ID: 902364112

View in Genome Browser
Species Human (GRCh38)
Location 1:15959596-15959618
Sequence GAGAGTAGACAGAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1325
Summary {0: 1, 1: 1, 2: 7, 3: 100, 4: 1216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902364112 Original CRISPR GAGAGTAGACAGAGGGAAGG AGG Intronic
900129030 1:1079908-1079930 GTGAGGAGACCGAGTGAAGGAGG - Intergenic
900142186 1:1143348-1143370 GAGAATAGAGAGAGGGTCGGGGG - Intergenic
900142202 1:1143395-1143417 GAGAATAGAGAGAGGGTCGGGGG - Intergenic
900153978 1:1196740-1196762 CACAGTAGACAGATGCAAGGAGG + Intronic
900271765 1:1793844-1793866 GAGAGTAGACTCAGAGAAGGAGG + Intronic
900308969 1:2024400-2024422 GGGAGGAGACAGAGAGTAGGAGG + Intronic
900486304 1:2924367-2924389 GAGAGAAGACAGAGAGGTGGAGG - Intergenic
900548494 1:3241827-3241849 CAGCGTGGACAGAGGGAGGGCGG + Intronic
900549220 1:3245690-3245712 GAAAGGAGAAAGAGGGAAAGTGG - Intronic
900745571 1:4358431-4358453 GAGAAAAGACAGAGAGAAAGGGG - Intergenic
900993464 1:6108288-6108310 GAGAGATGATAGAGGGAAGATGG + Intronic
901279751 1:8025516-8025538 GAGATTAGGCAGAGGGAGCGGGG + Intronic
901590405 1:10336600-10336622 GAGACTACACAGGGGGAGGGAGG - Intronic
901625617 1:10623189-10623211 GAGTGGAGACAGAGGGAGAGGGG - Intronic
901735194 1:11307985-11308007 GACAGGAGGCAGAGGGAAGAGGG - Intergenic
901934931 1:12620345-12620367 GAGGGCAGACGGTGGGAAGGAGG + Intergenic
902059588 1:13630932-13630954 AAGTGTATACAGAGGGCAGGTGG - Intergenic
902364112 1:15959596-15959618 GAGAGTAGACAGAGGGAAGGAGG + Intronic
902490625 1:16778250-16778272 GAGAGTGGACTGAGGGATGAGGG + Intronic
902550598 1:17216989-17217011 GGGTGTAGACAGAAGAAAGGAGG + Intronic
902810459 1:18885221-18885243 GAGCGAGGACAGAGGGATGGAGG + Intronic
902833136 1:19030307-19030329 GAAAGGAGAAGGAGGGAAGGAGG + Intergenic
902859419 1:19234320-19234342 GAGAGAAGAGAGAGGGTGGGGGG + Intronic
903139852 1:21332802-21332824 GCGAGGAGTTAGAGGGAAGGGGG + Intronic
903225810 1:21893667-21893689 CAGAGTAGAGACAGAGAAGGAGG + Intronic
903331552 1:22599592-22599614 GGGAGTGGAGAGAGGGAGGGAGG + Intronic
903498239 1:23786410-23786432 GAGAGTGGACTGAGGTAAGATGG + Exonic
904504496 1:30939589-30939611 GAGAGTAACCAAAGGGCAGGTGG - Intronic
904555918 1:31364192-31364214 GAGAGTATAAAGAGTGTAGGGGG + Exonic
904846557 1:33423038-33423060 GAGAGAGTACAGATGGAAGGCGG + Intronic
904893683 1:33798448-33798470 AAGAGGAGAGAGATGGAAGGGGG + Intronic
904894705 1:33805750-33805772 GAGAGGACACAGTGAGAAGGTGG + Intronic
905289010 1:36908543-36908565 GAGAGGAGCCAGTGGAAAGGGGG - Intronic
905365022 1:37446213-37446235 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
905407595 1:37746006-37746028 GTGAGAATACAGTGGGAAGGTGG - Intronic
905495750 1:38384515-38384537 CAGAGGAGAAAGATGGAAGGTGG - Intergenic
905618500 1:39419115-39419137 GGGAGTTGACAGAAGGAAGCAGG + Intronic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906263799 1:44412915-44412937 GAAAGTAGCCAGAGGCAAGTTGG + Intronic
906457389 1:46008818-46008840 GAGAGTACACAGACAGAAGTAGG + Intronic
906638194 1:47424494-47424516 GAGATTAGAAAGAGGGAAAGGGG - Intergenic
906978961 1:50607850-50607872 CTGAGTAGACAGAGGCAATGTGG + Intronic
907487199 1:54786422-54786444 GAGAGCATACACTGGGAAGGAGG - Intronic
907602732 1:55787160-55787182 GAGAAAAGAGAGAGGGAAAGAGG - Intergenic
907722167 1:56982272-56982294 GGGACTAGCCAGAGGGATGGTGG - Intergenic
907764143 1:57391816-57391838 GAGAGGAGAGAGAGAGAAGAGGG + Intronic
907909365 1:58813640-58813662 GAGTGTAGAAAGATGGAAGAAGG + Intergenic
908131901 1:61082699-61082721 GAGAGGAGAAAGAGGGAGAGAGG - Intronic
908414367 1:63898624-63898646 GAAAGGAGACAGAGGAAAGAAGG + Intronic
908494323 1:64679497-64679519 GAGGGAATACAGTGGGAAGGGGG - Intronic
908495275 1:64688634-64688656 GAGGCTGGACAGAAGGAAGGTGG - Intronic
908913919 1:69104211-69104233 TAGAGTATAGAGAGTGAAGGGGG - Intergenic
909292832 1:73905860-73905882 GAGAGAAGAGGGAGGGAAAGGGG - Intergenic
909418428 1:75434123-75434145 GTGAGAACACAGAGGAAAGGAGG - Intronic
909471506 1:76033993-76034015 GTGAGGACACAGTGGGAAGGAGG + Intergenic
909540785 1:76789229-76789251 GAGAAGAGAAAGAGGGAAGATGG + Intergenic
910115570 1:83728116-83728138 GAGAGTAGAGAAAGGGAATGAGG - Intergenic
910482155 1:87670458-87670480 GAGAGAAGAACGAGGGAAGGAGG + Intergenic
910487627 1:87732873-87732895 GAGAGAAGAGTGAGTGAAGGAGG - Intergenic
911514760 1:98854157-98854179 GTAAGAAGAGAGAGGGAAGGAGG + Intergenic
912145266 1:106785967-106785989 GTGAGAAGACAGTGGGAAGATGG - Intergenic
912230621 1:107788344-107788366 GAGAGTGGGCAGAGTGAGGGTGG - Intronic
912443728 1:109717517-109717539 GAGAGTAGAAAGAAGGAAAAAGG - Exonic
912500640 1:110119901-110119923 GAGAGTTCACACAGAGAAGGCGG - Intergenic
912556076 1:110517112-110517134 GAGAGAAGGGAGAGGGAAAGAGG + Intergenic
913168761 1:116213020-116213042 GAGAGGACACAGAGAGAAGGTGG + Intergenic
913210798 1:116580783-116580805 GAGAGAAGACAGAGAGAAAGTGG + Intronic
913226859 1:116708167-116708189 GTAAGGAGAGAGAGGGAAGGGGG + Intergenic
913458202 1:119055702-119055724 GAAAGAAGAGAGAGAGAAGGAGG + Intronic
914241745 1:145857427-145857449 GATAGGAGACAGGGAGAAGGAGG + Intronic
914320636 1:146556266-146556288 GAGAATAGTAAGAGGGAAGCTGG - Intergenic
914862282 1:151396818-151396840 GAGAAGAGAGAGAGGGAGGGAGG - Intergenic
914960114 1:152197528-152197550 GAAAGGAGAGAGAAGGAAGGAGG - Intergenic
914984889 1:152448003-152448025 CAGAGGAGACAGAGAGAAGGTGG + Intergenic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
915312310 1:155010826-155010848 GAAAGGAGACAGAAGTAAGGGGG + Intronic
915530506 1:156500061-156500083 GAGAGGAGGGAGAGGGAGGGAGG + Intronic
915591857 1:156875369-156875391 GACAGCAGGCAGGGGGAAGGGGG - Intronic
915700004 1:157783072-157783094 GAGAGAAGAAAGAAGAAAGGAGG - Intergenic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915854509 1:159367386-159367408 GAGAGGAGACAGAGTTAATGAGG + Intergenic
916123994 1:161553059-161553081 GAGGGGAGAGAGATGGAAGGTGG + Intergenic
916133878 1:161634421-161634443 GAGGGGAGAGAGATGGAAGGTGG + Intronic
916403608 1:164475118-164475140 GACAGTGGGCAGAGGGATGGCGG + Intergenic
916503465 1:165406972-165406994 GAGAGTGGCCAGAGAGAATGGGG - Intronic
916786113 1:168088254-168088276 CAGAGCAGGCAGAGGGAATGGGG + Intronic
916875734 1:168966583-168966605 GAGGGGAGAGAGAGGGACGGGGG + Intergenic
917484959 1:175447383-175447405 GAGGGTGGGCAGCGGGAAGGAGG + Intronic
917530592 1:175831490-175831512 GAGAGTGGGCTGAGGGAAGATGG + Intergenic
917727248 1:177839579-177839601 GAGAGGAGAAGGTGGGAAGGGGG - Intergenic
918407367 1:184224166-184224188 GGGTGGAGAGAGAGGGAAGGAGG - Intergenic
918735755 1:188061020-188061042 GAGGGAAGAGAGAGGGAAGACGG - Intergenic
919058836 1:192605784-192605806 GAGAGAGGAGAGAGGGAGGGAGG + Intergenic
919368194 1:196692861-196692883 GGGAGGTGACAGAGGGAGGGAGG - Intronic
919497269 1:198288612-198288634 GAGAGAAGGCATAGGGAAGTTGG - Intronic
919840414 1:201605216-201605238 GAGAGGATGGAGAGGGAAGGTGG - Intergenic
919972439 1:202589960-202589982 GAGAGGAGACAGGTGGAAGTGGG + Exonic
920387688 1:205580217-205580239 GAAAGGAGAGAGAGGGAAGGAGG - Intronic
920440761 1:205979092-205979114 GAGGGGAGACACAGGGAAGAAGG - Intronic
920683705 1:208092933-208092955 AAGAGAACAAAGAGGGAAGGTGG + Intronic
920687964 1:208124217-208124239 GAGGGTGGAGGGAGGGAAGGGGG + Intronic
920837245 1:209522543-209522565 TAGAGGAGATAAAGGGAAGGGGG + Intergenic
921232192 1:213084149-213084171 GAGAGGAGACAGAGGAAGAGAGG - Intronic
921399165 1:214701751-214701773 GAGAGCGGACAGAAGGAAAGTGG - Intergenic
921734522 1:218612118-218612140 GAAGGGAGAAAGAGGGAAGGAGG - Intergenic
922068553 1:222168483-222168505 AAGAGAAGGAAGAGGGAAGGAGG + Intergenic
922093677 1:222422551-222422573 GAGAGCAGACAGAGCTCAGGTGG - Intergenic
922095603 1:222440503-222440525 AAGAGGAGGGAGAGGGAAGGAGG + Intergenic
922504012 1:226115932-226115954 GACAGTGGAAAGAGGGGAGGGGG + Intergenic
922505994 1:226126008-226126030 GAGAGTAACAGGAGGGAAGGAGG - Intergenic
923127579 1:231045981-231046003 GAGAGAAGAGGGAGGGAGGGAGG + Intergenic
923241190 1:232087246-232087268 GAGGGTATTCAGAGGAAAGGAGG + Intergenic
923388553 1:233490555-233490577 GAGAGGAGGCAGAGCGAAGGAGG - Intergenic
923529818 1:234804285-234804307 GAGAGTGGACTGAGGGATGAGGG - Intergenic
923754544 1:236779086-236779108 GAGAGAAGAGTGAGCGAAGGAGG + Intergenic
924444815 1:244119367-244119389 GAGAGGAGATGGAGGAAAGGAGG + Intergenic
924539877 1:244970688-244970710 GAGAGAAGAGGGAGGGAAGAGGG - Exonic
924815796 1:247440861-247440883 GATAGTAGAAAGTGGGAAAGTGG - Intronic
924893367 1:248308639-248308661 GACAGGAGGCAGAGGGCAGGCGG - Intergenic
1063180771 10:3597703-3597725 GAGAGAAGACAGAAGGAAAAGGG + Intergenic
1063454484 10:6173626-6173648 GGGAATAGACAGAGGCAAAGGGG + Intronic
1063711415 10:8482717-8482739 GAGAGAGGAGGGAGGGAAGGAGG - Intergenic
1063716057 10:8528304-8528326 GTGAGTACGCAGAGAGAAGGTGG + Intergenic
1063876391 10:10483871-10483893 GAGACGAGAGAGAGAGAAGGAGG - Intergenic
1064146045 10:12827162-12827184 GAGAGAAGAGAGAGGGAAGGAGG - Intronic
1064157873 10:12918702-12918724 GTGATTAAACAGATGGAAGGGGG + Intronic
1064209632 10:13351340-13351362 CAGAGGAGACACAGGGAAGATGG + Intergenic
1064241504 10:13633727-13633749 GGGAGTATACTGGGGGAAGGAGG - Intronic
1064293825 10:14059511-14059533 GTGAGCAGACAGCGAGAAGGTGG + Intronic
1064719825 10:18217782-18217804 TGGAGCAGAAAGAGGGAAGGAGG + Intronic
1064792179 10:18970265-18970287 GGTAGTAGATATAGGGAAGGAGG + Intergenic
1065391791 10:25189890-25189912 AAGAACAGAAAGAGGGAAGGGGG + Intronic
1065694843 10:28370258-28370280 GAGAAAGGAAAGAGGGAAGGAGG + Intergenic
1065708733 10:28495208-28495230 CTGGGAAGACAGAGGGAAGGAGG + Intergenic
1065713927 10:28545555-28545577 GAGAGTACACAGAAGGGAAGAGG + Intronic
1065853871 10:29814149-29814171 CCAAGTACACAGAGGGAAGGAGG - Intergenic
1066018215 10:31269676-31269698 GGGACTATAAAGAGGGAAGGAGG - Intergenic
1066525772 10:36277576-36277598 GAGAGTAGAGAAAGAAAAGGAGG + Intergenic
1066576310 10:36829147-36829169 GAGATTACACAGAGACAAGGGGG + Intergenic
1067168719 10:43886166-43886188 GAGTGTGGGCAGAGGGCAGGTGG + Intergenic
1067216032 10:44304129-44304151 GAGAGGAGAGAGAGAGAGGGAGG - Intergenic
1067397551 10:45936310-45936332 GCGAGAGGAGAGAGGGAAGGAGG - Intergenic
1067710352 10:48645833-48645855 GAGGGTCGGGAGAGGGAAGGAGG + Intronic
1067854882 10:49783593-49783615 GAGGGAAGAGCGAGGGAAGGGGG + Intergenic
1067865868 10:49905404-49905426 GCGAGAGGAGAGAGGGAAGGAGG - Intronic
1068840593 10:61609474-61609496 TGGAGTAGCCAGAGGGAAGCGGG + Intergenic
1068937616 10:62651249-62651271 GAGTGAAGACAAAGAGAAGGAGG - Intronic
1069069587 10:63979505-63979527 GAGAGTAGCCAGGAGGGAGGAGG - Intergenic
1069441493 10:68432864-68432886 GATAGAAGACAGGGAGAAGGTGG - Intronic
1069560736 10:69427582-69427604 TAGAGTGGAGAGAGGGAAGGAGG - Intergenic
1069735103 10:70648895-70648917 GAGGGAAGTCAGAGGGCAGGTGG - Intergenic
1069821880 10:71233518-71233540 GTGGGGAGGCAGAGGGAAGGGGG - Intronic
1069982243 10:72260781-72260803 GAGAGGAGAGAGGGGGAGGGAGG - Intergenic
1070159652 10:73858531-73858553 GAGGGTGGGCAGAGGGAAGGGGG - Intronic
1070363515 10:75713844-75713866 GAGAGGAGAGAGAGAGAGGGTGG - Intronic
1070413367 10:76165685-76165707 GAGAGAAGAATGAGTGAAGGAGG + Intronic
