ID: 902360141

View in Genome Browser
Species Human (GRCh38)
Location 1:15937911-15937933
Sequence TCCCTGCCCCTTTCTGAAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 330}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902360137_902360141 -10 Left 902360137 1:15937898-15937920 CCTGGCCCATCGGTCCCTGCCCC 0: 1
1: 0
2: 3
3: 33
4: 405
Right 902360141 1:15937911-15937933 TCCCTGCCCCTTTCTGAAGGAGG 0: 1
1: 0
2: 3
3: 41
4: 330
902360134_902360141 14 Left 902360134 1:15937874-15937896 CCACTTCGTCTCTGGCAACAACG 0: 1
1: 0
2: 1
3: 3
4: 66
Right 902360141 1:15937911-15937933 TCCCTGCCCCTTTCTGAAGGAGG 0: 1
1: 0
2: 3
3: 41
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902360141 Original CRISPR TCCCTGCCCCTTTCTGAAGG AGG Exonic
900923320 1:5687600-5687622 GCTCTCCCCCTTTCTGAATGGGG + Intergenic
901306754 1:8238634-8238656 TCCCTGGCACTTTCTGAGTGGGG - Intergenic
901822977 1:11842129-11842151 TCCCCGCCCCTTCCTGGAGCTGG + Exonic
902129111 1:14243318-14243340 GCCCTACCCTTTTCTGCAGGCGG + Intergenic
902360141 1:15937911-15937933 TCCCTGCCCCTTTCTGAAGGAGG + Exonic
902551840 1:17224001-17224023 ACCCTGGCCCTGGCTGAAGGGGG - Intronic
903058679 1:20654467-20654489 ACCCTGGCCCTACCTGAAGGGGG + Intronic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
903525640 1:23992065-23992087 ACCCTGACCCTTTCTGATTGTGG + Intergenic
905638701 1:39574147-39574169 TCCCCACCCCCTTCAGAAGGTGG + Intronic
905904437 1:41608467-41608489 TGCCTGCCTCTTTGTGAAGAAGG + Intronic
908175588 1:61552390-61552412 TCCCTCTCCCTTTCTCAAGGAGG + Intergenic
909261771 1:73499223-73499245 TCACAGTCCATTTCTGAAGGAGG + Intergenic
909359758 1:74746576-74746598 TCACAGCCCCTTTTTGAGGGGGG + Intronic
910107055 1:83642910-83642932 TCCCTGGCACTTTCTAGAGGAGG - Intergenic
910315428 1:85877123-85877145 TCCATGCCCATTTCTCCAGGAGG + Exonic
911773136 1:101773155-101773177 TTCCTGCCACTTTGTGAAGAAGG - Intergenic
912467942 1:109886810-109886832 TCCCTGCCCATTTCTACAAGTGG - Intergenic
912601181 1:110934604-110934626 TTCCTTCCCCTTTCCAAAGGCGG - Intergenic
912950469 1:114117171-114117193 TCTCTGACCCTTTCTGATGATGG + Intronic
914250974 1:145920998-145921020 TCCCTGCCCCAATCTGAAGGAGG - Intergenic
914341662 1:146765170-146765192 TGAATGCCCCTTTCAGAAGGAGG - Intergenic
915285523 1:154849662-154849684 TCCCTCACCCTTTCCCAAGGGGG - Intronic
918839290 1:189513501-189513523 TGGCTGCCCCTTGGTGAAGGGGG - Intergenic
919570461 1:199242495-199242517 CTCCTGTCCCTTTCTGAACGTGG - Intergenic
920531879 1:206708047-206708069 TCCCTGCCCCTCTCTGGCTGTGG - Intronic
921236698 1:213139176-213139198 TCCCTGCCCATTTTTTAATGGGG + Intronic
921345204 1:214176582-214176604 TCCCAGACCCTTCCTGCAGGTGG + Intergenic
922686128 1:227639988-227640010 TTCCTGCTACTTCCTGAAGGGGG + Intronic
923100013 1:230806715-230806737 TTCCTGCCGCTTTGTGAAGAGGG - Intergenic
924588172 1:245378298-245378320 TCCCTCCCCCTTTTTGATGTGGG + Intronic
1063873367 10:10444505-10444527 TCCCTGCCCTTTTCGAAATGAGG - Intergenic
1064220485 10:13436533-13436555 TTCCTGCCCCCTTGTGAAGAAGG + Intergenic
1069659230 10:70112650-70112672 TCCCTGCTCCCTTTTGATGGTGG - Exonic
1069723703 10:70564639-70564661 CCCATCCCCCTTTCTGCAGGAGG + Intronic
1069819142 10:71216977-71216999 CCTCTGCCCTTTCCTGAAGGCGG - Intronic
1071162650 10:82768083-82768105 TCCAGGCTCCTTTCTAAAGGCGG + Intronic
1072465794 10:95661289-95661311 TACCTGCCCCTTTCAGAATCCGG - Intergenic
