ID: 902359604

View in Genome Browser
Species Human (GRCh38)
Location 1:15935223-15935245
Sequence GGGACATGGTTGACTTCTGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902359604_902359616 21 Left 902359604 1:15935223-15935245 CCTACAGAAGTCAACCATGTCCC 0: 1
1: 0
2: 2
3: 16
4: 135
Right 902359616 1:15935267-15935289 AGATCGAACTGTCTCCCATTTGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902359604 Original CRISPR GGGACATGGTTGACTTCTGT AGG (reversed) Exonic
900808107 1:4781184-4781206 GGGACATGCCTGCCTTCTGAGGG - Intronic
902359604 1:15935223-15935245 GGGACATGGTTGACTTCTGTAGG - Exonic
903666395 1:25010081-25010103 TGGGCAGGGCTGACTTCTGTAGG + Intergenic
905488423 1:38324391-38324413 GGGACAGGATTGACTGATGTTGG - Intergenic
905996140 1:42381782-42381804 AAGACATGGTTGTCATCTGTGGG + Intronic
906551687 1:46671002-46671024 GGGCCATGCTTGACTCCTGGGGG - Intronic
910855768 1:91693700-91693722 GGCACATGGTAAACATCTGTGGG + Intronic
911341969 1:96650448-96650470 TGGTCATGCTGGACTTCTGTTGG - Intergenic
915896215 1:159813325-159813347 TGGACATGGTTGATTTTTATGGG - Intronic
916208866 1:162342148-162342170 AGGAGATGGGTAACTTCTGTGGG - Intronic
917752639 1:178067496-178067518 GGGACATGGTTGATGTTCGTGGG + Intergenic
919037099 1:192327035-192327057 AGGAAATGGCTGACTTCTCTAGG - Intronic
919288673 1:195600126-195600148 TGCACAAGGTTGACTTTTGTTGG + Intergenic
921621576 1:217331350-217331372 GGGACATGGTTGAATCATGGAGG - Intergenic
923519655 1:234725830-234725852 GGGACTTGGTTGACCTCCTTTGG + Intergenic
1063231971 10:4074275-4074297 GAGGCATGGATGACTTCTATAGG + Intergenic
1063754082 10:8985881-8985903 GGGCCAAGGTTGCCTTCTGGTGG + Intergenic
1067944535 10:50681849-50681871 GGGTCATGGTGGGCTTCTGCCGG - Intergenic
1071331690 10:84566735-84566757 GGGACATGGGACACTTCTATTGG + Intergenic
1073859637 10:107722910-107722932 GGGAGATGGTTGAATTCTGGGGG + Intergenic
1077394915 11:2316015-2316037 GGGACAGGGCTGGCCTCTGTGGG - Intronic
1077929733 11:6718574-6718596 GGGGCATGGTAGAGATCTGTTGG - Intergenic
1079799063 11:24845634-24845656 GGGACATGATTGAATTATGGGGG + Intronic
1080422432 11:32122938-32122960 GGGACTTCGTTGAGTGCTGTGGG - Intergenic
1084085599 11:66853688-66853710 GGGGCAAGGGTGACTGCTGTGGG - Intronic
1090207771 11:124895420-124895442 GGGATATTGTTGGCTTCTGAAGG + Intronic
1090638800 11:128712708-128712730 GGGAGATGATTGAATTCTGGGGG - Intronic
1090735269 11:129607308-129607330 TGGAAATGGTTGACTTGTGTTGG - Intergenic
1091134924 11:133180000-133180022 GGCCCATGGTTGCCTTCTGCGGG - Intronic
1091732147 12:2889274-2889296 GGGACATAGATGAGTTCTTTAGG + Exonic
1093416637 12:18927992-18928014 GGGAGTTGGATGACTTCTGCTGG - Intergenic
1094065505 12:26357344-26357366 GGGGCTTGGTTGAATTTTGTTGG + Intronic
1095381899 12:41605018-41605040 AGTACATGGTTGACTTCTGTAGG + Intergenic