1070760945 10:79024098-79024120 AAGGGTAGACAGAGGGGGGGGGG + Intergenic
1071179579 10:82967417-82967439 AATAATAGACAGTGGGAAGGAGG - Intronic
1071229785 10:83572110-83572132 GAGAGGAAAGAGAGGGAAGAAGG + Intergenic
1071275353 10:84049114-84049136 GAGGGTAGAAGGAGAGAAGGAGG + Intergenic
1071468489 10:85961867-85961889 GAAAAGAGAGAGAGGGAAGGAGG + Intronic
1071734581 10:88283808-88283830 GAGAGTAGAGGGTGGGAGGGAGG + Intronic
1071849379 10:89552984-89553006 CAAAGTGGACAGAGGGACGGAGG - Intronic
1072162789 10:92784020-92784042 CAGAGTAGAAAGAGAGAAGGAGG - Intergenic
1072892883 10:99340733-99340755 GAAAGAAGAGAGAGGGAGGGAGG - Intronic
1073004466 10:100312106-100312128 GAGAGTAGGCAGAGGAAAGTAGG + Intronic
1073137790 10:101229367-101229389 GAGAGAAGAGAGAGGGAGGGAGG - Exonic
1073317440 10:102592906-102592928 GAGAGGGGAGAAAGGGAAGGGGG + Intronic
1073444759 10:103574087-103574109 GAGAGTAGTCAGGGGCAGGGTGG + Intronic
1073944012 10:108730091-108730113 GGAAGGAGATAGAGGGAAGGAGG + Intergenic
1074315569 10:112358354-112358376 GAAAGTATACATATGGAAGGTGG - Intergenic
1074900105 10:117808932-117808954 GAGATTAGCAAGTGGGAAGGAGG + Intergenic
1075017109 10:118917951-118917973 GAGAGGGGACAGAGGGAACAGGG + Intergenic
1075090677 10:119442528-119442550 CAGAGCAGACTGAGGAAAGGTGG - Intronic
1075153623 10:119956338-119956360 GACTGGAGACAGAGGGAAGAAGG + Intergenic
1075164099 10:120051523-120051545 GAGGAAAGGCAGAGGGAAGGAGG + Intergenic
1075301984 10:121333067-121333089 GAGTCTAGACAGGGGGAACGGGG + Intergenic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1076024578 10:127101022-127101044 GAGAGAGGACAAAGGGCAGGAGG + Intronic
1076069146 10:127472208-127472230 GAGGATAGAGGGAGGGAAGGTGG + Intergenic
1076404142 10:130201215-130201237 GTGAGTACCCGGAGGGAAGGAGG + Intergenic
1076494930 10:130890827-130890849 GAGAGGGGAGAGAGGGAAAGAGG + Intergenic
1076551573 10:131281658-131281680 GAGAGTAGCCAGGGGGACTGTGG - Intronic
1076570957 10:131432538-131432560 GAGAGTGCACAGAGGGGAGAGGG + Intergenic
1076721386 10:132394945-132394967 GGGAAGAGGCAGAGGGAAGGCGG + Intergenic
1076749786 10:132537064-132537086 CAGAGAAGACGGAGGGGAGGCGG - Intergenic
1076783874 10:132739413-132739435 GACAGAAGGCAGCGGGAAGGTGG + Intronic
1077344059 11:2038315-2038337 GAGGGTAGAGAGTGGGAGGGAGG + Intergenic
1077372772 11:2191259-2191281 GGAAGGAGAGAGAGGGAAGGAGG + Intergenic
1077479659 11:2807681-2807703 GGGAGGAGGCTGAGGGAAGGGGG - Intronic
1077841165 11:5976196-5976218 AAGAATAAAAAGAGGGAAGGAGG + Intergenic
1077890295 11:6413436-6413458 CTGAGAACACAGAGGGAAGGGGG - Intronic
1078098326 11:8313742-8313764 GAGGGCACCCAGAGGGAAGGTGG + Intergenic
1078626355 11:12962379-12962401 AAGAGAAGACAGAAGGCAGGAGG + Intergenic
1078950032 11:16120163-16120185 GAGAGAAGAGAGAGAGCAGGAGG - Intronic
1078950037 11:16120202-16120224 GAGAGAAGAGAGAGAGCAGGAGG - Intronic
1079056703 11:17212345-17212367 GAGAAAAGATAGAGGGAAGATGG + Intronic
1079123833 11:17704463-17704485 GTGAGTACACAGTGAGAAGGTGG + Intergenic
1079523276 11:21354346-21354368 GAGAGTAGAAAGAAGGAGGGAGG - Intronic
1079826455 11:25201186-25201208 AAGAGGAGAAGGAGGGAAGGAGG + Intergenic
1080000771 11:27346457-27346479 GAGGGAAGACAGAGGAAAGAAGG + Intronic
1080018675 11:27535234-27535256 GAGGGTAGAGAGTGGGAAGCGGG - Intergenic
1080050224 11:27851919-27851941 GAGGGAAGAAAGAGGGAGGGAGG - Intergenic
1080224005 11:29939516-29939538 GAGAGGGGACAGAGAGAAAGAGG - Intergenic
1080270922 11:30449918-30449940 ATGACTAGACAGAGGAAAGGGGG - Intronic
1080581776 11:33650323-33650345 GAGAAGGGAGAGAGGGAAGGTGG + Intronic
1081082961 11:38766451-38766473 GAGAAAAGAGAGAGGAAAGGAGG + Intergenic
1081084880 11:38787290-38787312 GGAAGGAGAGAGAGGGAAGGAGG - Intergenic
1081489488 11:43556550-43556572 GAGGGTAGAGGGAGGGAGGGAGG - Intronic
1081851914 11:46279727-46279749 GACACTAGTCAGAGGGAAAGAGG + Intronic
1081975206 11:47229429-47229451 GGGAGTGGAGAGAGGGAAGAGGG + Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083068927 11:59956158-59956180 GAGAGGAGAGGAAGGGAAGGAGG - Intergenic
1083421534 11:62556094-62556116 TAGGGTAGAATGAGGGAAGGGGG - Intronic
1083445794 11:62707364-62707386 CAGAGTAGAGGGAGGAAAGGAGG + Exonic
1083758480 11:64803433-64803455 GCCAGAAGACAGAGGGAAGAGGG + Intergenic
1083812923 11:65115689-65115711 GAGAGTAGTCAGAGAGCTGGGGG + Intronic
1084495248 11:69499666-69499688 CTGAGTAGACAGAGTGAAAGGGG - Intergenic
1084604709 11:70165700-70165722 AGGAGGACACAGAGGGAAGGTGG + Intronic
1084721680 11:70910018-70910040 GTGAGGACACAGAGAGAAGGCGG - Intronic
1084907966 11:72363204-72363226 GGGAGGGGACGGAGGGAAGGAGG + Intronic
1084933317 11:72574040-72574062 GAGAGAGGACAGATGGGAGGAGG - Intergenic
1085122281 11:73974845-73974867 GAATGTAGAAAGAGGGAAGGTGG + Exonic
1085300430 11:75455357-75455379 GTGAGTAGAGTGAGGGCAGGAGG + Intronic
1085337377 11:75706480-75706502 GAGAGGAGGCAGCGGGGAGGAGG - Intergenic
1085775143 11:79358715-79358737 GAGGGAAGGAAGAGGGAAGGAGG - Intronic
1086085342 11:82947448-82947470 GAGAGGGGAAAGGGGGAAGGAGG + Intronic
1086168252 11:83805581-83805603 GAGAGTAGACAAAAGGGAGAGGG - Intronic
1086286632 11:85259254-85259276 GAGAGAGGAGAGAGCGAAGGGGG - Intronic
1086306425 11:85485564-85485586 GTGAGTAAGGAGAGGGAAGGGGG + Intronic
1087171974 11:95058410-95058432 GAGAGTTGAGGGAGGGAGGGAGG - Intergenic
1087831140 11:102820880-102820902 CAGAGAAGGCAGAGGGATGGGGG - Intergenic
1087897023 11:103597520-103597542 CAGAGTAGACAGAAGGAAACAGG - Intergenic
1088279827 11:108124576-108124598 AAGATTAGAAAAAGGGAAGGGGG - Intronic
1088539657 11:110900693-110900715 CAAAGTAGACAGAGGAAAGAAGG - Intergenic
1088561288 11:111118793-111118815 GTGAGGACACAGTGGGAAGGCGG - Intergenic
1088846310 11:113671269-113671291 GAGACCAGACAGAAGGAAGGTGG - Intergenic
1088847159 11:113678228-113678250 GGGAGGAGAAAGAGGGAAGAGGG + Intergenic
1089415252 11:118283771-118283793 GAGAATAGAGAGAGAGATGGGGG - Intergenic
1089746908 11:120623963-120623985 GGGAGGAGGAAGAGGGAAGGGGG - Intronic
1090202269 11:124865387-124865409 GAGAGAAGGACGAGGGAAGGAGG + Exonic
1090234933 11:125140177-125140199 GAGAGTAGAAAGAGGCAGGTCGG - Intergenic
1090362790 11:126185274-126185296 GAGAGACGACAGAGGGACAGAGG + Intergenic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1090521317 11:127482624-127482646 AAGAGTACACAGATGGAAAGAGG - Intergenic
1090961880 11:131564396-131564418 GTGAGCACACAGTGGGAAGGTGG - Intronic
1091050003 11:132358834-132358856 AAGAGAAGAGAGAGGGACGGGGG - Intergenic
1202827045 11_KI270721v1_random:93504-93526 GAGGGTAGAGAGTGGGAGGGAGG + Intergenic
1091619818 12:2078194-2078216 GTGAGGACACAGAGAGAAGGTGG + Intronic
1092035967 12:5334754-5334776 TTGAGAAGACAGAGGGAGGGGGG + Intergenic
1092318731 12:7447914-7447936 GTGAGGACACAGAGAGAAGGTGG + Intronic
1092377346 12:7966921-7966943 GAGAGGTGGCAGAGGGCAGGGGG + Intergenic
1092925842 12:13271368-13271390 GAGAAGAGACAGAGAGAAAGGGG - Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1092957035 12:13560623-13560645 GAGAGAGGACAGAGGGCATGAGG - Exonic
1093803306 12:23400376-23400398 TTGAGAAGATAGAGGGAAGGTGG - Intergenic
1094466850 12:30762501-30762523 CAGAGGAGACACAGGGAAGAAGG + Intergenic
1095131929 12:38553127-38553149 GAGAGGAGATGAAGGGAAGGGGG - Intergenic
1095776496 12:46016155-46016177 ATGAGTAGACAGAGAGAATGTGG - Intergenic
1096042985 12:48536237-48536259 GAGAGCAGAGGGAGGGAGGGAGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096747632 12:53738893-53738915 GAGAGCAGGCAGAGGGCAGGAGG + Intergenic
1096836385 12:54353805-54353827 GAGAGGTGACAGAGTGGAGGAGG + Intergenic
1096870815 12:54590940-54590962 GAGAGGAGGGAGAGGGAAGAGGG + Intergenic
1097176757 12:57147727-57147749 TAGAATAGAAAGAAGGAAGGAGG + Intronic
1097224746 12:57470777-57470799 GTGAGTAGACAGAGGTTGGGAGG - Exonic
1097492061 12:60282797-60282819 GAGAGTAGGGAGAGGCCAGGTGG + Intergenic
1098086318 12:66848206-66848228 GAGAGAAAAGAAAGGGAAGGAGG - Intergenic
1099134887 12:78885245-78885267 GTGAGAAGAAAGGGGGAAGGAGG + Intronic
1099224177 12:79949407-79949429 GAAGGAGGACAGAGGGAAGGAGG - Intergenic
1099769705 12:87035276-87035298 GAGAGGAAATAGAGGGATGGAGG + Intergenic
1099902964 12:88735290-88735312 GAGAGAAGAGGGAGAGAAGGAGG - Intergenic
1100499837 12:95163168-95163190 GAGAGTACACAGTGTGGAGGAGG - Intronic
1100631961 12:96399330-96399352 GAGCGGAGGTAGAGGGAAGGTGG - Intronic
1100923703 12:99519733-99519755 GAGAAAAGACAGAAGGAAAGAGG - Intronic
1101035865 12:100705828-100705850 CAGAAAAGAAAGAGGGAAGGAGG - Intergenic
1101199033 12:102415611-102415633 GAGAGAAGAAGGAAGGAAGGAGG - Intronic
1101612995 12:106309205-106309227 GAGAGAAGACAGAAGAAAAGGGG - Intronic
1101861883 12:108489149-108489171 GAGAAGGGAAAGAGGGAAGGAGG + Intergenic
1102097236 12:110250391-110250413 GAGACAGGAGAGAGGGAAGGTGG - Intergenic
1102503149 12:113366779-113366801 GAGAGGAGGAGGAGGGAAGGAGG - Intronic
1102558029 12:113741813-113741835 GAGAGGAGAGGGGGGGAAGGAGG + Intergenic
1102641424 12:114370576-114370598 GTGAGGACACTGAGGGAAGGCGG - Intronic
1103073573 12:117964538-117964560 CAGATTGGACAGAGAGAAGGAGG - Intronic
1103079760 12:118014513-118014535 GAGAGAAGAAAGAGTGAAGTAGG + Intronic
1104215382 12:126728393-126728415 GTGAGGAGACAGAGTGACGGGGG + Intergenic
1104340667 12:127945714-127945736 GATATGAGACACAGGGAAGGAGG + Intergenic
1104384862 12:128341927-128341949 GAGAGAAGACAGCAGGAAGCAGG - Intronic
1104415342 12:128593136-128593158 GAGAGAGGAGAGAGGGAAGAAGG - Intronic
1104415361 12:128593312-128593334 GAGAGAGGAGAGAGGGAAGAGGG - Intronic
1104656056 12:130574818-130574840 GTGAGTGGACAGAGGGAACCAGG - Intronic
1105383119 13:19905690-19905712 GTCAGAAGGCAGAGGGAAGGAGG - Intergenic
1106551172 13:30772356-30772378 GAGAGGAGTCAGGGGAAAGGAGG + Intergenic
1107053411 13:36077011-36077033 GAGAGGAGAAAGAGAGGAGGAGG + Intronic
1107376149 13:39806909-39806931 CAGATTAGAGAGAGAGAAGGTGG - Intergenic
1107514229 13:41113604-41113626 GTGAGGACACAGAGAGAAGGTGG - Intergenic
1107653206 13:42565820-42565842 GAGAGGAGACTGCTGGAAGGAGG + Intronic
1107763663 13:43710145-43710167 GAGAGGAAAAAGAGGGCAGGAGG + Intronic
1108130350 13:47292796-47292818 GAAAGGAGACAGAAGGAAGGAGG + Intergenic
1108331961 13:49395823-49395845 GAGAGTTGGCAGGGGGCAGGGGG + Intronic
1108432763 13:50371031-50371053 CAGAGCACACAGAGGGGAGGAGG + Intronic
1108501359 13:51072488-51072510 GAGTGTAGAGAGGCGGAAGGTGG - Intergenic
1108551573 13:51551025-51551047 AAGAGAAGATAGAGTGAAGGTGG - Intergenic
1109166646 13:59043337-59043359 GAAAGGAGAGAGATGGAAGGAGG - Intergenic
1110281393 13:73698171-73698193 GAGAAAAGAGAGAGGAAAGGGGG + Intronic
1110582494 13:77147552-77147574 AAGGGTAGAGAGAAGGAAGGGGG - Intronic
1110624078 13:77631976-77631998 GTGAGTACACAGTGAGAAGGTGG - Intronic
1110735265 13:78928766-78928788 GACAGGGGACAGAGGGCAGGGGG - Intergenic
1110767369 13:79296296-79296318 GAGAGTAGGCAGAGTGTATGTGG + Intergenic
1110893168 13:80715276-80715298 GAGAGTAGACAAAAGCAAGCAGG + Intergenic
1111141892 13:84129611-84129633 GAGAGTAAGTAGAGGGAAGTAGG + Intergenic
1113251548 13:108458555-108458577 GGGAGGGGAGAGAGGGAAGGGGG - Intergenic
1113325353 13:109276326-109276348 GAGAGTTGTAAGAGGGAGGGAGG + Intergenic
1113437967 13:110307622-110307644 GGGAGTAGAAAGGGGGAGGGTGG + Intronic
1113613138 13:111662015-111662037 GAGAGTTGAGAGAGGGGAGCTGG + Intronic