1074464169 10:113667259-113667281 TCCCTGTGCCTTGCTGAGGGGGG - Intergenic
1074726595 10:116316363-116316385 TCCCTGCCACTATATGAAGAAGG + Intergenic
1075916165 10:126169272-126169294 TGCCTGCCCCTTCCTAAATGCGG + Intronic
1076173016 10:128338734-128338756 TCCTTGCACCTTGCTGATGGTGG + Intergenic
1076188757 10:128468402-128468424 TCCCTGCCTCCTTCTCATGGCGG + Intergenic
1076875037 10:133211629-133211651 TCACTGCCACCTTCTGGAGGAGG - Intronic
1077488042 11:2848060-2848082 CACCTGGCCCTCTCTGAAGGAGG + Exonic
1078139589 11:8682645-8682667 TCGCTTCCTCTTTCTGAGGGTGG - Exonic
1078657592 11:13256147-13256169 TCGCTGCCACTTTCTCAAGGTGG - Intergenic
1079257787 11:18847388-18847410 TCCCTGCTGCTTTGTGAAGAAGG + Intergenic
1080623017 11:34003249-34003271 TTCCTGCCACCTTGTGAAGGAGG + Intergenic
1080921256 11:36711566-36711588 TTCCTGTCCCTTTCTGAAGCAGG + Intergenic
1083484907 11:62977155-62977177 TCCCTGCTTCTTTCTGAGTGGGG + Exonic
1085008184 11:73114477-73114499 TCCCTCCCCTTTTCTCAAGCAGG + Intronic
1085399752 11:76228779-76228801 TCCCTGCCCCTCTCTGAGCCTGG - Intergenic
1086483294 11:87268414-87268436 CCCCTGCTCCTTTCTAAAGATGG + Intronic
1086769670 11:90745943-90745965 TTCCTGCCACTTTGTGAAGAAGG + Intergenic
1087049135 11:93868550-93868572 TTCCTGCTACTTCCTGAAGGGGG + Intergenic
1087162035 11:94958571-94958593 TCTCTGCCTCTTTCTGAAAAGGG + Intergenic
1087280718 11:96206956-96206978 TCCCTGCCCCTTTTTTATGCTGG - Intronic
1087427621 11:98011505-98011527 TTCCTGCCCCCTTGTGAAGAAGG - Intergenic
1088835403 11:113574403-113574425 TCCCTCCTACTGTCTGAAGGGGG - Intergenic
1089067104 11:115670366-115670388 TCTCTGCCCCTGTCTGATAGTGG + Intergenic
1089584524 11:119502107-119502129 GCCCTGCCTCTCTCTGCAGGAGG - Intergenic
1090595966 11:128321646-128321668 ACCCTGACCCTTTTTGAAAGGGG - Intergenic
1090627713 11:128620505-128620527 TCCCTGCACATCTCTGAAGATGG + Intergenic
1091033689 11:132214191-132214213 GCCCTGGGCCCTTCTGAAGGAGG + Intronic
1091814253 12:3424321-3424343 TACTTGTTCCTTTCTGAAGGTGG + Intronic
1091818918 12:3459806-3459828 TCCCTGTCTCTTTCTCATGGTGG + Intronic
1092531406 12:9348648-9348670 TCCCTGTCTCTTTCTCATGGTGG - Intergenic
1093047892 12:14471644-14471666 TCCCTGCCCTTATGTGAAGAAGG - Intronic
1096382740 12:51172831-51172853 CCCCCGCCCCTTTCTGCTGGAGG + Exonic
1096552615 12:52383263-52383285 TCCCTTCCACTTTCTTAATGTGG + Intronic
1096877698 12:54643559-54643581 TCCTTCCCCCTTTCTGTAGTTGG + Intergenic
1098469815 12:70830337-70830359 TCACTGCCCCAGTCTGAGGGAGG + Intronic
1098771723 12:74560761-74560783 TCCCTGCCACATTATGAAGAAGG - Intergenic
1099076443 12:78114498-78114520 TCCCTGCCACCATGTGAAGGAGG - Intronic
1099373897 12:81872407-81872429 TTCCTGCCACCTTGTGAAGGAGG - Intergenic
1099860982 12:88225927-88225949 TTCCTGCCACTTTGTGAAGAAGG - Intergenic
1102491606 12:113292841-113292863 TCCTTGCCCCCTTCCGCAGGGGG - Intronic
1102666864 12:114581549-114581571 TTCCTGCCACTTTGTGAAGAAGG - Intergenic
1102815616 12:115863298-115863320 TGCCTGCGTCTTTATGAAGGTGG - Intergenic
1102825072 12:115942331-115942353 TTCCTGTCCCTTGCTGCAGGTGG - Intergenic
1103589859 12:121983987-121984009 TCCATGCAACTTCCTGAAGGAGG - Intronic
1103667358 12:122580025-122580047 TCGATGCCTCTTTCTGAAGAGGG - Intronic
1105545992 13:21351568-21351590 TCCCTGTCCCTTTTTTAAGACGG - Intergenic
1106046646 13:26148115-26148137 TTCCTGCCCCCTTGTGAAGAAGG - Intronic