1095819134 12:46458195-46458217 GGTACATGGTAGGGTTCTGTTGG - Intergenic
1096877450 12:54641271-54641293 GGTACCTGCTTGACTCCTGTAGG - Intergenic
1102596987 12:114000518-114000540 GGGAGATGATTGAATTATGTGGG - Intergenic
1104570148 12:129917944-129917966 GGGACATGGTTGACTGCCCTTGG - Intergenic
1104765561 12:131327924-131327946 GGGATGTGGTTGGTTTCTGTTGG - Intergenic
1105223116 13:18352240-18352262 GGGATTTTGTTGAGTTCTGTTGG - Intergenic
1107229267 13:38087788-38087810 GGAACATGGTTGACATCTTTAGG - Intergenic
1107797069 13:44063713-44063735 AGGCTATGTTTGACTTCTGTAGG + Intergenic
1111659589 13:91192779-91192801 GGGACAAGGCTGAATTCTGTAGG + Intergenic
1111877900 13:93919423-93919445 AGGACATGGTTCACTAATGTGGG + Intronic
1118243077 14:64080760-64080782 GGGCCATGGTAGGCTTGTGTGGG + Intronic
1121029673 14:90647177-90647199 GGGAAATGGTTTACATGTGTAGG - Intronic
1121340149 14:93100198-93100220 GGGACAGGGATTCCTTCTGTTGG - Intronic
1122211373 14:100176111-100176133 GGGACATGTTTGAGGTCTTTGGG - Intergenic
1122673044 14:103386234-103386256 GGGACACGGCAGACTTCTGGAGG - Intronic
1123761607 15:23437934-23437956 GGGACAGGGAGGACTTCTGTTGG + Intergenic
1124006744 15:25800886-25800908 GAGACAGGCTTGACTTCTATGGG - Intronic
1127709179 15:61578670-61578692 GGGACTTGGATGTCTTCTGTTGG - Intergenic
1131279201 15:91007104-91007126 TGGAAAGGGCTGACTTCTGTAGG - Intronic
1132290923 15:100703470-100703492 GGGCCCTGGGTGACTTCTGAGGG + Intergenic
1133463503 16:6007843-6007865 GGGACATTGATGACATCTGTAGG + Intergenic
1137577303 16:49608800-49608822 GGGTCATAGTTTTCTTCTGTGGG - Intronic
1139201827 16:64985571-64985593 GGGACATGAATGACTTCTTGTGG - Intronic
1139775619 16:69315322-69315344 GGGACACAGTTCTCTTCTGTTGG + Intronic
1140420770 16:74817135-74817157 GGGCCATGGATGGCTTCTGGAGG - Intergenic
1143469141 17:7160827-7160849 AGGACCTGGTTGAGTTCTGATGG - Intergenic
1144658767 17:17055157-17055179 GGGACCTGCATGACTTCTCTGGG - Intronic
1147166637 17:38596867-38596889 GGGGCATGGTGGACAGCTGTAGG - Intronic
1153735850 18:8066415-8066437 GGGACATGGTCCACTTCAGATGG - Intronic
1159505166 18:69327390-69327412 CTGACACGGTTGACTTCTGCCGG - Intergenic
1162139446 19:8577185-8577207 GGGGCATGGTGGACTTCTGTGGG - Intronic
1163114595 19:15181294-15181316 GGGACCTGATTGGCTTCTGCTGG - Intronic
1166422870 19:42652385-42652407 GGGACCCTGCTGACTTCTGTTGG - Intronic
1167676610 19:50890676-50890698 GGGACATGGCTCACATGTGTGGG - Intergenic
925633251 2:5916335-5916357 GGGACATGGTTAATATTTGTGGG - Intergenic
926070050 2:9880276-9880298 GGGACATGGCTAAACTCTGTTGG + Intronic
928821558 2:35367276-35367298 GGGAGATGATTGACTTATGGGGG + Intergenic
933294547 2:80474265-80474287 GTGACATGGTTGGCTTTTGTTGG + Intronic
939390410 2:141561918-141561940 AGGAGATGGTTAACTTCTATTGG - Intronic
941158641 2:162009478-162009500 TGAACATGGTTTACTTTTGTTGG + Intronic