1113743254 13:112725351-112725373 GAGAGCAGAGAGAGTGGAGGGGG - Intronic
1114270329 14:21097226-21097248 GAGTGAGGACAGAGGGAAGGAGG - Intronic
1114485025 14:23057222-23057244 GAGAGAAGAAAGAGGGAGAGAGG + Intronic
1114525323 14:23364490-23364512 AAGAGAAGACAGAGGGAGGAGGG - Intronic
1114663985 14:24368021-24368043 AAGAGAGGACAGAGGGAGGGAGG + Intronic
1114782284 14:25551182-25551204 CAGAGAAGAGAGAGGGAATGGGG + Intergenic
1114843115 14:26289449-26289471 AAGAGTAGACAGAGAGTAGGAGG - Intergenic
1114895263 14:26981894-26981916 GAGAGGAGAGAGACTGAAGGAGG + Intergenic
1115295818 14:31825629-31825651 GAAAGGAGAAAGAGGGGAGGAGG - Intronic
1115333038 14:32218888-32218910 GAGTGAAGAAAGAGGGAAAGAGG - Intergenic
1116140178 14:40983389-40983411 GGGAGTTGAGAGTGGGAAGGAGG - Intergenic
1116209567 14:41917439-41917461 CAGAGAAGACAGAGAAAAGGGGG - Intergenic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1116452319 14:45080437-45080459 GAGAGGAGCCAGCGGGAAGCGGG + Intergenic
1116940348 14:50784945-50784967 GAGAGTAGGCAGAGGGGAGAAGG + Intronic
1117186780 14:53247648-53247670 GAGACTAGAAAGAAGGAAGAGGG + Intergenic
1117214965 14:53541553-53541575 GAGAAGAGAAAGAGGGAAGAGGG + Intergenic
1117542289 14:56760002-56760024 CAGTGTCGACAGAGTGAAGGTGG + Intergenic
1117838888 14:59836678-59836700 GGGAGTAGTGAGAGAGAAGGCGG + Intronic
1118055502 14:62075431-62075453 GAGAGTGGAAAGAGGGGAAGGGG - Intronic
1118482343 14:66179835-66179857 GTGAGTACAAAGAGGGAAGATGG - Intergenic
1118632929 14:67722781-67722803 GAAAGAAGAGAAAGGGAAGGAGG + Intronic
1118658338 14:67978576-67978598 GAGAAGAGACAGTGTGAAGGAGG + Intronic
1118990948 14:70796564-70796586 GAGAGGAGACAGGGAGATGGAGG - Intronic
1119063759 14:71504435-71504457 GAGAATAGAGAGAGGAAAGCTGG - Intronic
1119217035 14:72876926-72876948 GGGAGTGGGGAGAGGGAAGGAGG - Intronic
1119517592 14:75260401-75260423 CAGAGGAGATAGAGGAAAGGAGG - Intronic
1119607762 14:76035429-76035451 GAGAGAAGGAGGAGGGAAGGGGG - Intronic
1119909643 14:78337961-78337983 CAGAGTACCCAGTGGGAAGGTGG + Intronic
1120317875 14:82919447-82919469 GTCAGGAGACAGAGAGAAGGAGG + Intergenic
1120391256 14:83911156-83911178 GAGAGAAGAGTGAGGGAAGGAGG - Intergenic
1120810935 14:88802827-88802849 GAGAGAAGACAGAGCTCAGGCGG - Intergenic
1120841258 14:89087125-89087147 GTGAGGACACAGAGAGAAGGCGG - Intergenic
1120899085 14:89560126-89560148 GAGAGAGGAGAGAGAGAAGGGGG + Intronic
1121097497 14:91228064-91228086 GGGAGCAGACAGAGAGGAGGTGG - Intergenic
1121238267 14:92409258-92409280 GAGAATGGACCTAGGGAAGGAGG + Intronic
1121624604 14:95374946-95374968 GAGAGAGGAAAGAAGGAAGGGGG - Intergenic
1121624635 14:95375049-95375071 GAGAGAGGAAAGAAGGAAGGGGG - Intergenic
1121629685 14:95413179-95413201 GAGAGAAGAGAGAGAAAAGGAGG - Intronic
1121637708 14:95465100-95465122 GAGAATGGACAGAGGGACTGGGG + Intronic
1121828396 14:97029177-97029199 AAGAGAAGAAAGAGGGAAGAAGG - Intergenic
1121990613 14:98553342-98553364 GAAAGGAGAAAAAGGGAAGGTGG - Intergenic
1122156545 14:99753535-99753557 GGGAGTAGAGGGAGTGAAGGAGG - Intronic
1122736997 14:103848510-103848532 GAGAGCAGACAGGGGGACTGAGG + Intergenic
1122757978 14:103997638-103997660 GGGAGTGCACAGAGGGAGGGTGG + Intronic
1122823146 14:104357053-104357075 GAGATTGGACACAGAGAAGGAGG + Intergenic
1122868709 14:104623562-104623584 TGGAGAAGAGAGAGGGAAGGAGG + Intergenic
1123006405 14:105325886-105325908 GAGAGTAAACAAAGGCATGGAGG - Intronic
1123206000 14:106714015-106714037 GATATTAGTCAGAGGGAAAGTGG - Intergenic
1123211084 14:106761422-106761444 GATATTAGTCAGAGGGAAAGTGG - Intergenic
1123510051 15:20989477-20989499 GACAGCAGACAAAGGGAGGGGGG + Intergenic
1123567267 15:21563229-21563251 GACAGCAGACAAAGGGAGGGGGG + Intergenic
1123603530 15:22000522-22000544 GACAGCAGACAAAGGGAGGGGGG + Intergenic
1123667633 15:22620750-22620772 GAGATAAGATAGAGGGATGGAGG + Intergenic
1123706404 15:22954200-22954222 GAGAGGACACAGAGAGAAGGTGG + Intronic
1123813709 15:23955173-23955195 GAGAGAAGGCAGAGGGCAGAGGG + Intergenic
1124001541 15:25764536-25764558 GTGAGGACACAGAGTGAAGGTGG + Intronic
1124139113 15:27061983-27062005 GTCAGTGGACAGAAGGAAGGAGG - Intronic
1124195520 15:27623273-27623295 GCGATCAGACAGAGGGAAGGCGG + Intergenic
1124321477 15:28715317-28715339 GAGATAAGATAGAGGGATGGAGG + Intronic
1124481027 15:30080030-30080052 GAGATAAGATAGAGGGATGGAGG - Intergenic
1124522571 15:30417134-30417156 GAGATAAGATAGAGGGATGGAGG + Intergenic
1124536093 15:30549080-30549102 GAGATAAGATAGAGGGATGGAGG - Intergenic
1124762558 15:32458511-32458533 GAGACAAGATAGAGGGATGGAGG + Intergenic
1124776067 15:32590560-32590582 GAGATAAGATAGAGGGATGGAGG - Intergenic
1124826600 15:33102543-33102565 AAGAGAAGACAGGGAGAAGGAGG - Intronic
1125145995 15:36469003-36469025 CAGACCAGACAGAGGGAAGGAGG + Intergenic
1125233208 15:37482039-37482061 GAGAGAGGAGAGAGGGAAGGAGG + Intergenic
1125299945 15:38244718-38244740 GAGAGTTGAGGGCGGGAAGGCGG + Intergenic
1125437284 15:39660099-39660121 GAGAGAGGAAAGAGAGAAGGAGG + Intronic
1125447764 15:39776187-39776209 GGGAGGAGAGAGAGGGAGGGAGG + Intronic
1125605824 15:40939321-40939343 GAGGGCATAAAGAGGGAAGGGGG - Intergenic
1126406136 15:48324466-48324488 ATGAGTACACAGAGAGAAGGTGG + Intergenic
1126592192 15:50351650-50351672 GAGAGAGGAAAGAGGGAGGGAGG + Intronic
1126759947 15:51960888-51960910 GAGTGTGGGGAGAGGGAAGGGGG + Intronic
1127061648 15:55192279-55192301 GAGAGAAGTCAGGGGGAAAGAGG - Intronic
1127082527 15:55394481-55394503 GGGAGCAGGCAAAGGGAAGGAGG - Intronic
1127130004 15:55852614-55852636 GAGAGTAGACATAGGGACAGAGG - Intronic
1127130215 15:55854611-55854633 GAGAGTAGGCATAGGGATTGAGG + Intronic
1127497147 15:59524092-59524114 GAGGGTAGTCAGATGGCAGGAGG - Intergenic
1127550351 15:60031534-60031556 GTGAGCACACAGAGAGAAGGTGG + Intronic
1127704041 15:61529752-61529774 GTGAGGACACAGAGAGAAGGTGG - Intergenic
1128084451 15:64876194-64876216 CAGAGCAGTAAGAGGGAAGGAGG - Intronic
1128610636 15:69070399-69070421 GAGAGGAGACAGAGGAGAGGAGG + Intergenic
1128677822 15:69624691-69624713 GAGAGGAGAGGGAGGGAAGATGG - Intergenic
1128789666 15:70423744-70423766 GAGATTAGAAGGCGGGAAGGAGG + Intergenic
1128793715 15:70450250-70450272 GTAAGTGGACAGAGGGATGGAGG + Intergenic
1128827683 15:70735193-70735215 GAGGGCAGACAGAGGGATGGGGG + Intronic
1129164513 15:73768717-73768739 GAGAGGAGAGGAAGGGAAGGAGG - Intergenic
1129515297 15:76153608-76153630 GTGAGCAGGCAGAGGGCAGGAGG + Intronic
1129902647 15:79163577-79163599 GAGAGGAGAAAGGGGGAAAGAGG - Intergenic
1130014195 15:80174718-80174740 GAGGGGAGAGAAAGGGAAGGTGG - Intronic
1130029374 15:80297777-80297799 GAGGGAAGACAGAGAGAGGGAGG + Intergenic
1130044754 15:80435172-80435194 GAGGGCAGGCAGAGGGCAGGAGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130863092 15:87908576-87908598 GAGGGGAGAGAGTGGGAAGGGGG + Intronic
1131035439 15:89218908-89218930 GAGAGAGAAGAGAGGGAAGGTGG + Intronic
1131144255 15:90001452-90001474 GAGAGGAGCCGGAGGGAGGGCGG + Exonic
1131308118 15:91263850-91263872 GAGAGAAGGCAGAGGAAAGGAGG - Intronic
1131333709 15:91526615-91526637 GAGAGGAGACAGAGGGCTGAGGG - Intergenic
1131409353 15:92193394-92193416 TGGAGTAGACTGAGGGGAGGAGG - Intergenic
1131756317 15:95566695-95566717 GTGAGTAGAAGGAAGGAAGGTGG - Intergenic
1132357756 15:101185435-101185457 GAGAGTGTTCACAGGGAAGGAGG - Intronic
1132416049 15:101619634-101619656 GAAAGCAGACAGATGGCAGGAGG + Intergenic
1132679404 16:1133565-1133587 GAGGACAGACAGAGGGAAGCTGG - Intergenic
1132755860 16:1485084-1485106 GAGAGAAGAGAGAGAGAAAGAGG + Intergenic
1133103942 16:3494881-3494903 CAGAGGAGACAGCGGGAGGGTGG + Intronic
1133254884 16:4510474-4510496 GAGAGTAGACCCAGAGCAGGAGG - Intergenic
1133421498 16:5650736-5650758 GGGAGAAGACAGGGAGAAGGAGG - Intergenic
1133501965 16:6375315-6375337 GAGAAATGACACAGGGAAGGTGG - Intronic
1133526131 16:6607548-6607570 GAGAGGAGGAAGAGGGAAAGAGG - Intronic
1133629281 16:7603911-7603933 CAGAATGGACAGGGGGAAGGAGG + Intronic
1133818387 16:9215185-9215207 GGGAGAGGACAGAGGGAAGGGGG + Intergenic
1133972022 16:10575045-10575067 GAGAGTAGGCAGAGGTTAGCTGG - Intronic
1134122745 16:11596551-11596573 GGGAGGAGGCAGAGGGGAGGAGG + Intronic
1134691142 16:16191722-16191744 GAGGAAGGACAGAGGGAAGGAGG - Intronic
1134906572 16:17984669-17984691 GAGAGGGGAAAGAGGGAAGGGGG - Intergenic
1135027514 16:19010114-19010136 GAGAGGAGAGAGGGGAAAGGGGG - Intronic
1135480705 16:22818624-22818646 GAAAGGGGAGAGAGGGAAGGAGG - Intronic
1135727222 16:24865050-24865072 GAGAGGAGAGAGAGAGAAAGGGG + Intronic
1136005256 16:27324896-27324918 GAGCGGGGACAGAGGGAAAGTGG - Intronic
1136074799 16:27809657-27809679 GAGAGAAAAGAGAGGGATGGAGG - Intronic
1137484687 16:48881510-48881532 GAAAGGAGAGAGAGGGAGGGTGG - Intergenic
1137664219 16:50239532-50239554 GAAAGTAGAAGGAGGGATGGGGG - Intergenic
1137676780 16:50307593-50307615 GGGTGAAGTCAGAGGGAAGGGGG + Intronic
1137716372 16:50600866-50600888 GAGAGTTTGCACAGGGAAGGTGG - Intronic
1137720053 16:50622490-50622512 GAAGGCAAACAGAGGGAAGGAGG - Intronic
1137935369 16:52630153-52630175 GAGAGTGAACAGAGGGGAGGAGG + Intergenic
1138130622 16:54476602-54476624 GAGGGGAGACAGAGGGAGGGGGG + Intergenic
1138243447 16:55447332-55447354 GAGAGGAGACATAGGAAATGGGG - Intronic
1138486706 16:57349860-57349882 GAAGGAAGAAAGAGGGAAGGAGG - Intergenic
1138510551 16:57506271-57506293 GAGAGGGGACTGAGGGCAGGGGG + Intergenic
1138575176 16:57903118-57903140 GAGGAGAGAGAGAGGGAAGGAGG + Intronic
1138613783 16:58148206-58148228 GAGAGGACACAGAGAAAAGGTGG - Intergenic
1138976596 16:62214838-62214860 GAGACTGGACAGAAGGAAGCTGG - Intergenic
1139147004 16:64337479-64337501 GAGAGAAGACAGAGGCAATAAGG - Intergenic
1139437533 16:66944937-66944959 GAGAGAAGGCAGGGAGAAGGTGG - Exonic
1139672551 16:68501663-68501685 GAGAGGAGAGAGAAAGAAGGAGG - Intergenic
1140012897 16:71153839-71153861 GAGAATAGTAAGAGGGAAGCTGG + Intronic
1140109794 16:71994262-71994284 TTGAGTAGAGAGAGGGAAGTGGG - Intronic
1140268558 16:73442162-73442184 AAGAGAAGGCAAAGGGAAGGAGG + Intergenic
1140337210 16:74118746-74118768 GAGAGGAGAAGGAGGGAGGGAGG + Intergenic
1140480656 16:75261287-75261309 GTAAGCAGACAGAGGGAAGGTGG + Intronic
1140537885 16:75727462-75727484 GAGAGCAGAGAGGGGGAGGGAGG + Intronic
1140903612 16:79392330-79392352 GAGAGGAGAGAGAAGGAAGGAGG + Intergenic
1140905374 16:79404871-79404893 GGGAGAAGAGAGAGAGAAGGAGG - Intergenic
1140930040 16:79618948-79618970 CAGAGGAGACAGAGAGGAGGCGG - Intergenic
1141110261 16:81265979-81266001 GATAGTAGACAGATGGATGGTGG - Intronic
1141212728 16:81996228-81996250 GAGAATGGACTGAAGGAAGGAGG + Exonic
1141331526 16:83115868-83115890 GAGGGCAGAAAGAGGGAATGAGG + Intronic
1141760567 16:86026130-86026152 GAGAGGAGACAGAGAGAGAGAGG + Intergenic
1141882924 16:86871853-86871875 GAGGGAAGAAAGGGGGAAGGGGG - Intergenic
1141998625 16:87650368-87650390 CAGAGGAGAGAGAGGGATGGGGG - Intronic
1142272342 16:89096729-89096751 CAGAGTCGGCCGAGGGAAGGGGG - Intronic
1142280921 16:89147167-89147189 GAGGGTCCACAGAGGGAGGGAGG + Intronic
1142507983 17:377568-377590 GAGAGTGGGGAGAGGGGAGGGGG + Intronic
1142712258 17:1730067-1730089 AAGAGAGGCCAGAGGGAAGGTGG + Intronic
1142883230 17:2896947-2896969 TAGAGCAGACAGAGAGCAGGAGG - Intronic
1142958245 17:3535454-3535476 GGGGGAAGAAAGAGGGAAGGAGG - Intronic
1143065924 17:4247222-4247244 GAGAGCAGAGAGGGGGAAGATGG - Intronic