1108978350 13:56478779-56478801 ACCCAGCCCCTTCCTGCAGGAGG + Intergenic
1111212508 13:85097990-85098012 TTCCTGCCACCTTCTGAAGAAGG + Intergenic
1112048056 13:95617228-95617250 TCCCAGGCCCTTCCTGAAGCGGG + Intronic
1113331799 13:109334521-109334543 CCCCTGCCCCTCTCTGGAGAGGG + Intergenic
1113333046 13:109349956-109349978 TCTCTGCCCCTTATTGAGGGTGG - Intergenic
1114312750 14:21482554-21482576 TTCCTGGGCCTTTTTGAAGGAGG - Intronic
1115410612 14:33069942-33069964 TACGTGCCTCTTTTTGAAGGTGG + Intronic
1116472894 14:45306083-45306105 TACCTGGCCATTTCTGCAGGAGG - Intergenic
1119246890 14:73117874-73117896 ACTCTGCTCCCTTCTGAAGGGGG - Intronic
1120121206 14:80681666-80681688 TCCCTGCCGCCTTATGAAGAAGG + Intronic
1121073892 14:91050852-91050874 TCCCTGCTGCTTTTTGAATGTGG - Intronic
1121653416 14:95576612-95576634 TCCTGGCACCTTTCTGAAGGTGG - Intergenic
1124130972 15:26985335-26985357 TCCCTGCCCGTTCCTGGATGAGG + Intronic
1124436522 15:29653599-29653621 TTCCTGCCACTTTGTGAAGAAGG + Intergenic
1125215775 15:37272610-37272632 TTCCTGCCACTTTGTGAAGAAGG - Intergenic
1125515849 15:40320665-40320687 TTCCTGGCCCTTTCTGAGGCAGG + Intergenic
1125744720 15:41990435-41990457 TCCCGGCCCCTGTCTGGTGGTGG - Intronic
1126607606 15:50494665-50494687 TCCCAGTCCCTTGCTGAAAGTGG + Intronic
1129011609 15:72423358-72423380 TCCCTGCCCCTGTGTGTGGGAGG - Intergenic
1129673678 15:77620994-77621016 TCCCTTCCCTTTTCTAAAGAAGG - Intronic
1130189230 15:81716060-81716082 TACCTGCTTTTTTCTGAAGGGGG + Intergenic
1130554464 15:84913155-84913177 TCCCTTCCACTTTCTGGCGGTGG + Intronic
1131073187 15:89478619-89478641 TCCATGTCCCTTCCTGCAGGTGG + Intronic
1131366612 15:91846910-91846932 TCCTTCCCCCTTTCTTCAGGGGG - Intergenic
1131451530 15:92544261-92544283 TCCCTGCCACTATGTGAAGAAGG - Intergenic
1132764770 16:1528844-1528866 GCCCTGCCCCTGTGAGAAGGAGG + Intronic
1132907913 16:2292999-2293021 CCCCTGCCCCATTCTATAGGGGG - Intronic
1133025573 16:2987705-2987727 TCCCTGCCCCTCATGGAAGGAGG + Intergenic
1133280776 16:4663975-4663997 TCCCTGTAACTTTCTGAAGAAGG - Intronic
1134684140 16:16146971-16146993 TTCCTGCCCCACTTTGAAGGTGG + Intergenic
1135423789 16:22322422-22322444 CACCTGCCCCTTTCAGCAGGTGG + Intronic
1135762877 16:25151662-25151684 TCCCACCCCCTTTTTGAAGATGG + Intronic
1136429066 16:30186512-30186534 TCTCTGGGCCTCTCTGAAGGAGG + Intronic
1136586212 16:31186952-31186974 ACCCTACCCCTTTCTGGAGGTGG - Intronic
1137293483 16:47068332-47068354 TTCCAGCGCTTTTCTGAAGGAGG - Intergenic
1137400858 16:48153566-48153588 TCCCAGCCCCTTTGAGAAGGTGG + Intronic
1137434170 16:48441909-48441931 TCTCTGACTCTTTCTGATGGGGG + Intronic
1137539116 16:49349914-49349936 TCCCTGACCTTGTCTGCAGGTGG + Intergenic
1138499102 16:57427623-57427645 TCCCTGCCACCTTGTGAAGGAGG + Intergenic
1139664416 16:68446762-68446784 TCCAGGCCCCTTGCTCAAGGTGG + Intronic
1139796074 16:69483942-69483964 TCCATGCCTCTTTCTGATGGAGG + Intergenic
1139992616 16:70952272-70952294 TGAATGCCCCTTTCAGAAGGAGG + Intronic
1141305949 16:82864478-82864500 TTCCTGCCACCTTCTGAAGAAGG - Intronic
1142610670 17:1107958-1107980 TCCCTGCCCCTCACAGAAGATGG - Intronic
1142716969 17:1752567-1752589 TCCCTTCCCTTTTCTGTAGGTGG + Exonic
1143831741 17:9657641-9657663 TTCCTGCCACCTTGTGAAGGAGG - Intronic
1144334330 17:14255444-14255466 TCCCTGCTCCTGTCTGAAGCTGG + Intergenic
1145882896 17:28364894-28364916 TAGCTGCCCTTTGCTGAAGGTGG + Exonic
1146764415 17:35506401-35506423 CCACTTTCCCTTTCTGAAGGTGG - Intronic