1169826390 20:9773130-9773152 GGGACATGTTGTACTTCTTTAGG - Intronic
1175618698 20:60424841-60424863 GGGACCAGTTTGAATTCTGTTGG + Intergenic
1176309221 21:5140984-5141006 GGGACATGTTTGACAGCTGGAGG - Exonic
1176731664 21:10504658-10504680 GGGATTTTGTTGAGTTCTGTTGG - Intergenic
1178818876 21:35957174-35957196 GTTACATGTCTGACTTCTGTAGG - Intronic
1179355903 21:40659108-40659130 GGCACATTGGTGACATCTGTGGG - Intronic
1179821423 21:43939460-43939482 GGGACGTGCCTGACTTCTGGAGG + Intronic
1179847840 21:44121049-44121071 GGGACATGTTTGACAGCTGGAGG + Exonic
1180732086 22:17989659-17989681 GTGACCATGTTGACTTCTGTGGG - Intronic
1180840325 22:18956074-18956096 GGGACATGGATGACTCCAGCTGG + Intergenic
1181061163 22:20282702-20282724 GGGACATGGATGACTCCAGCTGG - Intronic
1181364409 22:22364045-22364067 GAGACAAGCTAGACTTCTGTGGG - Intergenic
1182131674 22:27857672-27857694 GGGCCATGCTTGTCTTCAGTTGG - Intronic
950634916 3:14307856-14307878 GGGACATGTTTAAATTCTGGTGG - Intergenic
951763617 3:26172172-26172194 GGGAGATGGTTGAATTATGGGGG + Intergenic
953558400 3:43965262-43965284 GGGACATGGTTGGGCTCTGATGG - Intergenic
959489245 3:106968218-106968240 AGGAAGTTGTTGACTTCTGTAGG - Intergenic
962610008 3:137067247-137067269 GGGATATTCTTGACTTCTGAGGG + Intergenic
963243324 3:143032972-143032994 GGGAGATAGTTGACGTCTTTTGG + Intronic
963573811 3:147033408-147033430 AGAACCTGGTTGACTTCTGTAGG - Intergenic
964681601 3:159346005-159346027 GAGACAGGGTTTCCTTCTGTTGG - Intronic
965255753 3:166408523-166408545 GGGCCATGGTTGTGCTCTGTGGG + Intergenic
965938711 3:174148316-174148338 GGGAAATGTATGACTTCTGTAGG - Intronic
967394312 3:188990095-188990117 GGGATCAGGTTGACTTCAGTGGG + Intronic
969094873 4:4724833-4724855 GTATCATGGTTGACTTCTGCTGG + Intergenic
969203306 4:5622757-5622779 GGGTCATGGCTGAGTTCTGCAGG + Exonic
970960653 4:21867548-21867570 AGGACAGGATTGACTTCTGCAGG + Intronic
976597297 4:86906136-86906158 GGGAAATGGCTGAGTTCTGAAGG - Intronic
978000564 4:103552876-103552898 GGCTCATGGTTGACTGCTTTGGG - Intergenic
978072146 4:104487351-104487373 GTGACATGATTGATCTCTGTGGG - Intronic
981879775 4:149595560-149595582 GGGACATGACTGACTTCTTCAGG - Intergenic
983245746 4:165284993-165285015 GGGAGATGATTGAATTATGTGGG - Intronic
986573526 5:9189623-9189645 GGGACCTGGCTGAGCTCTGTGGG - Intronic
986677716 5:10201428-10201450 GGGACATGAATGACTGGTGTGGG + Intergenic
987097753 5:14565348-14565370 GGGACATGGTTGAATCCAGGAGG - Intergenic
991010556 5:61878693-61878715 GGCACCTGCTTGATTTCTGTGGG - Intergenic
991143379 5:63273327-63273349 GGGAGATGGTTGAATCCTGGGGG - Intergenic
991598589 5:68329841-68329863 GGGGCATGGTTTTCTTCTGGGGG - Intergenic
994924382 5:106095765-106095787 GAGAGATGGCTGACTTTTGTGGG + Intergenic
995191850 5:109326250-109326272 AGGAAATGGTTTATTTCTGTAGG + Intergenic
995695166 5:114870829-114870851 AGGACATGGTTGTCTTGTGCTGG - Intergenic