1143104573 17:4522574-4522596 GAGAAGAGAAAGAGGGAGGGAGG - Intronic
1143114470 17:4574873-4574895 GTGAGTAGGCAGGGGGAAGTGGG - Intergenic
1143303645 17:5929237-5929259 GGGAGAAGAGAGAAGGAAGGAGG - Intronic
1143391519 17:6561619-6561641 AAGAGGAGGAAGAGGGAAGGAGG - Intergenic
1143791811 17:9302709-9302731 GAGACAAGACAGAGAGAAAGTGG + Intronic
1144034190 17:11350591-11350613 GACAGTGGACTGAGGGAAGAGGG - Intronic
1144142219 17:12360713-12360735 GAGACTGGACAGATGGATGGAGG + Intergenic
1144274857 17:13656463-13656485 GTGGGGACACAGAGGGAAGGGGG + Intergenic
1144326415 17:14186308-14186330 GAGAGTAGAATGAGGGTGGGAGG - Intronic
1144475293 17:15583183-15583205 GAGAGTAGAATGAGGGTGGGAGG - Intronic
1144722422 17:17480670-17480692 GAGAGGAGACAGAGAGAGAGAGG + Intronic
1145246340 17:21272310-21272332 GAGAGCAGCCAGAGGCAAGCAGG + Intergenic
1145302729 17:21652596-21652618 CAGAGGAGACAGAGGGCAGGAGG - Intergenic
1145347574 17:22050592-22050614 CAGAGGAGACAGAGGGCAGGAGG + Intergenic
1145416012 17:22714736-22714758 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1145943544 17:28757093-28757115 AAGAATGGACAGAGGGCAGGAGG + Exonic
1145980696 17:29009707-29009729 GAGACCAGAGAGAGGGAAGAAGG + Intronic
1146085916 17:29829503-29829525 GAGAGAGGAGAGAGGGAAGAAGG + Intronic
1146479324 17:33192028-33192050 GAGAGAAGAAAGAGGAAAGGAGG - Intronic
1146605721 17:34255984-34256006 GATAATGGACAGAGAGAAGGAGG - Intronic
1146623854 17:34421142-34421164 GAGAATAGACAAAGGGCAAGAGG - Intergenic
1146624272 17:34424066-34424088 GAGTGGAGACGGAGGGATGGAGG + Intergenic
1146920349 17:36705871-36705893 GGGAGTATACAAAGGGAAGCTGG - Intergenic
1147158544 17:38557895-38557917 GAAAGTAGGCAGAGGGCAGAGGG + Intronic
1147242381 17:39099022-39099044 AACAGGAGACAGAGGGAAGGAGG + Intronic
1147242765 17:39101447-39101469 GAAAGGAGACAGAGGGCACGGGG + Intronic
1147725575 17:42564408-42564430 AAGGGTAAAAAGAGGGAAGGAGG - Intronic
1147840977 17:43371238-43371260 GAGAGTTACCAGAGGTAAGGAGG + Intergenic
1148015638 17:44520085-44520107 GAGAATCTTCAGAGGGAAGGTGG - Intergenic
1148171606 17:45525774-45525796 GAAAATAGAAAGAAGGAAGGGGG - Intergenic
1148277765 17:46320635-46320657 GAAAATAGAAAGAAGGAAGGGGG + Intronic
1148299972 17:46538490-46538512 GAAAATAGAAAGAAGGAAGGGGG + Intronic
1148364415 17:47042775-47042797 GAAAATAGAAAGAAGGAAGGGGG + Intronic
1148616418 17:49003978-49004000 GAGAGTAGAGAGAGAGAAAGTGG + Intronic
1148970560 17:51477202-51477224 GTCAGCAGAAAGAGGGAAGGAGG - Intergenic
1149006029 17:51806230-51806252 GGGAGGAGAAAGAGGGAAGCAGG + Intronic
1149090457 17:52772119-52772141 GAGAGTAGATGGAGGGAGGAAGG + Intergenic
1149965619 17:61161011-61161033 CAAAGTTGACACAGGGAAGGGGG - Intronic
1150586416 17:66522427-66522449 GAGAATAGGCAGGGGGAAGAGGG + Intronic
1150625764 17:66840182-66840204 GAGAGAAGCCAGAGGGCAGGTGG + Intronic
1150810283 17:68350841-68350863 GAGAAGAGATAGAAGGAAGGAGG + Intronic
1151018317 17:70583198-70583220 GAGAGAAGACAGGAGGAATGAGG - Intergenic
1151156751 17:72129627-72129649 GAGAACAGGCACAGGGAAGGAGG + Intergenic
1151163916 17:72188152-72188174 AGGAGAAGAGAGAGGGAAGGAGG + Intergenic
1151278149 17:73051498-73051520 GAGAAGAGACACAGTGAAGGAGG + Intronic
1151433348 17:74079755-74079777 GGCAGGAGACAGAGGGCAGGAGG + Intergenic
1151458651 17:74241794-74241816 GAGAGTGGACAGAGGAGGGGCGG - Intronic
1152018893 17:77770326-77770348 GAGAAGGGACAGAGGGAGGGAGG - Intergenic
1152078575 17:78172860-78172882 GACCCCAGACAGAGGGAAGGGGG - Exonic
1152157997 17:78647553-78647575 GAGAGGAGAGAGAGGCAGGGTGG + Intergenic
1152241892 17:79165256-79165278 GAGAAGAGAAAGAGGGAGGGAGG + Intronic
1152362970 17:79840840-79840862 GAGAGTGGAGCGAGGGATGGGGG + Intergenic
1152529633 17:80910000-80910022 GAGAAAAAACAGCGGGAAGGCGG - Intronic
1152598345 17:81249179-81249201 AAGAGGAGACAGAAGGGAGGAGG + Intronic
1153590451 18:6669090-6669112 GAGAGGAGAGGGAGGGAAGGAGG + Intergenic
1153987791 18:10368595-10368617 GAGAGCAGAGAGAGGGAGGAAGG + Intergenic
1154078454 18:11229421-11229443 TAGAGAAAACAGAGAGAAGGAGG - Intergenic
1154503188 18:15006586-15006608 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1155007429 18:21741308-21741330 GAGAGCGGGCAGAGGGGAGGGGG - Exonic
1155034270 18:22011492-22011514 GAGAAAAGACAGAGGAAAAGAGG - Intergenic
1155103547 18:22638500-22638522 GAGAGGGGAAGGAGGGAAGGAGG + Intergenic
1155149057 18:23108073-23108095 GAGAGTAGAGGGAGGGTGGGAGG - Intergenic
1155322795 18:24634944-24634966 GAGAGTAGAATGAGGGTTGGCGG - Intergenic
1155797377 18:30057508-30057530 AAGAAAAGAAAGAGGGAAGGAGG - Intergenic
1155797391 18:30057603-30057625 AAGAAAAGAAAGAGGGAAGGAGG - Intergenic
1155858952 18:30872087-30872109 GAGAAGAGACAGAGGGAGGGGGG - Intergenic
1155917779 18:31572980-31573002 GAGAGGAAAGAGAGGGAAGGAGG + Intergenic
1156289140 18:35730364-35730386 GAGAGGAGAAAGTGGGAAGGGGG - Intergenic
1156612608 18:38743105-38743127 GAGAGGAGAGAGAGAGAAAGAGG + Intergenic
1156690650 18:39703138-39703160 GAGAGGAGGGAGAGTGAAGGGGG - Intergenic
1157094673 18:44677497-44677519 GAGAGGAGAGAAAGGAAAGGAGG - Intergenic
1157099983 18:44720650-44720672 GAGAGTACAGGGAGGGATGGAGG + Intronic
1157301395 18:46482399-46482421 GTGAGGACACAGAGAGAAGGCGG + Intronic
1157405493 18:47419273-47419295 AAGAGGAGATAGGGGGAAGGAGG + Intergenic
1157836815 18:50911500-50911522 GAGAGTTAACAGAGGGAAGTAGG + Intronic
1157985476 18:52432873-52432895 GAGAGTTGATAGAGGGAAATTGG + Intronic
1158123520 18:54077175-54077197 GATATTAGAGACAGGGAAGGGGG - Intergenic
1158259139 18:55588246-55588268 GGGAGGGGACGGAGGGAAGGGGG + Intronic
1159103524 18:63980779-63980801 AAGAGGATATAGAGGGAAGGAGG - Intronic
1159108861 18:64032926-64032948 GAGAGTAGACCTAGGAATGGTGG + Intergenic
1159325449 18:66910068-66910090 GAGAGGACACAAAGAGAAGGTGG - Intergenic
1159362649 18:67425303-67425325 GAGAGGAGACAGAGAAAAGCAGG - Intergenic
1159918838 18:74209403-74209425 TAGAGCAGAAGGAGGGAAGGAGG - Intergenic
1160111260 18:76033987-76034009 TAGAGCACACAGAGGGAAGACGG + Intergenic
1160566785 18:79790906-79790928 GAGAGAGGAGAGAGGGAGGGAGG - Intergenic
1160595293 18:79969245-79969267 GAGAGGAGAGAGAGAGAGGGAGG + Intronic
1160711738 19:555002-555024 GTGAGTGGACAGAGGCAACGTGG - Intergenic
1161029442 19:2050956-2050978 GGGAGCAGACAAAGGGAGGGCGG + Intronic
1161131421 19:2591319-2591341 GAGAGGAAACAGAGAGGAGGCGG - Intronic
1161427155 19:4210026-4210048 GAGGGGAGAGAGAGTGAAGGGGG - Intronic
1161754162 19:6119421-6119443 GAGAGGAGAGGGAGGGAGGGAGG - Intronic
1162143452 19:8598443-8598465 GACAGTGGTCAGAGGAAAGGAGG + Intronic
1162151977 19:8652904-8652926 GAGAAGAGAGAGAGAGAAGGAGG - Intergenic
1162385913 19:10360613-10360635 CAGAGTAGTCAGAGGGATGTGGG + Intronic
1162642022 19:12018417-12018439 GAGTGTAGACAGAGAGTATGAGG - Intronic
1163091147 19:15021279-15021301 GAGAATAGAGAGAGGGACAGGGG + Intronic
1163093214 19:15035808-15035830 GAGAGGAGAAGGAGGGAGGGAGG + Intergenic
1163178290 19:15581083-15581105 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163178295 19:15581106-15581128 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163178300 19:15581129-15581151 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163178305 19:15581152-15581174 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163178310 19:15581175-15581197 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163178315 19:15581198-15581220 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163178320 19:15581221-15581243 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163178325 19:15581244-15581266 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163178330 19:15581267-15581289 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163178335 19:15581290-15581312 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163178340 19:15581313-15581335 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163371988 19:16906292-16906314 GAGAAGAGAGAGAGGGAGGGAGG - Intronic
1163444634 19:17339267-17339289 GTGAGTAGGCGGCGGGAAGGGGG + Intronic
1163472701 19:17506573-17506595 GAGAGGAGAGGGAGGGAGGGAGG + Intergenic
1163815226 19:19460938-19460960 CAGAGCACACAGAGGGACGGGGG - Intronic
1164149760 19:22541008-22541030 GCGAGTAGACGGTGGGAAGATGG + Intergenic
1164250165 19:23468899-23468921 GAGAGGAGGAAGAGAGAAGGAGG - Intergenic
1164324418 19:24179438-24179460 GAGAGAAAAAGGAGGGAAGGAGG + Intergenic
1164747165 19:30624908-30624930 GAGAGAAGAGTGAGGAAAGGAGG - Intronic
1164802692 19:31090752-31090774 AAGGGGAGACAGAGAGAAGGAGG + Intergenic
1164967090 19:32494762-32494784 GAGAAGAGACAGAAGGAATGTGG - Intergenic
1164982456 19:32624555-32624577 GAGAGAAGCCAGAAGGAGGGCGG + Intronic
1165156867 19:33794599-33794621 GAGGGTGGAATGAGGGAAGGTGG - Intergenic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165911328 19:39230053-39230075 GAGAGGAGAGAAAGGAAAGGGGG + Intergenic
1165923556 19:39313782-39313804 GAGAGGAGACAGGGCAAAGGAGG + Intronic
1166006327 19:39909857-39909879 GGGAGTGGACAGAGTGCAGGTGG - Intronic
1166322577 19:42027781-42027803 GTGAGTAGGAGGAGGGAAGGGGG - Intronic
1166329584 19:42070223-42070245 GAGAGAAGAGGGAGGGAGGGAGG + Intronic
1166342926 19:42149697-42149719 GAGAAAAGAAAGAGGGAGGGAGG + Intronic
1166872410 19:45878915-45878937 GACGGTGGACAGAGAGAAGGTGG - Intergenic
1166872412 19:45878930-45878952 CAGAGTAGACAGAGAGACGGTGG - Intergenic
1166880934 19:45929520-45929542 GAGAGGGGACAGAGAGATGGGGG + Intergenic
1167191302 19:47991790-47991812 GAGGGGAGAAAGAGGGAAAGGGG - Intronic
1167623048 19:50569214-50569236 GGGAGTAGACAGAGTGGGGGAGG + Intergenic
1167680131 19:50914632-50914654 GAGAGAAGACAGGAGGAAAGTGG - Intergenic
1167687912 19:50968159-50968181 GGGAGCAGACAGAGGGATGGGGG - Intronic
1167717151 19:51150823-51150845 GTGATTAGACAGAGGGAGGCAGG + Intronic
925184381 2:1836969-1836991 GAGAGTAGACAGAGGTGTGTGGG + Intronic
925235579 2:2274376-2274398 GAGAGAGGACAGTGGGCAGGTGG + Intronic
925460031 2:4054042-4054064 GAGAGGATCCAGAGGCAAGGCGG - Intergenic
925474952 2:4203110-4203132 GTGAGGAGACAGGGAGAAGGTGG - Intergenic
925725555 2:6867332-6867354 GTGAGAACACAGAGAGAAGGAGG - Intronic
925752321 2:7099865-7099887 GAGAGAAGAGTGAGTGAAGGAGG - Intergenic
925781472 2:7386009-7386031 GTGAGGAGAGAGAGAGAAGGGGG + Intergenic
925786144 2:7432627-7432649 GAGAGAGGAGAGAGGGAAGCTGG - Intergenic
926244664 2:11113795-11113817 GAGAAAGGACAGAGGGAGGGAGG - Intergenic
926694091 2:15758580-15758602 GTGAGGACACAGCGGGAAGGTGG + Intergenic
926714509 2:15913573-15913595 GAGGCTAGGCAGAGGGAGGGAGG + Intergenic
926922128 2:17949502-17949524 GAGAGGACTCAGAGAGAAGGTGG + Intronic
927436632 2:23072104-23072126 GAGCGTAGGCAGAGGGAGGCTGG - Intergenic
927529094 2:23777116-23777138 GTGAGGACACAGAGAGAAGGAGG + Intronic
927843981 2:26461997-26462019 GAGAGGAGGCAGAGGGAAGGTGG - Intronic
927937555 2:27084191-27084213 GTGAGCAGCCAGAGGGAGGGCGG - Intronic
928133445 2:28670186-28670208 GAGAGAAGAGAGATGGATGGTGG + Intergenic
928194178 2:29202501-29202523 GAGAGCAGAGAGAGGGAGGTGGG - Intronic
928278348 2:29921817-29921839 GAGAGGGAACAGAGGGAGGGTGG - Intergenic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
928360060 2:30655474-30655496 GAGAGTGGTCGGAGGGGAGGAGG + Intergenic
928460243 2:31465742-31465764 GAGAGTAGGCAGAGGGTTAGGGG + Intergenic