1147020168 17:37525476-37525498 TCCCTGCCCCTTTTTCAATCAGG + Intronic
1147430316 17:40366831-40366853 TGCCTTCCCCTTCCTGAAAGTGG - Intergenic
1147447588 17:40484225-40484247 TCCCTGCTTTTTTCTGATGGTGG - Intronic
1147957036 17:44141898-44141920 TGCCTGCCCCTTTAAGAAGGCGG + Exonic
1148067961 17:44886958-44886980 AACTTGCCCCTTTCTGAATGTGG + Intronic
1148909711 17:50934877-50934899 TCCCTGCCTCTTTGCGGAGGTGG + Intergenic
1149382130 17:56104913-56104935 ACCCAGCCCCTGGCTGAAGGAGG - Intergenic
1149660157 17:58330663-58330685 TCCCTGCCCCTTTCTGCAGATGG + Intergenic
1150259129 17:63774179-63774201 TCACGGCCCGTTGCTGAAGGGGG - Exonic
1151726564 17:75888515-75888537 TCTCTGCCCCTTTCAGAGCGCGG + Intronic
1151744877 17:76006676-76006698 TCCCTGCCCCGCACTCAAGGAGG + Intronic
1151830630 17:76547296-76547318 GCCCTGCCCCTGGCTGAAGGAGG - Intronic
1203163868 17_GL000205v2_random:76221-76243 TCCCTGTCGCTTTCTGCAGGTGG - Intergenic
1153024520 18:660419-660441 TCCCTTCCCCTGTTAGAAGGGGG + Intronic
1154009102 18:10560280-10560302 TCCCTGCCCGTTTCTCACGTGGG - Intergenic
1155233033 18:23793084-23793106 TCCCTGCCCATTCCTTAATGTGG - Intronic
1157160636 18:45311017-45311039 TACCTGCCCATGTCTGAAGCTGG - Intronic
1157644402 18:49252363-49252385 TCCCTGCCACTTTGTGAAGAAGG - Intronic
1157795896 18:50574978-50575000 CCTCTGCTCCTTGCTGAAGGAGG - Intronic
1157911740 18:51623030-51623052 TCCCTGCCCCTTTCTGTTCCTGG - Intergenic
1159725207 18:71949650-71949672 TCCCTTCCTATTTCTAAAGGAGG + Intergenic
1160083757 18:75754644-75754666 TCCATGCACAGTTCTGAAGGTGG - Intergenic
1162461222 19:10815567-10815589 TCCCAGCTCCTCTCTGTAGGAGG + Intronic
1163674030 19:18646421-18646443 CTCATGCCCCTTTCAGAAGGAGG + Intronic
1164227196 19:23256274-23256296 ACCTGGCCCCTTCCTGAAGGGGG - Intergenic
1164237003 19:23346061-23346083 TTTCTGCCACTTCCTGAAGGGGG - Intronic
1164525687 19:29011664-29011686 TGCCAGCCTCTTCCTGAAGGCGG + Intergenic
1164570382 19:29370402-29370424 TCCCTGGCCCTTTCAAAAGCAGG - Intergenic
1166062766 19:40336921-40336943 TCCATGCCTCTCTCTGAGGGAGG - Intronic
1166503241 19:43355973-43355995 TCGCTCCCCCTTTCTGCAGGAGG + Exonic
1166507213 19:43378788-43378810 TCGCTCCCCCTTTCTGCAGGAGG - Intergenic
1166968684 19:46547395-46547417 TTCCTGCCGCTTTGTGAAGAAGG + Intronic
1167293412 19:48636412-48636434 TTCCTGCCCCTTACAGATGGTGG - Intronic
925736355 2:6967449-6967471 CCCTTGCCCCTTTCTGCATGGGG + Intronic
926059508 2:9796366-9796388 TCCCTGGCCCTGGCTGTAGGAGG + Intergenic
926307608 2:11650214-11650236 TCCCTGCCCCTTCCCTAATGTGG - Intergenic
927647479 2:24887155-24887177 TTCCTGCTGCTTTGTGAAGGAGG - Intronic
928593782 2:32841816-32841838 TTCCTGCCGCCTTCTGAAGAAGG + Intergenic
929493131 2:42415357-42415379 TCACTGCCCCTTCCTATAGGAGG + Intronic
930095245 2:47561577-47561599 GCCCTGCCTCTCTGTGAAGGAGG - Intronic
930891707 2:56396823-56396845 TTCCTGCCACTTTGTGAAGAAGG + Intergenic
931523111 2:63121169-63121191 TGCCTGCCCCTTTCTCCAGAGGG + Intergenic
932329075 2:70887546-70887568 TCCCTGCCCTTTTGTCCAGGTGG - Intergenic
935650770 2:105379964-105379986 TCCCTGTCACTCTCTGAATGGGG + Intronic
936165320 2:110115535-110115557 TCCCCCCCCCTCTCTGCAGGTGG + Intronic
936281535 2:111144698-111144720 TCACTGCCTCTGTCTGCAGGTGG - Intronic
936502867 2:113080194-113080216 CCCCTGCCCATTTCTGAGGCTGG + Intergenic
936920295 2:117681734-117681756 TCCCTGCCACCATGTGAAGGAGG + Intergenic