996519011 5:124405508-124405530 TGGAAATGGTTGAGTTCTTTAGG + Intergenic
996582124 5:125042991-125043013 GGGAGATAGGTGACTTCTGTAGG - Intergenic
1000365472 5:160486671-160486693 GGGACATGGGTGTGTTCTCTGGG + Intergenic
1000998294 5:167980973-167980995 GGGACTTGGCTGAGCTCTGTTGG - Intronic
1009825179 6:68857873-68857895 GGGAGATGATTGAATTATGTGGG + Intronic
1012160451 6:95878634-95878656 GGGAAAAGGATCACTTCTGTGGG - Intergenic
1013428942 6:110038959-110038981 GAGAAATGATTGATTTCTGTTGG + Intergenic
1015207254 6:130653863-130653885 GTGACGTGGTTGATTTCTGTAGG + Intergenic
1015693153 6:135949115-135949137 GGGAAATGGTTGAATACTGCAGG + Intronic
1017872891 6:158502054-158502076 GGGCCTTGGCTGACTTCTGCAGG - Exonic
1028722506 7:94049865-94049887 GGCAGGTGGGTGACTTCTGTAGG + Intergenic
1030642828 7:112025596-112025618 GGGATATGATTGACTTCGTTTGG - Intronic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1031440470 7:121788486-121788508 GGGACATGGTAAACATCTGAAGG + Intergenic
1035990852 8:4488743-4488765 GGGTCATAGCTGACTTCTGAGGG - Intronic
1037322089 8:17653718-17653740 GGGCCATGGTGGGCTTCAGTGGG - Intronic
1037603652 8:20419748-20419770 GGGATAGGGATGACTTCAGTGGG + Intergenic
1039355685 8:36812756-36812778 GGGAGATGGCAGCCTTCTGTGGG - Intronic
1039951287 8:42174714-42174736 TGGACTTAATTGACTTCTGTAGG - Intergenic
1041118401 8:54563004-54563026 GGGACATCTTTGACTGCTGTAGG - Intergenic
1044814669 8:96099322-96099344 GGGAAATGCTTGACTTCTCATGG + Intergenic
1045547760 8:103143130-103143152 GGGAATGGCTTGACTTCTGTGGG + Intronic
1045916404 8:107476886-107476908 GGGAAAAGGTTGAATTCTGAGGG - Intronic
1047027134 8:120836281-120836303 GGGACTTGCAGGACTTCTGTTGG + Intergenic
1047082861 8:121482944-121482966 GGGACACAGGTGGCTTCTGTGGG - Intergenic
1048125786 8:131634486-131634508 GGTACATGTTTGACTTTTGAAGG + Intergenic
1052010650 9:23404591-23404613 GGCACATGGATGGCATCTGTGGG - Intergenic
1054747090 9:68865503-68865525 GAGAAATGGAGGACTTCTGTGGG + Intronic
1061513027 9:131072436-131072458 GGGTCATGTTTGCCTTCTCTGGG + Intronic
1062471384 9:136707031-136707053 GAGCAATGGCTGACTTCTGTTGG - Intergenic
1062516119 9:136937404-136937426 GGGTCATGTTTGAATCCTGTGGG + Intronic
1190982954 X:55472913-55472935 GGGACATTGGTGACTTTTTTGGG - Intergenic
1190985745 X:55500270-55500292 GGGACATTGGTGACTTTTTTGGG + Intergenic
1194254965 X:91624156-91624178 AGGTCATGGTTGCTTTCTGTGGG + Intergenic
1198219583 X:134587232-134587254 AGGAAATGTCTGACTTCTGTGGG - Intronic
1198673398 X:139106006-139106028 GGCATTTGGTTGACTTCTGTTGG + Intronic
1199897169 X:152136792-152136814 GGGTCATGGCAGATTTCTGTGGG + Intronic
1200573751 Y:4863759-4863781 AGGACATGGTTGCTTTCTGTGGG + Intergenic
1202181766 Y:22145865-22145887 GGGTCATGGTTTACTTGTGGGGG - Intergenic
1202209594 Y:22440537-22440559 GGGTCATGGTTTACTTGTGGGGG + Intergenic