928644625 2:33339033-33339055 GAGAATGGATAGAGGGAGGGAGG + Intronic
928957693 2:36888241-36888263 GATAATAGACATGGGGAAGGGGG - Intronic
930018187 2:46985031-46985053 GAGTGCAGACAGGGGGAAGCAGG - Intronic
930309879 2:49726774-49726796 GAGAGAAGAGAAAGTGAAGGGGG - Intergenic
930721608 2:54643627-54643649 GAGAGAAGTCGGGGGGAAGGGGG - Intronic
930752255 2:54945198-54945220 GAGAGAAGGGAGAGAGAAGGGGG - Intronic
930900734 2:56504911-56504933 GTAAGTAGATAGAAGGAAGGAGG + Intergenic
930933600 2:56919307-56919329 GAGAGTAGAAAGTGGGAGGTTGG + Intergenic
930990710 2:57650672-57650694 CAGTGTAGACAGAGGCAATGGGG + Intergenic
931077693 2:58734988-58735010 GAGAGGAGAGAGAAGGAGGGAGG - Intergenic
931553024 2:63468168-63468190 GAAAGGAGAGAGAAGGAAGGAGG - Intronic
931892524 2:66689498-66689520 GAGAGTAGAGAGAGAGAATGTGG + Intergenic
932094061 2:68831381-68831403 GAGAACAGAGAGAAGGAAGGAGG - Intergenic
932132648 2:69201697-69201719 GAGGGTAGAAAGTGTGAAGGAGG + Intronic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932274337 2:70440794-70440816 GAGAGGAGAAAGATGGGAGGAGG - Intergenic
932411728 2:71551557-71551579 CAGGGGAGACAGAGGGGAGGAGG - Intronic
932699122 2:73981503-73981525 TAGAGCAGACAGAGGGAGAGAGG - Intergenic
933119258 2:78515810-78515832 GAGAAGAGACAGGGGGAATGGGG + Intergenic
933137778 2:78759067-78759089 GAGTGGAGACACAGAGAAGGGGG - Intergenic
933601733 2:84339056-84339078 GAGAGTAGACAGCTGGAGGTAGG + Intergenic
933721160 2:85398583-85398605 GGGAGAAGGCAGGGGGAAGGTGG - Intronic
934715074 2:96538384-96538406 GAGGGTACAGAAAGGGAAGGAGG - Intronic
934895006 2:98110104-98110126 GAGAAGAGAAAGAGGGTAGGGGG - Intronic
934959333 2:98655152-98655174 GACAGTGGAGAGAGGGAAGAGGG + Intronic
935269361 2:101420216-101420238 AAGAGAAGCCAGAGGGGAGGTGG - Intronic
935556841 2:104519356-104519378 GAAAGGAAACAGAGGGAGGGAGG + Intergenic
935611374 2:105029314-105029336 GAGGGAGGAAAGAGGGAAGGGGG + Intergenic
935757052 2:106284442-106284464 CAGAGCAGACACAGGGAAGCTGG - Intergenic
935868567 2:107419460-107419482 GTGAGTACACAGTGAGAAGGTGG - Intergenic
936060577 2:109293234-109293256 GAGGGAGGACAGAGGGATGGTGG + Intronic
936086235 2:109471374-109471396 GAGAGAAGAGAAAGTGAAGGGGG + Intronic
936112509 2:109676546-109676568 CAGAGCAGACACAGGGAAGCTGG + Intergenic
936870350 2:117129181-117129203 GAGAGAAGAGAGAAGGAAGAAGG - Intergenic
937014065 2:118587513-118587535 GTGAGGACACAGAGAGAAGGCGG + Intergenic
937257961 2:120568197-120568219 CAGAGAAGCCAGAGGGGAGGTGG - Intergenic
937305472 2:120867867-120867889 GGGAGGAGAGAGAGGGAATGTGG + Intronic
937400836 2:121582224-121582246 GGGAGCAGAGGGAGGGAAGGAGG + Intronic
937576948 2:123435224-123435246 GACAGTAGACAGAGCTCAGGCGG + Intergenic
937941810 2:127292061-127292083 GTGAGTACACAATGGGAAGGTGG - Intronic
938108709 2:128550307-128550329 TACACGAGACAGAGGGAAGGAGG - Intergenic
938165118 2:129019355-129019377 GAGAGTCAGCAGAGAGAAGGGGG + Intergenic
938502369 2:131836756-131836778 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
938599286 2:132821023-132821045 GAGAGGAGACAGGGTGAATGTGG + Intronic
938698801 2:133858401-133858423 GAGAGGGGAGAGAGGGAAAGAGG + Intergenic
939238311 2:139526075-139526097 GAGAGAAGAGTGAGTGAAGGAGG + Intergenic
939244868 2:139610262-139610284 GAGAGTGGAGAGAGAGAAAGGGG - Intergenic
939417763 2:141923482-141923504 GTGTGTAGAGAGAGGGAGGGAGG + Intronic
939513396 2:143135673-143135695 GAGAGTTTCAAGAGGGAAGGAGG - Intronic
940457735 2:153922676-153922698 GATAGTGGACTGGGGGAAGGTGG - Intronic
941347580 2:164389343-164389365 GAGAGGAGAGGGAGGGAGGGAGG - Intergenic
941422185 2:165296175-165296197 TACTTTAGACAGAGGGAAGGAGG - Intronic
941794221 2:169582553-169582575 GAGTGTAGACAGTGGGAGGAGGG - Intergenic
941801969 2:169669985-169670007 AAGAGTAGAAAGAGAGAAGAGGG - Intronic
942614547 2:177776736-177776758 GTGAGGACACAGAGAGAAGGTGG + Intronic
942701368 2:178714862-178714884 GAGAGGAAACAAAGGGAAAGTGG + Intronic
942910748 2:181241550-181241572 GAAAGTAGAGGGAGGGAGGGAGG - Intergenic
943065609 2:183082853-183082875 AAGAGAAGAGAGAGGGAGGGAGG - Intronic
943482493 2:188437920-188437942 GAGGGTAGAGAGTGGGAAGAGGG + Intronic
943684612 2:190805308-190805330 GAAAGAAGAGAGAGGGAGGGAGG + Intergenic
944708791 2:202317220-202317242 GAGAGTAAACAGGTGGAAGCTGG - Intergenic
944724349 2:202454956-202454978 GTGAGGACACAGAGAGAAGGTGG - Intronic
945014712 2:205503018-205503040 GAGAGAAGAGAGAGGGGAGAGGG - Intronic
945050528 2:205819981-205820003 GAGAGAAGAGAGAGAGGAGGGGG - Intergenic
945213328 2:207406996-207407018 GTGAGGACACAGAGAGAAGGTGG - Intergenic
945337986 2:208615634-208615656 GAGACTAGACAGAGTGCAGGAGG + Intronic
945624687 2:212188251-212188273 GAGAGAAGAGGGAGGGAGGGAGG - Intronic
945653188 2:212590471-212590493 GAGAGAAGACACAGGGATGGTGG + Intergenic
945653386 2:212592714-212592736 GAGAGAAGACACAGGGATGGTGG + Intergenic
945674473 2:212839282-212839304 GAGACGAGGCAGAGGGATGGGGG + Intergenic
945782300 2:214190756-214190778 GAGAGGACACAGAAAGAAGGTGG + Intronic
945825343 2:214714844-214714866 GAGAGTGGAAAGAAGGAATGTGG - Intergenic
945922042 2:215764589-215764611 GAGAGTTGACAGTGAGAGGGAGG + Intergenic
945930669 2:215852058-215852080 GAGGGGAGACAAAGGGAAAGAGG - Intergenic
946726437 2:222665986-222666008 GAGAGAAGACAGAGAGAGAGAGG + Intergenic
946881362 2:224180272-224180294 GGCAGGAGACAGAGGGATGGTGG + Intergenic
947077058 2:226355992-226356014 AAAAAGAGACAGAGGGAAGGGGG + Intergenic
947077771 2:226364057-226364079 GAGAGAGGAAGGAGGGAAGGAGG + Intergenic
947370852 2:229444165-229444187 GAGAATAGACGGAAGGAAAGTGG + Intronic
947635162 2:231676709-231676731 GACAGAAGACAGAAGGCAGGCGG - Intergenic
947797628 2:232905081-232905103 GAGAGGAGAGAGAGGGGAGAGGG - Intronic
948257094 2:236576435-236576457 GAAAGTGGAGAGAGGGAGGGAGG - Intronic
948303921 2:236932617-236932639 GAGAGTAGCCTGGGGGCAGGAGG + Intergenic
948303929 2:236932654-236932676 GATAGTAGCCTGAGGGAGGGGGG + Intergenic
948381983 2:237557055-237557077 GAGAGAACAGAGAGGGAGGGAGG - Intergenic
948504879 2:238422000-238422022 GAGAGAAGACAGCGTGAAGACGG - Intergenic
948566004 2:238886667-238886689 GGGTGGAGACAGAGGGCAGGTGG + Intronic
948739451 2:240033343-240033365 GAGAGGAAACAGAGGTCAGGTGG - Intergenic
948742737 2:240058201-240058223 GCTAGTAGACAGAGCAAAGGAGG + Intergenic
1168842241 20:916906-916928 GAGAGCAGAGGGAGGGGAGGAGG + Intergenic
1168957373 20:1843763-1843785 GAGAGTAGAGAGAGCAAGGGAGG + Intergenic
1169027110 20:2380609-2380631 GAGAGAAGACTGAGGGAACTCGG - Intergenic
1169316716 20:4597896-4597918 GAGAGGAGAGAGAGGGAGGGAGG - Intergenic
1169525964 20:6426141-6426163 AAGAGGAGAGAGAGAGAAGGGGG - Intergenic
1170012214 20:11736464-11736486 GAATGTGGACAGAGGGAATGTGG + Intergenic
1170601174 20:17842927-17842949 GAGAGGAGACAGAGAAAAAGGGG + Intergenic
1170743725 20:19080128-19080150 GAGAATAGACAGAGCCAAGCAGG - Intergenic
1171332805 20:24356400-24356422 GAAAGAGGACAGAGGGGAGGGGG + Intergenic
1171342996 20:24445179-24445201 GTGGGTAGGAAGAGGGAAGGGGG - Intergenic
1171519319 20:25764127-25764149 CAGAGGAGACAGAGGGCAGGAGG - Intronic
1171557605 20:26092364-26092386 CAGAGGAGGCAGAGGGCAGGAGG + Intergenic
1172398712 20:34630352-34630374 GAGAGCAGGAACAGGGAAGGTGG - Intronic
1172474869 20:35228963-35228985 GAAAGCTGACAGAGGGAAGGGGG - Intronic
1172612149 20:36260298-36260320 GGAAGTGGACAGAGGGAAGAGGG - Intronic
1172853526 20:37983667-37983689 GAGGGTACAGAGAGGGAAGGCGG + Intronic
1172890565 20:38260876-38260898 GGGGGTGGACGGAGGGAAGGGGG - Intronic
1172896601 20:38304616-38304638 GAGGTTACATAGAGGGAAGGAGG - Intronic
1172974475 20:38895844-38895866 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1172974483 20:38895871-38895893 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1172974491 20:38895898-38895920 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1172974499 20:38895925-38895947 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1173120824 20:40287408-40287430 GAGAGGTGCCAGGGGGAAGGAGG - Intergenic
1173418041 20:42876034-42876056 GAGGATGGAGAGAGGGAAGGAGG - Intronic
1173845396 20:46185267-46185289 AGGAATAGACTGAGGGAAGGGGG - Intronic
1174084943 20:48000589-48000611 GAAAATAGAAAGAGGGAGGGAGG - Intergenic
1174605171 20:51756229-51756251 GTGAGGACACAGGGGGAAGGTGG - Intronic
1174735586 20:52962734-52962756 GTGAGTAAAGAAAGGGAAGGTGG - Intergenic
1174881331 20:54282450-54282472 CAGAGTAAACAGAGGTAAAGAGG - Intergenic
1174885098 20:54325140-54325162 GAGAGTGGGCAGAGGGAGGTAGG + Intergenic
1175018825 20:55822507-55822529 GAGAGGAGAGAGAGAGAAGCTGG - Intergenic
1175052482 20:56168109-56168131 AAGAACAGAGAGAGGGAAGGAGG - Intergenic
1175245060 20:57577215-57577237 GAGAATAGACAGATGGATAGTGG + Intergenic
1175457495 20:59126560-59126582 TAGAGGAGACAAAGGGAAGCAGG - Intergenic
1175616588 20:60405068-60405090 GAGATTAGACTGGGGGCAGGAGG - Intergenic
1175717140 20:61262770-61262792 GAGGGAGGAGAGAGGGAAGGAGG - Intronic
1175899394 20:62354068-62354090 GAAAGTAGGCAGAGCCAAGGTGG - Intronic
1175979971 20:62733765-62733787 CAGAGGAGAGAGAGGGGAGGAGG + Intronic
1176653463 21:9570408-9570430 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1176718017 21:10370560-10370582 GATAGTAGAGAGATGGTAGGTGG - Intergenic
1177022859 21:15884900-15884922 GTGAGGACACAGAGAGAAGGTGG - Intergenic
1177244249 21:18502219-18502241 CAGAGGAGATAGAGGGATGGAGG + Intergenic
1177494062 21:21866097-21866119 GTGAGGACACAGAGAGAAGGTGG - Intergenic
1177848419 21:26318548-26318570 GAGAGTAGAGACAAAGAAGGGGG + Intergenic
1178204185 21:30444000-30444022 GTGAGGACACAGAGAGAAGGTGG + Intergenic
1178329641 21:31676648-31676670 AAGAGTAGACAGGATGAAGGAGG - Intronic
1178778756 21:35578899-35578921 GAGAGAAGAGAGAGGAAGGGAGG + Intronic
1178862019 21:36297541-36297563 GGCAGGAGACAGAGTGAAGGGGG + Intergenic
1178957858 21:37039711-37039733 GAGGGAAGGGAGAGGGAAGGGGG - Intergenic
1179083488 21:38195481-38195503 GACAGGACACAGATGGAAGGTGG - Intronic
1179224574 21:39442484-39442506 GAGAAAAGCCAGAGGGAATGTGG + Intronic
1179368218 21:40779239-40779261 GAGAGTAGAGAGAGGCAAGACGG + Intronic
1179499135 21:41796047-41796069 GAGGGGAGAAAGGGGGAAGGGGG - Intergenic
1179514445 21:41897185-41897207 GAAACCAGACAGGGGGAAGGAGG + Intronic
1179568602 21:42264718-42264740 GACAGAGGAGAGAGGGAAGGAGG + Intronic
1180299245 22:11023470-11023492 GATAGTAGAGAGATGGTAGGTGG - Intergenic
1181112594 22:20610720-20610742 GAGAGTGAACAGAGAGAAGCCGG + Intergenic
1181345022 22:22213424-22213446 GAGAGTTGGCAGAGGGAGGGAGG + Intergenic
1181406727 22:22690224-22690246 GTGAGTGGACAGGGGGAAGCTGG + Intergenic
1181576948 22:23801261-23801283 GACAGCAGACAGAGCCAAGGAGG - Intronic
1181901551 22:26160323-26160345 GAGAGGAAGTAGAGGGAAGGAGG + Intergenic
1182285344 22:29243739-29243761 GAAAGGCCACAGAGGGAAGGTGG - Intronic
1182289244 22:29265995-29266017 GGTAGTAGTCTGAGGGAAGGGGG - Intronic
1182457826 22:30463222-30463244 GTGATTAGGCAGAGGGAAGTGGG - Intronic
1182743555 22:32587305-32587327 GAGAGAGGACATAGGGAGGGAGG + Intronic
1182943584 22:34301210-34301232 GAGAGAACTCAGAGGGAAGAAGG + Intergenic
1183084457 22:35478056-35478078 GAGAGGAGAAGGAGGGAAGTGGG - Intergenic
1183416763 22:37687030-37687052 GAGATTAGACCGAGGGAAGGAGG + Intronic
1183698845 22:39438299-39438321 GAGGGGAGAGGGAGGGAAGGAGG - Intergenic