937560565 2:123219088-123219110 TCCCTCCACTTTTCTGAAGCAGG - Intergenic
937971380 2:127551944-127551966 ACCCTGCCCCTGTCTGTAAGGGG + Intronic
938629398 2:133149791-133149813 TCCATGCCCCCTACTTAAGGGGG + Intronic
940516580 2:154691263-154691285 TCCCTGCCCCTTTGTCACGGAGG + Intergenic
941587486 2:167379153-167379175 TTCCTGCCCCCTTATGAAGAAGG - Intergenic
941790509 2:169547408-169547430 TCCCTCCACCTTTCTGATCGTGG - Intronic
942396300 2:175553182-175553204 TCTCTGGACCTTTCTTAAGGTGG + Intergenic
942543579 2:177039491-177039513 TCCCAGCACCTTGCTGAGGGTGG - Intergenic
943878654 2:193109009-193109031 TTCCTGCCACCTTGTGAAGGAGG + Intergenic
944882356 2:204026433-204026455 TGCCACCCCCTTCCTGAAGGGGG + Intergenic
946177576 2:217930854-217930876 TCCCTGACCTATTCTGAAGCAGG + Intronic
947119329 2:226799523-226799545 TCCCTGCCCCTCGCTCCAGGCGG + Exonic
947328230 2:229000644-229000666 TTCCTGCCACTTTTTGAAGAAGG + Intronic
947914007 2:233820156-233820178 ACCCTGCCCCACCCTGAAGGAGG + Intronic
948429769 2:237911982-237912004 TCCCTGCCCCCTTCCTAGGGTGG - Exonic
948563404 2:238868418-238868440 ACCCTGCCCCTGTCCGAAGTGGG - Intronic
1169191191 20:3660145-3660167 TCCCTGCACCTACCTGCAGGAGG + Exonic
1169208854 20:3754627-3754649 TCCCTGCCCCTTTCTTGGGGGGG - Intronic
1169290762 20:4349620-4349642 TCCCCTCACCTTTCTGAAAGTGG + Intergenic
1169550809 20:6699336-6699358 TGCCAGCCAGTTTCTGAAGGGGG - Intergenic
1171306590 20:24112355-24112377 TCCCTGCCGCTTTGTGACTGAGG - Intergenic
1171953350 20:31440767-31440789 GCCCTGCCCCTTCCTTAAGGAGG - Intronic
1172227746 20:33316594-33316616 GCCCTGCCACTTCCTGAGGGTGG - Intergenic
1172328768 20:34059130-34059152 TTCCTTCCCCTGTCTGAATGTGG + Intronic
1172457841 20:35092144-35092166 TTCCTTCCCCTTTCTAAAGTAGG - Intronic
1173304090 20:41831487-41831509 TCCCTGCCCCATTGTGAGGCAGG - Intergenic
1173487249 20:43450133-43450155 TCCTTGCTCCCCTCTGAAGGTGG + Intergenic
1174651243 20:52127521-52127543 TTCCTGCCTCTTTGTGAAGAAGG + Intronic
1174661818 20:52220317-52220339 TTCCTGCCACTTTATGAAGAAGG - Intergenic
1174959954 20:55144646-55144668 TTCCTGCCGCCTTGTGAAGGGGG + Intergenic
1175944891 20:62554085-62554107 TCCCTGCCCCCTTCTGACCTCGG - Intronic
1175997062 20:62816689-62816711 CCCCTGCCCCTCCCTGAAGGCGG + Intronic
1175998284 20:62821043-62821065 GCCCTGCCCCTCTGTGAAGTGGG + Intronic
1176337742 21:5614733-5614755 TCCCTGTCGCTTTCTGCAGGTGG + Intergenic
1176339150 21:5677806-5677828 TCCCTGTCGCTTTCTGCAGGTGG + Intergenic
1176471404 21:7109959-7109981 TCCCTGTCGCTTTCTGCAGGTGG + Intergenic
1176494965 21:7491737-7491759 TCCCTGTCGCTTTCTGCAGGTGG + Intergenic
1176505677 21:7646650-7646672 TCCCTGTCGCTTTCTGCAGGTGG - Intergenic
1178242070 21:30914502-30914524 TTCCTGCCACCTTCTGAAGAAGG - Intergenic
1179058117 21:37954711-37954733 TCCCTTCCAGTTTCAGAAGGTGG + Intronic
1179618677 21:42598367-42598389 ACTCTGCCCCTCTCTGAATGGGG + Intergenic
1179808652 21:43856108-43856130 TCCCTGCCACTGTCTGCAGCAGG + Intergenic
1179886126 21:44314937-44314959 TCCCTGTCCCCGTGTGAAGGTGG + Intronic
1179916502 21:44481336-44481358 TTCCTGCCGCCTTCTGAAGAAGG - Intergenic
1180850733 22:19018795-19018817 TCCCTGCCCCCCTCTTCAGGAGG + Intergenic
1181001853 22:19991551-19991573 CCCCTGCCCTTTTCTGGATGAGG - Intronic
1182411566 22:30191350-30191372 TCTCTGAAACTTTCTGAAGGAGG + Intergenic
1182791718 22:32958700-32958722 TCGGTGCCCCTTTCTAAAGTGGG - Intronic
