558-74663580 TAGAGTGAACTGGAAGGAGCTGG + Intergenic
1195939171 X:110153191-110153213 CAGAGGCAGCTGGCGGGAGCTGG - Intronic