1183712801 22:39515571-39515593 CAGATAAGACAGAGGGGAGGAGG + Exonic
1183751492 22:39723598-39723620 GAGAGGAGAGGGAGGGCAGGAGG - Intergenic
1184113063 22:42406453-42406475 GAGAGTAGACGGATGGGAAGTGG - Intronic
1184218112 22:43080762-43080784 GAGAGGAGACAGAGGGTCTGGGG - Intronic
1184280101 22:43432570-43432592 GGGAGGAGAGAGAGGGAAAGAGG + Intronic
1184564926 22:45286105-45286127 TGGAGTAGCCAGAGGGAAGCAGG - Intronic
1184586637 22:45452519-45452541 CATAGTGGACAGAAGGAAGGGGG - Intergenic
1184815975 22:46870267-46870289 GAGAGCAGACAGAGAGCAGAGGG - Intronic
1184868842 22:47220221-47220243 GAGGGGTGACAGAGGGATGGGGG - Intergenic
1185004910 22:48270104-48270126 GAGAGGAGAGAGAGGGGAAGGGG + Intergenic
949332828 3:2941267-2941289 GAAAGTAGACAGAGCAAAGGAGG - Intronic
949525574 3:4900172-4900194 GAGTGTATACAGAGGGAGAGAGG - Intergenic
949785775 3:7740108-7740130 TAGAGTATAAAGAGGGAAGCTGG + Intronic
950671317 3:14527436-14527458 GAGGGAAGAGGGAGGGAAGGAGG + Intronic
951097828 3:18652401-18652423 CATGGTAGACAGAGAGAAGGTGG + Intergenic
951607290 3:24450040-24450062 GGAAGTAAACAGAGGGAAGAAGG + Intronic
952510153 3:34044757-34044779 GAGAGCTGACACAGGGAAAGTGG + Intergenic
952799038 3:37271087-37271109 GACAGTAGACAGAGCTCAGGTGG + Intronic
953548796 3:43884686-43884708 GAGAGTAGCCAGCAGGAAGTGGG - Intergenic
953724029 3:45381976-45381998 GAGAGTGGCCAGAGGCACGGGGG - Intergenic
953875136 3:46662374-46662396 GAGAGCACAGAGAGGAAAGGGGG + Intergenic
954632001 3:52052794-52052816 GGGAATAGAGAGAGGGAAGCAGG - Intronic
954655150 3:52190140-52190162 GAGAGGAGACAGGGAGGAGGGGG + Intergenic
955158915 3:56445667-56445689 GAGAGTGGCAAGAGGGGAGGCGG - Intronic
955167565 3:56529362-56529384 GAGAGAAGAGAGAGTGAAGGGGG + Intergenic
955700808 3:61680287-61680309 GAAAGTAGAGTGAGGGAAGCAGG + Intronic
956039585 3:65132031-65132053 TAGAGCCAACAGAGGGAAGGAGG - Intergenic
956145653 3:66188423-66188445 TGGAGTATGCAGAGGGAAGGAGG + Intronic
956219332 3:66884809-66884831 GAGAGTGGGGAGAGGGAAGGAGG + Intergenic
957710930 3:83859133-83859155 AGGAGCAGACAGAGTGAAGGGGG + Intergenic
957927371 3:86832014-86832036 GATACTAAACAAAGGGAAGGGGG + Intergenic
958076504 3:88688356-88688378 GAGAGAAGAGAGAGGGAATGGGG - Intergenic
958536862 3:95414986-95415008 GAAAGAAAACAGAAGGAAGGAGG + Intergenic
958936373 3:100260580-100260602 GGGAATTGACATAGGGAAGGCGG - Intergenic
959539607 3:107523968-107523990 GAGAGAAGAGGGAGGGAAGGGGG + Intronic
959807624 3:110576068-110576090 GGAAGTAGACAGATGGAAGCAGG + Intergenic
959974435 3:112442532-112442554 GAGGGCAGAGAGAGGGAGGGGGG + Intergenic
960369974 3:116823220-116823242 GAGAGTGAAGAGAGGGGAGGTGG + Intronic
960506607 3:118501861-118501883 GCAAGGAGACAGAGAGAAGGGGG - Intergenic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
960926577 3:122800454-122800476 GGCAGTAGCCAGAGGGAATGTGG + Intronic
961153587 3:124660338-124660360 GAGGGAAGACAAAGGAAAGGGGG - Intronic
961234538 3:125353929-125353951 GAGAGGAGAGAGGGGTAAGGTGG + Intronic
961428865 3:126865703-126865725 CAGAGTAGACTCAGGGAAGAGGG - Intronic
961440711 3:126951561-126951583 GAGAGAAGGAAGAGGGAGGGAGG + Intronic
961928424 3:130508246-130508268 GTGAATACACAGAGAGAAGGCGG + Intergenic
962234809 3:133698900-133698922 GAGGGTTGAGAGATGGAAGGAGG - Intergenic
962313419 3:134342092-134342114 CAGAGGAGACACAGGGAAGAAGG + Intergenic
962842827 3:139251388-139251410 GAGAGGAGAAAGAGGGGAGGAGG - Intronic
962849155 3:139295006-139295028 GACAGTAAACACAGGGAAGCCGG - Intronic
962962769 3:140326322-140326344 GAGGCAAGACAGAGGGAAGAAGG + Intronic
963176917 3:142308288-142308310 GAGAGGAGGCAGAGAGAGGGAGG - Exonic
963271645 3:143291238-143291260 GGGAGTGGACACTGGGAAGGTGG - Intronic
963323608 3:143836610-143836632 GAGAGGGGACAGAAGGAAGGAGG + Intronic
963570295 3:146986341-146986363 AAGAGCAGAGAGAGGAAAGGTGG - Intergenic
963897332 3:150701161-150701183 GAGAGAAGAAAGATGGAAGGAGG + Intronic
964088364 3:152845682-152845704 GAGAGGAGAGGAAGGGAAGGGGG - Intergenic
964472775 3:157072013-157072035 GAGAGGAGACAGAGAGAGAGAGG + Intergenic
964762465 3:160147193-160147215 AAGGGGAGACAGAGGGAGGGAGG - Intergenic
965620976 3:170642090-170642112 GACAGAAGACAGGGGGAAGAGGG - Intronic
965640984 3:170828813-170828835 GAGAAGAAACAGAGGGAGGGAGG + Intronic
965652274 3:170946938-170946960 GAGAGAGGAGAGAGGGAGGGAGG + Intergenic
965801416 3:172497619-172497641 GAGAAGAGACATAAGGAAGGGGG + Intergenic
966230465 3:177646065-177646087 GAGAGTAGAGAGAGATAAGAGGG - Intergenic
966621568 3:181969708-181969730 AAGAGTAGATAAAGGGAAGTAGG + Intergenic
966853662 3:184179569-184179591 GAAAATAGACATTGGGAAGGTGG - Intronic
967360623 3:188626600-188626622 GTGAGGACACAGAGAGAAGGTGG - Intronic
967484550 3:190015435-190015457 GTGAGTAAACAGAGCCAAGGGGG - Intronic
967498866 3:190174740-190174762 GAGAGAAGAAGGAGGGAGGGAGG - Intergenic
967512002 3:190322884-190322906 GAGAGCAGAGAGAGGAAAGAAGG - Intronic
968003619 3:195224658-195224680 GACAGCTGACAGAGGGAAAGAGG + Intronic
968130250 3:196188951-196188973 GAGAGGAGCCACAGAGAAGGAGG - Intergenic
968862800 4:3185899-3185921 GAAAGAAGAGAGAGGGAGGGAGG + Intronic
969145862 4:5123609-5123631 TGGAGGACACAGAGGGAAGGTGG - Intronic
969334364 4:6498928-6498950 GAGAGGAGAGAGAGGGGAGAGGG - Intronic
969437456 4:7196631-7196653 GAGGGGAGGGAGAGGGAAGGGGG - Intronic
969481316 4:7448543-7448565 GAGGGTAGAGAAAGGGAGGGAGG - Intronic
969632956 4:8349056-8349078 GTGAGGACACGGAGGGAAGGTGG - Intergenic
970615153 4:17761852-17761874 GATAGTACAGAGAGGTAAGGTGG - Intronic
970662981 4:18306879-18306901 GAGAGCAGATAGAGGAAATGGGG - Intergenic
970698333 4:18704634-18704656 AAGAAAAGAAAGAGGGAAGGAGG - Intergenic
970993804 4:22242420-22242442 GAGGGCAGACAGAGGGAGTGGGG - Intergenic
971222088 4:24717570-24717592 GTGAGGACACAGAGAGAAGGAGG + Intergenic
971229541 4:24789890-24789912 TAGAGAAAACAGAGGGAATGCGG - Intronic
971318703 4:25588220-25588242 GAGAATGGACAGAAGGGAGGGGG - Intergenic
971367257 4:25987223-25987245 GGGAGACGACAGAGGAAAGGAGG - Intergenic
971499397 4:27301919-27301941 GAGACTAGATAAAGGAAAGGAGG + Intergenic
972953966 4:44366419-44366441 GAAAATAGAGAGAGCGAAGGGGG - Intronic
973652203 4:53007277-53007299 GAGAGGAGAGAGAGGGAGAGAGG + Intronic
973980411 4:56304077-56304099 GAGAAGAGGCAGAGGGAGGGAGG - Intronic
975109959 4:70612007-70612029 AATAGTAGACAGAGGCCAGGGGG - Intergenic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975495379 4:75030760-75030782 GAGTGGAGACATGGGGAAGGTGG - Intronic
975652881 4:76612038-76612060 GAGAGGAGGCAGAGGCAAGCAGG - Intronic
975920184 4:79377703-79377725 GAGAGGAGAGAAAGAGAAGGAGG - Intergenic
976204764 4:82614322-82614344 GAGATTCATCAGAGGGAAGGTGG - Intergenic
976544597 4:86319893-86319915 GAGAGTAGAAAGAGAGATAGAGG - Intronic
976587276 4:86812726-86812748 GAGAGAAGGAAGAGTGAAGGAGG + Intronic
976817011 4:89160490-89160512 GTGAGTACACAGTGAGAAGGTGG + Intergenic
977638587 4:99329535-99329557 GTGAGGATACAGAGGGAAGGTGG + Intergenic
977783930 4:101010814-101010836 GAGACAAGAGAGAGGAAAGGAGG + Intergenic
978282669 4:107036294-107036316 GAGAGCAGAGAGAGAGAAAGCGG - Exonic
978499961 4:109399074-109399096 GAGAAGAGAAAGAGGGAGGGAGG + Intergenic
978753719 4:112281715-112281737 GACAAAAGAAAGAGGGAAGGTGG - Intronic
978952216 4:114574373-114574395 GAGAGAAGAGAGAGGAAGGGAGG - Intergenic
979535673 4:121817852-121817874 GGGAGAAGAGAGAAGGAAGGGGG - Intronic
980001800 4:127497982-127498004 GAGAGTGGACCGGGGAAAGGTGG - Intergenic
980874625 4:138648509-138648531 GAGAGAAGAGTGAGTGAAGGAGG - Intergenic
981344224 4:143656649-143656671 GAGAGTAGGGAGAGGGGTGGCGG + Intronic
981439195 4:144763258-144763280 AAGAGTAGAGAGAGGGAGGACGG + Intergenic
981489946 4:145328460-145328482 GAGAAAAGAGAGAGGGAGGGAGG + Intergenic
981497524 4:145410895-145410917 GAGTGTAGAAAGAAGGTAGGAGG - Intergenic
981610453 4:146588547-146588569 GTCAAAAGACAGAGGGAAGGGGG + Intergenic
981817494 4:148847631-148847653 GGTACTAGCCAGAGGGAAGGTGG + Intergenic
981863580 4:149386259-149386281 GAGAGAAGAATGAGGGAAAGTGG + Intergenic
982013693 4:151131078-151131100 GAGAGGAAACATAGGGAAAGGGG - Intronic
982294135 4:153808947-153808969 TAGCACAGACAGAGGGAAGGAGG - Intergenic
983361353 4:166727145-166727167 GAAACAAGAGAGAGGGAAGGAGG + Intergenic
983387414 4:167082798-167082820 GAGAGAGGACAGAGGGAGGGAGG + Intronic
983699403 4:170573272-170573294 AGGAGTAGAGAGAGCGAAGGGGG + Intergenic
983849129 4:172558513-172558535 GTGAGGATACAGAGAGAAGGTGG + Intronic
983941640 4:173539026-173539048 GGTAGAAGAGAGAGGGAAGGTGG - Intergenic
984121824 4:175754942-175754964 GGGAGTAGACAGAGGGAGAGAGG - Intronic
984233143 4:177124242-177124264 GAGAGGAAAGAGAGGGAGGGAGG - Intergenic
984250473 4:177327100-177327122 GAGAGAAGAGAAAGAGAAGGGGG - Intronic
984614358 4:181879293-181879315 GAAAGTAGAGAGAGGGAGGGAGG + Intergenic
985477728 5:89216-89238 GTGTGTGGACAGAGGGGAGGAGG - Intergenic
985756646 5:1723446-1723468 GAGAGGAGAGAGAGGGAGTGAGG - Intergenic
985954411 5:3252592-3252614 GAGAGAAGCCAGTGGGGAGGAGG + Intergenic
986302011 5:6484748-6484770 GAGAGCAGAAACAGGGGAGGGGG - Intronic
986538120 5:8813976-8813998 GAGCGTGGAGAGAGGGAAGGTGG - Intergenic
986610864 5:9565694-9565716 GACAGTAGACAGGGGCAAGTGGG + Intergenic
986645180 5:9910324-9910346 TAGAGTAGACAGAGGCAGAGAGG + Intergenic
986692004 5:10320886-10320908 AGGAGAAGAGAGAGGGAAGGGGG + Intergenic
986902363 5:12452164-12452186 GTGAGGAGAGAGAGAGAAGGCGG + Intergenic
986937471 5:12907344-12907366 GACAGGAGAAAGAGTGAAGGAGG + Intergenic
987460081 5:18198433-18198455 GAGAGCAGCCACAGGGACGGAGG + Intergenic
987615426 5:20267942-20267964 GAGAGTGGGAAGAGGGAAGGAGG - Intronic
987910127 5:24132341-24132363 GAGAGAAGAAAGAAGAAAGGAGG + Intronic
987954676 5:24723090-24723112 CAGAGTAGTCATAGGGAAGAAGG - Intergenic
988059076 5:26143111-26143133 GAGAGAAGAAAGAGGAAAGAGGG + Intergenic
988101101 5:26680005-26680027 AAGAGGAGAAAGAGGGAGGGAGG - Intergenic
988514892 5:31895760-31895782 GGGAGCAGACAGAGGGAGGAAGG - Intronic
988526976 5:31995742-31995764 GAGAGGAGGCAGAGGGATGGGGG - Intronic
988578152 5:32445764-32445786 GCGAGGAAACAGAGGGAAAGAGG - Intergenic
988642679 5:33058665-33058687 GGGAGCAGACAGTGGGAATGGGG + Intergenic
989149600 5:38285771-38285793 GAGAGAAGAGAAAGTGAAGGGGG + Intronic
989758186 5:44981686-44981708 GAGGGTAGACAGAGGAGAGCTGG + Intergenic
990446201 5:55896608-55896630 GGGAGTGGGCAGGGGGAAGGTGG - Intronic
990822433 5:59857858-59857880 GAGAGCAGAAGGAAGGAAGGTGG + Intronic
990864081 5:60361209-60361231 CAGATCAGACATAGGGAAGGTGG - Intronic
990864156 5:60362211-60362233 CAGATCAGACATAGGGAAGGTGG - Intronic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
990995841 5:61731569-61731591 GAGAGAGGAGAGAGAGAAGGAGG + Intronic
991422016 5:66451755-66451777 GAGGAAAGAAAGAGGGAAGGAGG + Intergenic
991432433 5:66562357-66562379 AAGTGGAGACTGAGGGAAGGAGG - Intergenic
991492281 5:67195028-67195050 GAGAGGACACAGAGAGAAGATGG + Intronic
991733893 5:69614205-69614227 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
991810327 5:70469346-70469368 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
991860373 5:71007937-71007959 GAGAGAGGAGAGAGGGAAGAGGG + Intronic
991988197 5:72311314-72311336 GTGTGTATACAGGGGGAAGGAGG + Intronic