1183341856 22:37285923-37285945 CCCCTGTCCCCTTCTGACGGGGG - Intronic
1184326412 22:43790857-43790879 TTCCAGCCACATTCTGAAGGAGG + Intronic
1184880555 22:47301847-47301869 TCCCTGGCCCCTTCTGCAGTGGG + Intergenic
949626748 3:5875731-5875753 AGCCTGACCCTTTCTGAAGCTGG + Intergenic
950726219 3:14918713-14918735 TCCCTGCCCCACCCTGAAGGAGG + Intronic
950862107 3:16157836-16157858 CTCCTGCCACTTTCTGAAGAGGG - Intergenic
953487747 3:43318099-43318121 TTCCTGCCTCTTTCTCAATGTGG + Intronic
953673382 3:44981254-44981276 TTCCTGCCTCTTTTTGAATGAGG + Intronic
955804142 3:62716542-62716564 ACTTTGCCCTTTTCTGAAGGTGG + Intronic
957346354 3:78966194-78966216 TCCCTGCCCCTCTCTGTCTGTGG + Intronic
958546320 3:95556037-95556059 GCCCTTCCCCTATCTGAAGGTGG - Intergenic
959869583 3:111311043-111311065 TCCATGGCCATATCTGAAGGGGG + Intronic
960574458 3:119216297-119216319 TCCCGGCCCCTGCCTGAAGTGGG - Exonic
961649500 3:128410371-128410393 TCACTGTCCCTTTCTAAATGAGG + Intergenic
961786144 3:129348016-129348038 ACCCTGCCCATTACTGATGGTGG + Intergenic
962826018 3:139101574-139101596 TCCCCTCCCCTCTCTGCAGGTGG - Intronic
962851945 3:139314501-139314523 TCCCTCCACCATTCTGATGGGGG + Intronic
964193141 3:154029661-154029683 TCCCTTTCCCTTTCTCAAGCTGG + Intergenic
965057259 3:163737647-163737669 TCCCTACCTCTTCCTGAAGTTGG + Intergenic
966134530 3:176683149-176683171 GCACTGCCCCTTTCTAAGGGAGG - Intergenic
966248699 3:177837729-177837751 TCCCTGTCCCTGCCTGATGGGGG + Intergenic
966643336 3:182215052-182215074 TCCCTGCCCCTTTCTGTCTGAGG - Intergenic
967882498 3:194311825-194311847 TCCCTGCCAGGTTCTGAATGAGG + Intergenic
968500837 4:949146-949168 TGGCTGCCCCTTTCAGAACGGGG + Intronic
969301623 4:6300489-6300511 TCCCTCCCCCCTTCTCCAGGTGG - Intronic
972192300 4:36609694-36609716 TTCCTTCCCCTCTGTGAAGGTGG - Intergenic
972398183 4:38674828-38674850 TGCCTGCCCCTTCCTGAGGGAGG - Intronic
974312435 4:60230265-60230287 TTCCTGCCACTTTGTGAAGAAGG - Intergenic
974728773 4:65834266-65834288 TCCCTGCCACCTTGTGAAGAAGG - Intergenic
974950237 4:68577790-68577812 TTCCTGCTACTTCCTGAAGGGGG - Intronic
975038455 4:69713134-69713156 TCCCTGCTCCCTTGTGAAGAAGG + Intergenic
976300180 4:83509230-83509252 TTCCTGCTACTTCCTGAAGGGGG + Intronic
976679952 4:87745653-87745675 GGCCTGCCCCAGTCTGAAGGCGG + Intergenic
977064063 4:92291185-92291207 TTCCTGCCACTTTGTGAAGAAGG + Intergenic
977345591 4:95812258-95812280 TCCCTGCCCCTTTCCCACAGTGG - Intergenic
980120238 4:128720538-128720560 CCCCTCCCCCTCCCTGAAGGAGG - Intergenic
981187088 4:141816284-141816306 TCACTGTCCCTTTGTGGAGGTGG - Intergenic
981278964 4:142935458-142935480 GCCCTGCCCCTTTTCAAAGGTGG - Intergenic
983523135 4:168731705-168731727 TCCTTGCCACTTCTTGAAGGTGG - Intronic
984340358 4:178449544-178449566 TCTATGTCCCTATCTGAAGGAGG + Intergenic
984998209 4:185457326-185457348 TGCCTGCCCTTTCCTGTAGGTGG - Intronic
986664367 5:10087473-10087495 TCACTGCCCCTACCGGAAGGAGG + Intergenic
987284018 5:16438274-16438296 TCCAGGCCCCTTGCTGAAGTGGG - Intergenic
988695280 5:33615701-33615723 TCCCTGCTCCTTGCTAAAAGAGG + Intronic
990032888 5:51283211-51283233 TTCCTGCCCCCTTGTGAAGAAGG + Intergenic
990943036 5:61222745-61222767 TTCCTGCCCCCTTGTGAAGAAGG + Intergenic
992645320 5:78806423-78806445 TCCCTGTAAGTTTCTGAAGGGGG - Intronic
995746417 5:115408581-115408603 TCCCTGCCCATTGCTGAATAAGG - Intergenic
998127567 5:139634785-139634807 TCCCTGTCCCTGTTAGAAGGAGG + Intergenic
999372714 5:151065608-151065630 TCCCTTCCCCTCTCTGAGGGAGG + Intronic
1000345409 5:160310209-160310231 TCCTGGCCCTTTTCTGGAGGAGG - Intronic
1001160345 5:169307067-169307089 TTCCTGCCACTTTCTGAAAAAGG + Intergenic
1004455678 6:15789376-15789398 CCTCTGCCTCTTTCTGAAAGGGG + Intergenic
1004867471 6:19868461-19868483 CCCCAGCTCCTTGCTGAAGGTGG - Intergenic
1005406469 6:25493731-25493753 TCACTGCCCCTTTTTGAAGAAGG - Intronic
1005923029 6:30417596-30417618 TCCCTGAGCCTTTCTCAAGGTGG + Intergenic
1006152902 6:31998792-31998814 TCCCTGCCCCTTGCTGAGCCAGG + Exonic
1006159210 6:32031529-32031551 TCCCTGCCCCTTGCTGAGCCAGG + Exonic
1006273314 6:32980958-32980980 GCCCTGCCCCATTTTGAATGGGG - Exonic
1006446132 6:34080730-34080752 TGACGGCCCCTTTCTGAAAGTGG - Intronic
1007093787 6:39200914-39200936 TGCCTGCCCATGTCTGAAGGTGG - Intronic
1008151836 6:47962604-47962626 TCCCTGCCACCTTGTGAAGAAGG + Intronic
1009710083 6:67307249-67307271 TTCCTGCCACTTTGTGAAGAAGG + Intergenic
1010574045 6:77510516-77510538 TCCCTGCCACATTCTGAACAGGG + Intergenic
1011990886 6:93515872-93515894 CTCCTGCCACTTTATGAAGGAGG + Intergenic
1013962297 6:115914964-115914986 TCCCTGGCCCCCACTGAAGGTGG - Intergenic
1016292182 6:142538085-142538107 TTCCTGCTACTTCCTGAAGGGGG - Intergenic
1016305940 6:142683585-142683607 TTCCTGCCCTGTTCTGAACGAGG - Intergenic
1016828042 6:148406049-148406071 ACCCTGCCCCATTCTGAAATCGG - Intronic
1017716468 6:157217126-157217148 TCCCTGCATCTTTCTGATTGAGG - Intergenic
1018391315 6:163343812-163343834 TCACTGCCCCTATCTGCAGGAGG - Intergenic
1019368029 7:645219-645241 TCTCTGCTCCTTTCTGTAGGAGG - Intronic
1019720705 7:2568866-2568888 CCCCTGACCCTTTCTGAACATGG + Intronic
1019744712 7:2693072-2693094 GCCCTGCCCCGCTCTGTAGGGGG + Intronic
1019794977 7:3042920-3042942 TCTCTGCCCCTATCTGCAGAGGG + Intronic
1021058194 7:16076973-16076995 TTCTTGCCGCCTTCTGAAGGAGG - Intergenic
1021972228 7:25976701-25976723 CCCCTGCCCCTTTTTTAATGAGG + Intergenic
1022080260 7:27012958-27012980 TTCCTTCCCCTTTCCAAAGGAGG - Intergenic
1022818957 7:33939698-33939720 TCCCTGCCACCTTGTGAAGAAGG + Intronic
1024034335 7:45494965-45494987 TGGCTGCCCCTTTGTGGAGGGGG + Intergenic
1024219122 7:47273970-47273992 CCCCTGCCACTTGCTGCAGGAGG - Intergenic
1024554313 7:50590327-50590349 TCTCTGCGCCTTTCTGGGGGCGG - Exonic
1026287508 7:68976176-68976198 CCCCTGCCCCTATCTGAGGTTGG - Intergenic
1027131191 7:75592476-75592498 TCTGTGCCCCTTTCTCATGGTGG + Exonic
1027414618 7:77962066-77962088 TCCCTGCCCCTAAATGAAGATGG + Intergenic
1029595096 7:101533471-101533493 GCCCAGCCCCATTCTGGAGGTGG - Intronic
1029803631 7:102975165-102975187 TTCCTGCTACTTTCTGAAGGGGG - Intronic
1030550457 7:110952632-110952654 TCCATGCCTCTATCTGAAGATGG - Intronic
1031720607 7:125171341-125171363 TCCTTGCCCATGTCTGAAGTGGG - Intergenic
1031890398 7:127287293-127287315 TCCCAGCCCCTTAAAGAAGGCGG + Intergenic
1032206428 7:129869894-129869916 TCCCTTCCCCTTTCTCTAGTGGG + Intronic
1032267654 7:130380328-130380350 TCCCTGCCACTTTATCATGGAGG + Intronic
1035246326 7:157564602-157564624 CCCTTGCCCATTTCTGAAGTGGG - Intronic
1036023267 8:4872476-4872498 TTCCTGCCGCCTTCTGAAGAAGG + Intronic
1036706290 8:11049441-11049463 TCCCTGCGCCTCTCTGCAGGGGG + Intronic
1037720525 8:21439714-21439736 TCCATGCCCCTTCCTGGTGGTGG - Intergenic
1038410943 8:27359491-27359513 CTGCTGCCCCTTTCTCAAGGTGG + Intronic