992003018 5:72453473-72453495 GGGAGTTGACAGAGGGATGGAGG - Intronic
992132442 5:73706817-73706839 GAGAGAAGAAAGCGGGGAGGAGG - Intronic
992602214 5:78413930-78413952 AAGAGAAGAGGGAGGGAAGGGGG - Intronic
992659605 5:78945463-78945485 GAGTAAAGGCAGAGGGAAGGTGG - Intronic
992733885 5:79699554-79699576 GAAAGTAGAAAGAGGGAAGTGGG + Intronic
993202855 5:84840223-84840245 GAGAGAAGGGAAAGGGAAGGGGG - Intergenic
993677959 5:90840156-90840178 GAGAGTAGAGAGAAGGCAGAGGG - Intronic
994126777 5:96176453-96176475 GAATGTAGACAGAATGAAGGTGG - Intergenic
995247014 5:109946066-109946088 CAGAGTAGACAGGGTGATGGAGG + Intergenic
995377073 5:111486550-111486572 AAGAGCAAAGAGAGGGAAGGGGG + Exonic
995838535 5:116421802-116421824 TAGAGCAGAAGGAGGGAAGGGGG + Intergenic
995858603 5:116618873-116618895 GGGAGTAGCCAGAGGGAAGGAGG + Intergenic
995888582 5:116923422-116923444 CAGGGCAGACAGTGGGAAGGAGG + Intergenic
996022233 5:118604066-118604088 GAGAATAGGCGGAGGAAAGGAGG - Intergenic
996387534 5:122925091-122925113 AAGGGAAGAGAGAGGGAAGGAGG - Intronic
996428944 5:123348847-123348869 GAGAGGACACAGTGAGAAGGTGG + Intronic
996709278 5:126528067-126528089 GTGAGCAGACAGTGGGGAGGTGG - Intergenic
996949789 5:129111695-129111717 AAGGGTAGAGAGAGGAAAGGAGG - Intronic
997091340 5:130862437-130862459 GAGAGAAGAGAAAGTGAAGGGGG + Intergenic
997091430 5:130863674-130863696 GAGAGAAGAGAAAGTGAAGGGGG + Intergenic
997636577 5:135411855-135411877 GAAAGTAGAAAGAAGGAAAGAGG - Intergenic
997898412 5:137740849-137740871 GACAGGAGACAGAGGTCAGGTGG + Intergenic
997963263 5:138338367-138338389 GGGAGGGGAAAGAGGGAAGGAGG - Intronic
998091527 5:139373679-139373701 GAGAGGGCACTGAGGGAAGGTGG + Intronic
998415499 5:141943414-141943436 GAGAGAAGAGAGTGGGCAGGGGG - Intergenic
998772900 5:145566484-145566506 GACAGTATAAAAAGGGAAGGAGG + Intronic
998870052 5:146542987-146543009 GAGAGCACACAGTTGGAAGGGGG + Intergenic
999092634 5:148950760-148950782 CAGAGTAGAGGGAAGGAAGGGGG - Intronic
999259331 5:150228293-150228315 GAAAGAAGCCAGAGGGAAGAGGG + Intronic
999357286 5:150947162-150947184 GAGGGGAGAAAGAGGGAAGTGGG + Intergenic
999486555 5:152002878-152002900 GGGGGTAGAGGGAGGGAAGGGGG - Intergenic
999758514 5:154682827-154682849 GGGAGGAGAAAGAGGAAAGGGGG - Intergenic
999875720 5:155803577-155803599 CAGAGAAGAGAGAGGGAAGCAGG + Intergenic
999966563 5:156816517-156816539 AAGAGGTGACAGAAGGAAGGGGG + Intergenic
1000434123 5:161186560-161186582 GAAAGAAGAGAGAGTGAAGGGGG + Intergenic
1000439562 5:161249662-161249684 GAGAGTAGAGACATGGAGGGAGG - Intergenic
1000643129 5:163729018-163729040 GAGGGTGGAGAGAGGGAAGAGGG - Intergenic
1000702251 5:164467076-164467098 GTGGGTAGTCAGCGGGAAGGAGG - Intergenic
1000774789 5:165406309-165406331 GAGGGTGGAGGGAGGGAAGGGGG - Intergenic
1000847240 5:166297025-166297047 GAGTGTAGACAGAGAAAAGATGG - Intergenic
1001220348 5:169895252-169895274 GAAAGGAGAAAGAAGGAAGGGGG - Intronic
1002079391 5:176728443-176728465 TCGAGTAGACAGAGGTAAGAGGG - Intergenic
1002212223 5:177605810-177605832 GAGGGGAGAGAAAGGGAAGGAGG - Intronic
1002577061 5:180179988-180180010 GCGAGTGGGCAGAGAGAAGGTGG + Intronic
1002924293 6:1595840-1595862 GAGAGAAGAGGGTGGGAAGGCGG - Intergenic
1002985543 6:2187594-2187616 GAAAGTAGGCAGAGTGATGGTGG - Intronic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003205160 6:4002353-4002375 GAAAGGAGACAGAGGGAAGGAGG - Intergenic
1003282400 6:4705330-4705352 GAGAGTAGAGTGAGTAAAGGAGG - Intergenic
1003445279 6:6178125-6178147 GGGGCTAGACTGAGGGAAGGAGG + Intronic
1003561664 6:7185622-7185644 AAGAGGAGTGAGAGGGAAGGTGG + Intronic
1003563673 6:7204312-7204334 GAGAGCAGACACAGAGAGGGAGG - Intronic
1003872204 6:10412419-10412441 GAGAGGGGAGGGAGGGAAGGAGG + Intronic
1003875746 6:10434751-10434773 GTGAGGACACAGAGAGAAGGTGG - Intergenic
1004043526 6:12006114-12006136 GTGAGGACACAGAGAGAAGGTGG + Intergenic
1004527623 6:16424135-16424157 TAAGGTAGACAGAGGGCAGGTGG + Intronic
1004548835 6:16626856-16626878 GAGAGGACACAGGGGGAAGATGG + Intronic
1004595355 6:17094349-17094371 GAGAGAAGACAGAGGGAAGGAGG + Intergenic
1004723267 6:18287700-18287722 AGGAGTAGCCAGAGGGTAGGAGG + Intergenic
1005454541 6:26006509-26006531 GAGTGTAGACACAGGAAAGAGGG - Intergenic
1006191777 6:32213875-32213897 GAGAGCGGAGGGAGGGAAGGAGG - Intronic
1006410349 6:33870109-33870131 GAGAGAGAACAGAGGGCAGGTGG + Intergenic
1006437825 6:34035393-34035415 GAGATGAGACAGAGAGAAAGGGG + Intronic
1006793224 6:36716969-36716991 GAGAGAAGAGAGAGGGCAGATGG + Intronic
1007226131 6:40316120-40316142 TAGAGGAGAGAGAGGGAAAGAGG - Intergenic
1007260878 6:40562248-40562270 GAGATTGGGCAGACGGAAGGAGG + Intronic
1007708538 6:43806411-43806433 GAGAGGAGTCAGAGGGAGGAAGG + Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1007941385 6:45784860-45784882 TTCAGTAGCCAGAGGGAAGGAGG - Intergenic
1007981721 6:46166212-46166234 GAGAGAGGAGGGAGGGAAGGAGG - Intronic
1008018418 6:46547654-46547676 GGGAGTGGACAGGGGGAGGGAGG + Intergenic
1008892546 6:56511845-56511867 GAGACAAGACGGGGGGAAGGAGG + Intronic
1008917114 6:56800173-56800195 CCGAGTAGACAAAGGGAAGAAGG + Intronic
1009778582 6:68238524-68238546 TTGAGTAGAGAGAAGGAAGGAGG + Intergenic
1010674195 6:78721711-78721733 GAGAGAAGAATGAGGGAAGTGGG - Intergenic
1011038971 6:83009960-83009982 GAGAGTAGACAAATGGAGGAGGG + Intronic
1011303542 6:85901827-85901849 GAGAGTAGGCAGAGTGAGGCAGG + Intergenic
1011531190 6:88322696-88322718 GTGAGGAGAAAGAGGGAAAGGGG + Intergenic
1011623091 6:89260903-89260925 GAGAGCAGACAGAGGTGAGAAGG - Intronic
1011645774 6:89456461-89456483 GTGAGAACACAGAGAGAAGGTGG - Intronic
1012530888 6:100234949-100234971 GAGAAGAAAGAGAGGGAAGGAGG + Intergenic
1012917300 6:105184039-105184061 GAGAGAAGAGAGAGAGAAGGAGG - Intergenic
1013309574 6:108880721-108880743 GAGAAGAGGGAGAGGGAAGGGGG - Intronic
1013456462 6:110334094-110334116 GAGAGAAAACAGAGGAAAGGGGG + Intronic
1013824558 6:114195738-114195760 GAGAGGAGAAAGAGGGAAAGTGG + Intronic
1014562225 6:122905216-122905238 GAGGATAGAGAAAGGGAAGGGGG - Intergenic
1014640098 6:123898892-123898914 GAGAGAAGACAGAGGCAGAGAGG - Intronic
1014688636 6:124533870-124533892 GTGAGGACACAGAGGGAAGATGG - Intronic
1014752095 6:125268189-125268211 GAGAGGAGACGGTGGGCAGGTGG - Intronic
1015091286 6:129362417-129362439 GAGAGAAGAGAGAGGGGAAGAGG - Intronic
1015313923 6:131795539-131795561 GACAGCAGAGAGAGTGAAGGGGG + Intergenic
1015469699 6:133590193-133590215 GAGAGTAAAGAAAGGGCAGGAGG + Intergenic
1015678057 6:135772474-135772496 AAGAGTAAACATAAGGAAGGTGG - Intergenic
1015863018 6:137700132-137700154 GGGAGTAAACAGCAGGAAGGAGG + Intergenic
1015866067 6:137728018-137728040 CAAAGCAGAAAGAGGGAAGGAGG + Intergenic
1015973549 6:138767042-138767064 GAGAAGAAAGAGAGGGAAGGAGG - Intronic
1016154188 6:140783278-140783300 GAGTGTAACAAGAGGGAAGGAGG + Intergenic
1016199626 6:141392841-141392863 AAGAGAAGAAAGAGAGAAGGAGG - Intergenic
1016317704 6:142808506-142808528 ATGAATAGACAGAGGGAAGGAGG + Intronic
1016767086 6:147806935-147806957 GAGAGGACACAGTGAGAAGGTGG + Intergenic
1016981714 6:149860744-149860766 GAGGGTAGAGGTAGGGAAGGCGG - Intronic
1017041871 6:150314437-150314459 GGGAGGAGGAAGAGGGAAGGAGG + Intergenic
1017327482 6:153155929-153155951 GAGGGTAGGCAAAGAGAAGGAGG - Intergenic
1017333227 6:153224000-153224022 GGGAGGACACAGAGAGAAGGTGG + Intergenic
1017346860 6:153393334-153393356 GAGAGATAACAGAGAGAAGGGGG - Intergenic
1017573919 6:155780230-155780252 TAGAGTTGACAGGGGGAAGTGGG - Intergenic
1017630556 6:156392622-156392644 GACACTAGACACCGGGAAGGGGG - Intergenic
1017685857 6:156913661-156913683 GAAAGTAGAGAGTGGGATGGGGG - Intronic
1018001603 6:159583535-159583557 GATACTACACAGATGGAAGGTGG + Intergenic
1018246812 6:161831800-161831822 GAGAGGAGGCAGAAGGAAGAGGG + Intronic
1018512242 6:164537576-164537598 GAGAGTGGAGAGTGGGAAGAGGG + Intergenic
1018885764 6:167935130-167935152 GAGAGGAGAGAGAAGAAAGGAGG - Intronic
1019169425 6:170123820-170123842 GAGAGAAGAAAGAGTGAATGAGG - Intergenic
1019635547 7:2073704-2073726 GAGGGTAGACAGAGGCATAGGGG + Intronic
1019716728 7:2542629-2542651 GAGAGTAGACCGGGGGAGGATGG - Intronic
1019896046 7:3984187-3984209 GAGAGGGGGCAGAGGGATGGAGG + Intronic
1019927736 7:4204515-4204537 GAGAGCAGAAAGTGGGGAGGGGG + Intronic
1020011337 7:4807484-4807506 GAGAGGAGACAGACAGAGGGAGG - Intronic
1020011352 7:4807534-4807556 GAGGGGAGACAGAGGGAGAGAGG - Intronic
1020080236 7:5282843-5282865 GAGAGGAGCGAGAGGGAAGAGGG + Intronic
1021089138 7:16461404-16461426 GAGAGGAGACAGAGGGAGACAGG - Intergenic
1021138971 7:16999792-16999814 GAGAGGAGAGAAAGGGAAAGGGG - Intergenic
1021584546 7:22193789-22193811 GAGAGAAAAGAGAGGGAGGGAGG + Intronic
1022089248 7:27096881-27096903 GAGCGACGAGAGAGGGAAGGTGG - Intergenic
1022251209 7:28610254-28610276 GGGAGGGGCCAGAGGGAAGGCGG + Intronic
1022438048 7:30408854-30408876 GACAGGAGACAGAGAGAGGGAGG - Intronic
1022536529 7:31102006-31102028 GAGAGGAGAAGGAAGGAAGGAGG - Intronic
1022569951 7:31442536-31442558 GAGAGGAGACGGAGGGACAGGGG + Intergenic
1022660053 7:32358523-32358545 GAGACTAGACAGCGGGCAAGTGG + Intergenic
1022956268 7:35384537-35384559 GAGAGAAGAAAGAGGAAAAGAGG + Intergenic
1023149056 7:37182581-37182603 GAGAGAAGAGAGAGAGGAGGGGG - Intronic
1023458805 7:40370604-40370626 GAGAGGAGAGAGAGAGATGGGGG + Intronic
1023607476 7:41943351-41943373 GAGTGTGGAGGGAGGGAAGGAGG + Intergenic
1023618572 7:42046722-42046744 GAGAATAGACTGAGGGAGAGAGG - Intronic
1023623554 7:42095586-42095608 GAGAAGAGAAAGATGGAAGGTGG + Intronic
1023837694 7:44077978-44078000 GAGCAGAAACAGAGGGAAGGTGG + Intronic
1023840547 7:44095061-44095083 GAGAGAAGAGAGAGGGAGAGAGG + Intergenic
1023921238 7:44631830-44631852 GAGAAAGGAAAGAGGGAAGGGGG - Intronic
1024047085 7:45592309-45592331 GTGAGGGCACAGAGGGAAGGCGG - Intronic
1024141721 7:46468877-46468899 GAGAATACAGAGAGGGAAGGAGG - Intergenic
1024263641 7:47590116-47590138 GAGAGATGACAGAGGGAAGGGGG - Intergenic
1024736762 7:52313389-52313411 GTGAGTACACAGTGAGAAGGTGG + Intergenic
1024816033 7:53272645-53272667 GATATTATACAGAGGAAAGGAGG + Intergenic
1024959715 7:54961187-54961209 GAGAGAGGACAGAGGGAGGGAGG + Intergenic
1024983942 7:55180019-55180041 GACAGGAGACAAAGGCAAGGTGG - Intronic
1025279803 7:57619067-57619089 CAGAGGAGACAGAGAGCAGGAGG - Intergenic
1025304929 7:57846434-57846456 CAGAGGAGACAGAGAGCAGGAGG + Intergenic
1025888711 7:65624408-65624430 GAGAGTACAATGAGGGAGGGAGG - Intergenic
1025945125 7:66099320-66099342 GGGAGTAGAAGGAGGGGAGGAGG + Intronic
1025945150 7:66099389-66099411 GAGAGGAGAAGGAGGGGAGGAGG + Intronic
1026112096 7:67466440-67466462 GAGAGAAGAAGGAGGGAGGGAGG - Intergenic
1026275413 7:68871851-68871873 GTGAGTAGATAGATGGATGGAGG - Intergenic
1026479128 7:70763466-70763488 GAGACTAGAGACAGGGAATGGGG + Intronic
1026672841 7:72404654-72404676 GAGAGTAGAAAGAGGGCAGAGGG - Intronic
1026769707 7:73187882-73187904 GAGTGGGGACAGAAGGAAGGCGG + Intergenic
1026837637 7:73649012-73649034 GAGAGGAGAGAGAGGGAAAGGGG - Intergenic
1026877983 7:73890622-73890644 GAGAGGAGACGGGAGGAAGGAGG - Intergenic
1026878192 7:73891770-73891792 GCTAGCAGACAGAGGGGAGGAGG - Intergenic
1027010575 7:74741264-74741286 GAGTGGGGACAGAAGGAAGGCGG + Intronic
1027077467 7:75204776-75204798 GAGTGGGGACAGAAGGAAGGCGG - Intergenic
1027465175 7:78506258-78506280 GAGATTGGAAACAGGGAAGGAGG + Intronic