1038441055 8:27571187-27571209 TCCCTGCCCCTTTCCTCACGGGG - Intergenic
1039430194 8:37519787-37519809 TCCCTGCCTCTTTCTCAGGACGG - Intergenic
1039822432 8:41145867-41145889 GCCCTGACCCTTTCTGAGTGAGG - Intergenic
1041486386 8:58382250-58382272 TCCCTGCCCATTTCTTAATTGGG + Intergenic
1042157889 8:65864768-65864790 TTCCTGCTACTTCCTGAAGGGGG - Intergenic
1042194591 8:66221493-66221515 TCACTGCCCCTGTCAGCAGGAGG - Intergenic
1042630010 8:70805883-70805905 TCACTGCCCCTTGGTGGAGGGGG - Intergenic
1042674931 8:71309752-71309774 TCCCTGCCTCATTATGAAGTGGG - Intronic
1043512947 8:80967418-80967440 TCCCAGCCCTTTTGTGAAGATGG + Intergenic
1046883060 8:119331637-119331659 TTCCTGCTGCCTTCTGAAGGCGG - Intergenic
1046949899 8:120009753-120009775 TCCTTTTCCCTTTCTGAATGGGG + Intronic
1049034409 8:140063027-140063049 TTCCTGCCGCCTTCTGAAGAAGG - Intronic
1049188419 8:141271604-141271626 TCCCTGGCCCCTTCTGAAATGGG - Intronic
1049431729 8:142568489-142568511 TCCCTGCCCCTTGCTGAGCTGGG + Intergenic
1049602389 8:143513975-143513997 CACCAGCCCCTTTCTGAAGTCGG + Intronic
1050330876 9:4544885-4544907 TTCCTGCCACCTTGTGAAGGAGG - Intronic
1050646856 9:7729439-7729461 TCAGTGCCCCTCTCTGCAGGAGG - Intergenic
1051668733 9:19489364-19489386 TTCCTGCCACCTTGTGAAGGTGG + Intergenic
1052008745 9:23381759-23381781 TTCCTGCCACCTTCTGAAGAAGG + Intergenic
1052554329 9:29994484-29994506 TTCCTGCCACCTTGTGAAGGAGG - Intergenic
1055073804 9:72193875-72193897 TTCCTTCCCCTTTTTGAAGGTGG + Intronic
1057604167 9:96486891-96486913 TTCCTGCCCCTTCCTGCAGTGGG + Intronic
1059482775 9:114604677-114604699 CCCCTTCCACTTTCTGAATGGGG + Intergenic
1059652785 9:116331418-116331440 CCCATGACCCTTTCTGAAGATGG + Intronic
1059939509 9:119344207-119344229 TCCCTGCTGCCTTCTGAAGTAGG - Intronic
1060883190 9:127133135-127133157 TCCCTGCCCCTCTGTGAAGGTGG - Intronic
1061090299 9:128422134-128422156 CCCCTGTCCCTCTCTGAATGGGG - Intronic
1062299046 9:135853886-135853908 TCACTGCCCCCTTCTGATCGTGG - Intronic
1062584694 9:137243998-137244020 TCCCTACCCCTTTTGGAAGGGGG - Intronic
1203784717 EBV:121188-121210 GCCCTGCAGCTTTCTGCAGGAGG - Intergenic
1203785460 EBV:125127-125149 ACCCTTCCCCTATCTGACGGTGG - Intergenic
1203423924 Un_GL000195v1:20183-20205 TCCCTGTCGCTTTCTGCAGGTGG - Intergenic
1186465130 X:9779110-9779132 TCAGTGGCCCCTTCTGAAGGAGG + Intronic
1186795579 X:13044198-13044220 TCCCTGCCCCTGTCAGAAACAGG - Intronic
1189255070 X:39631616-39631638 CCACAGCCCCTTTCTGAAGATGG + Intergenic
1189376986 X:40474219-40474241 GCCCCACCCCTTGCTGAAGGAGG + Intergenic
1190113176 X:47608434-47608456 TCTCTGGCCCTTTCGCAAGGAGG + Intronic
1191110163 X:56798274-56798296 TCTCTGCCTCTATCTGAAAGGGG - Intergenic
1191767993 X:64721856-64721878 TCTCTTCCCCTTTCTAAAGGAGG - Intergenic
1192182785 X:68926844-68926866 CCCTTGCCCATCTCTGAAGGAGG + Intergenic
1193623740 X:83790381-83790403 TATCTGCCCATTTCTGAAAGTGG - Intergenic
1193911381 X:87310586-87310608 TCCCTGCCGCCTTGTGAAGAAGG - Intergenic
1195624420 X:106992850-106992872 TCCCTGCCCCTTTATTTAGCTGG + Intronic
1198128597 X:133672160-133672182 TACCTTCCCCTTTCTGCTGGGGG - Intronic
1198484313 X:137071407-137071429 TCCCTGCGCCATTCTTTAGGAGG - Intergenic
1198806375 X:140499432-140499454 TCTCTGCCCCCTTCTCAAGAGGG + Intergenic
1200701174 Y:6403763-6403785 TCCCTGCCTCTTGCTGGAGACGG - Intergenic
1201032938 Y:9760935-9760957 TCCCTGCCTCTTGCTGGAGACGG + Intergenic