1027481649 7:78705277-78705299 GAGAGAAGAGAGAGTGAAGGGGG - Intronic
1027543177 7:79493629-79493651 GAGAGGAGAGAGAGAGAAGAGGG - Intergenic
1027549094 7:79568332-79568354 GAGAGAAGACAGAGGCACAGGGG + Intergenic
1028009701 7:85625794-85625816 GAGAGCAGAGAGTGGGAAGAAGG + Intergenic
1028450586 7:90977758-90977780 CAGAATAGCCAGGGGGAAGGAGG + Intronic
1028455606 7:91035140-91035162 GAGGGTAGACAGGGAGAAGTGGG - Intronic
1028729606 7:94130739-94130761 CAGAGAAGACAGAGGGACAGAGG - Intergenic
1028751844 7:94391782-94391804 GAGAGTAGAGGGATGGAAGAAGG - Intergenic
1028962930 7:96769911-96769933 CAGAGTAGAGAGAGGTGAGGAGG - Intergenic
1029233984 7:99097273-99097295 GAGGGGAGAGAGAGGGAATGAGG + Intronic
1029412958 7:100427150-100427172 GAGAAGAGAGAGAGGGAGGGAGG - Intronic
1029643708 7:101837978-101838000 TAGAGTAGAATGAGGAAAGGGGG - Intronic
1029977959 7:104851952-104851974 GAAAGGAGACAGAAGGGAGGAGG - Intronic
1029991122 7:104963419-104963441 AAGAGGAGACAGAGGAAAGCAGG - Intergenic
1030128291 7:106176154-106176176 GAGAACAGAGGGAGGGAAGGGGG - Intergenic
1030677986 7:112404907-112404929 GTGAATGGAGAGAGGGAAGGAGG + Intergenic
1030944518 7:115700343-115700365 GAGAGGAGACAAGAGGAAGGCGG - Intergenic
1031045189 7:116879638-116879660 GACAGGAGACAGAGTGCAGGTGG + Intronic
1031484592 7:122311705-122311727 AAGAGGAGACAGTGGGAAGAGGG - Intergenic
1031562837 7:123258749-123258771 GAGAGGAGAATGAGGGAAGAAGG + Intergenic
1031681481 7:124680628-124680650 GAGAGGATAGAGTGGGAAGGGGG - Intergenic
1031853740 7:126897556-126897578 GAGAGTACAATGAGGGAGGGAGG + Intronic
1032275830 7:130454439-130454461 GAAAGTAGAGAGAAGGAAGATGG + Intergenic
1032362077 7:131265368-131265390 GAGAGAAGAAAGAAAGAAGGGGG - Intronic
1032626375 7:133595886-133595908 CAGAGAAGACAGAGGCAAGGTGG - Intronic
1032759428 7:134925591-134925613 GAGAGAAGAGTGAGCGAAGGAGG + Intronic
1032792410 7:135252270-135252292 GACAGGAGAGAGAGTGAAGGGGG + Intronic
1033354933 7:140591967-140591989 GAGAGGAGGGAGAGGGGAGGGGG - Intronic
1033460571 7:141543509-141543531 GAGAGTAGAGAGATGGGAAGAGG - Intergenic
1033641364 7:143265230-143265252 AAGAGAAGACAGCAGGAAGGCGG - Exonic
1033784352 7:144712876-144712898 TAAAGGAGAGAGAGGGAAGGAGG + Intronic
1033845088 7:145422000-145422022 GAGAGGAGACTAAGGGAAGGTGG - Intergenic
1034391588 7:150791693-150791715 GAAAGCAGAAAGAGGAAAGGAGG + Intronic
1034827067 7:154275292-154275314 GAGGGGACACAGAGGGAAGGAGG - Intronic
1034861284 7:154597165-154597187 GAGAGAAGACAGAGAGAGAGAGG + Intronic
1034878907 7:154749015-154749037 GACAGGAGAGAGAGGGATGGAGG + Intronic
1034985263 7:155509469-155509491 GAGAGGAGAGAGAGAGGAGGGGG + Intronic
1035058036 7:156049934-156049956 GATAGGAGACAGAGGGAAACAGG - Intergenic
1035582072 8:746800-746822 CAGAGCAGACAGAGGGAACCTGG - Intergenic
1035957686 8:4100381-4100403 CTGACTAGACACAGGGAAGGTGG - Intronic
1036188839 8:6650852-6650874 GAGAAGAGACAGAAGGAAGGAGG - Intergenic
1036546260 8:9772036-9772058 GAGAGGAGACAGAGGTAGGGAGG + Intronic
1037227397 8:16609600-16609622 GAGAGAAGAAAGAGAAAAGGGGG + Intergenic
1037467265 8:19172650-19172672 GAGAGGAGAGGGAGGGGAGGGGG + Intergenic
1037541179 8:19872925-19872947 GGCAGGAGACAGAGAGAAGGGGG + Intergenic
1037569631 8:20147558-20147580 AAGAGTAGACAGGGGAAAGTGGG + Intronic
1037588785 8:20295925-20295947 GAGGGAAGACAGCGTGAAGGAGG - Intronic
1037588788 8:20295944-20295966 GAGAGGGGAGAGAGGGAAGGAGG - Intronic
1037591736 8:20318073-20318095 GAGAGAAGGAAGAGGGAAGAGGG - Intergenic
1037753250 8:21696129-21696151 GAGAGGGGACAGAGGGAGAGGGG - Intronic
1037753260 8:21696159-21696181 GAGGGGAGAAAGAGGGAAAGGGG - Intronic
1037774376 8:21823273-21823295 GAAAGAAGAGAGAAGGAAGGAGG - Intergenic
1037776242 8:21837810-21837832 TAGGGTGGGCAGAGGGAAGGAGG - Intergenic
1038087690 8:24218025-24218047 GAGGGTGGAGAGATGGAAGGAGG + Intergenic
1038092757 8:24272359-24272381 CAGTGTAGTCAGAAGGAAGGTGG - Intergenic
1038117197 8:24570704-24570726 GAAAATAGAGAGAGGGAGGGAGG - Intergenic
1038152674 8:24956571-24956593 GACAGGGGAGAGAGGGAAGGGGG + Exonic
1038356425 8:26833103-26833125 GAGAGTAGGCAGAAGAAAAGAGG + Intronic
1038399989 8:27277356-27277378 GGGAGGAGAGAGAGGGGAGGGGG - Intergenic
1038450000 8:27633843-27633865 GAGAGGAGAAGGCGGGAAGGAGG + Intergenic
1038922504 8:32100123-32100145 GAGAGGAGGCAGAGGGAAGGAGG - Intronic
1039038443 8:33384485-33384507 TAGAGTAGGCAGAGGTATGGGGG - Intronic
1039436163 8:37560801-37560823 GAGAGTAGAAAGAGACAAAGAGG - Intergenic
1039574829 8:38614614-38614636 AAGAGTACACAGTGAGAAGGTGG + Intergenic
1040663584 8:49604216-49604238 GAGAGTAGGGAGGGGGAAGCAGG - Intergenic
1041256440 8:55983211-55983233 GAGGGCAGAGAAAGGGAAGGTGG - Intronic
1041392409 8:57358778-57358800 GAGAAGAAAGAGAGGGAAGGGGG - Intergenic
1041453371 8:58031841-58031863 GAGAGAAGAAAGAAGGAAGGAGG - Intronic
1041578881 8:59433741-59433763 GTGAGGACACAGAGAGAAGGTGG - Intergenic
1041654438 8:60335062-60335084 CAGAGGATGCAGAGGGAAGGGGG + Intergenic
1041682611 8:60608535-60608557 GAGAGAGGAGAGAGAGAAGGAGG - Intronic
1041750787 8:61258913-61258935 TAGAGTAAACAGAGAGGAGGAGG + Intronic
1042021311 8:64373230-64373252 GAGAGAACGCAGAGGGAGGGAGG + Intergenic
1042316884 8:67435049-67435071 GACAGTACAGAAAGGGAAGGGGG - Intronic
1042837592 8:73092445-73092467 GAGGGTTGACAGAATGAAGGTGG + Intronic
1042839302 8:73107822-73107844 GGGAGAGGAGAGAGGGAAGGAGG - Intronic
1043423312 8:80122811-80122833 TGGAGTACACAGAGGGAAGAAGG + Intronic
1043718051 8:83509639-83509661 GAGAGTAGAGACACGGAGGGAGG + Intergenic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1043823657 8:84899032-84899054 GTGAGTAGACTGAGGGATGTTGG + Intronic
1043960785 8:86416266-86416288 GTGTGAAGACAAAGGGAAGGAGG + Intronic
1044627190 8:94245578-94245600 GAGGGGACACAGAGGGAAGAAGG - Intergenic
1044925018 8:97202207-97202229 GGGAGTAGAAAGAGGAATGGAGG - Intergenic
1045035010 8:98170068-98170090 GAGACTTTATAGAGGGAAGGAGG + Intergenic
1045242636 8:100415972-100415994 GTGAGTAGACACAGGGAAAGTGG - Intergenic
1045723944 8:105148791-105148813 GATAGTGGACAGTGGGAAGGAGG - Intronic
1046117948 8:109806895-109806917 GCGAGTAGACACATGGATGGTGG + Intergenic
1046420613 8:113979093-113979115 GAAAGTAAACAGAAGGAAGTAGG - Intergenic
1046499562 8:115058526-115058548 GAGAGGAAACAGAGGGGAAGAGG - Intergenic
1046654535 8:116878655-116878677 GAGAGAAGACAGAGAGAGAGAGG - Intergenic
1046684807 8:117213311-117213333 GAGAGTGGACGGTGGGGAGGAGG + Intergenic
1046832412 8:118761202-118761224 GAGAGTACACAAAGTCAAGGTGG - Intergenic
1047518668 8:125577712-125577734 AAGAAGAGACAGAGGGAGGGAGG - Intergenic
1048507228 8:135032565-135032587 GAGGGTAGAGGGTGGGAAGGGGG - Intergenic
1048766125 8:137846346-137846368 GGGAGGAGGAAGAGGGAAGGAGG - Intergenic
1048825635 8:138423115-138423137 GAGGGTAGAGAGTGGGAGGGGGG + Intronic
1048838900 8:138547461-138547483 GAGAGGAGACAGAGGGAGACAGG - Intergenic
1049268716 8:141683011-141683033 GCGAGAAGAGGGAGGGAAGGAGG - Intergenic
1049346832 8:142143697-142143719 CAGAGGAGCCAGTGGGAAGGGGG - Intergenic
1049370289 8:142261121-142261143 GAGAGAGGAGGGAGGGAAGGAGG + Intronic
1049370331 8:142261272-142261294 GAGAGAGGATAGAGGGAGGGAGG + Intronic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049403374 8:142440807-142440829 CTGGGTAGACAGAGGGCAGGAGG - Intergenic
1049847150 8:144808352-144808374 GGGAGGACACAGAGGGCAGGCGG + Exonic
1050537885 9:6645784-6645806 GAAAGTAGACAGAGGGGGAGGGG + Intergenic
1051216450 9:14803191-14803213 GAAAGAAGAAAGAGGGAGGGAGG - Intronic
1051223866 9:14878396-14878418 GAGAGTAGAGAGGTGGAGGGAGG - Intronic
1051278354 9:15418083-15418105 GGGAGGAGACAGAAGGAAGAAGG - Intergenic
1052409560 9:28105776-28105798 GTGAGGACACAGAGAGAAGGTGG + Intronic
1052865696 9:33463528-33463550 GAGGGTGGTCAGATGGAAGGAGG - Intronic
1053308959 9:37003110-37003132 GAGAGGAGAAAGAGGGGAGCCGG + Intronic
1053480877 9:38415396-38415418 GGGAGGAGACAGAAGGCAGGAGG + Intronic
1053874351 9:42528284-42528306 GAGGGTAAAGAGAGAGAAGGAGG + Intergenic
1053898262 9:42766304-42766326 GAGGGTAAAGAGAGAGAAGGAGG - Intergenic
1054267984 9:62938470-62938492 GAGGGTAAAGAGAGAGAAGGAGG - Intergenic
1054828609 9:69598566-69598588 GATAGGAAGCAGAGGGAAGGTGG + Intronic
1055120323 9:72652535-72652557 GACAGTTACCAGAGGGAAGGTGG + Intronic
1055381323 9:75710098-75710120 GAGAGGAGAGGGAGGGAGGGAGG - Intergenic
1055892546 9:81138833-81138855 GAAAAGAGACAGAGGGAAGGAGG + Intergenic
1055934132 9:81589298-81589320 GAGAGAGGGCAGAGGGATGGGGG - Intronic
1056081774 9:83102616-83102638 GGCAGGAGACAGAGGGAACGAGG + Intergenic
1056201983 9:84285776-84285798 GATAGGAGACAGAGAAAAGGTGG + Intronic
1057202667 9:93151102-93151124 GGGAGTAGGGAGAGGGAGGGAGG + Intergenic
1057453538 9:95187361-95187383 GAGATGAGCCAGAGGGCAGGAGG - Intronic
1057474715 9:95388663-95388685 GAGATGAGCCAGAGGGCAGGAGG + Intergenic
1058156746 9:101524559-101524581 GAGAGTAGACAGAGGAGCAGGGG - Intronic
1058288452 9:103209099-103209121 CAGGGGAGACAGAGAGAAGGGGG + Intergenic
1058625602 9:106929958-106929980 GGGAGGAGTCAAAGGGAAGGAGG - Intronic
1058692613 9:107532273-107532295 AAGAGTACATAGAGGGGAGGTGG - Intergenic
1059206196 9:112468569-112468591 GAGAGGAGAAAAAGGGAAAGGGG - Intronic
1059361193 9:113743144-113743166 AAGACTTGAAAGAGGGAAGGAGG - Intergenic
1059510273 9:114838948-114838970 GACAAGAGAGAGAGGGAAGGGGG + Intergenic
1059679378 9:116571342-116571364 GTGAGAAGACCCAGGGAAGGAGG - Intronic
1059984139 9:119805545-119805567 TAGAGCAGACATAGGGAAGAAGG + Intergenic
1060335606 9:122718969-122718991 GAGAGTAGAAAGGGAGAAGCTGG + Intergenic
1060374413 9:123105803-123105825 CAGATTAGACAGAGAGCAGGTGG + Intergenic
1060494164 9:124105718-124105740 AAGGGGACACAGAGGGAAGGAGG - Intergenic
1060627492 9:125126966-125126988 GAGATTATACTGAGGGAAGAAGG + Intronic
1061142314 9:128775038-128775060 AAGAAGAGAGAGAGGGAAGGAGG + Intergenic
1061157905 9:128876090-128876112 AAGAGTAAAGGGAGGGAAGGTGG - Intronic
1061263248 9:129491405-129491427 AGGAGAAGACAGAGGGGAGGTGG + Intergenic
1061281933 9:129602549-129602571 AAGAGAAGAAAGCGGGAAGGAGG + Intergenic
1061454590 9:130688252-130688274 GTCAGGAGGCAGAGGGAAGGAGG + Intergenic
1062192823 9:135256479-135256501 GAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1062725583 9:138071595-138071617 GAGAGAAGCCAGGAGGAAGGGGG + Intronic
1203631183 Un_KI270750v1:73855-73877 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1185545416 X:939947-939969 GAGAGGAGATAGAGGGAGAGAGG - Intergenic
1185545757 X:942718-942740 GAGAGGAGATAGAGGGAGAGAGG + Intergenic
1185545792 X:943085-943107 GAGAGGAGATAGAGGGAGAGAGG + Intergenic
1185851075 X:3489279-3489301 GAGAGGAGGCAGAGGGAGAGAGG + Intergenic
1185851085 X:3489330-3489352 GAGAGGAGGCAGAGGGAGAGAGG + Intergenic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1186077582 X:5897906-5897928 GAGAGAGAAAAGAGGGAAGGGGG - Intronic
1186154074 X:6707644-6707666 GACAGGAGACAGAGGTCAGGTGG + Intergenic
1186176430 X:6930122-6930144 GAGAGAAGACAAAGACAAGGTGG + Intergenic
1186202833 X:7171348-7171370 GAGAGCTGAGAGAGGGCAGGTGG - Intergenic
1186344810 X:8681087-8681109 GAGAATAGACAAAGAAAAGGGGG - Intronic
1186400672 X:9256425-9256447 GAGGCTCGAGAGAGGGAAGGAGG + Intergenic
1186757288 X:12685348-12685370 GAGAGAAGAAAGAGGGAGGAAGG - Intronic
1187223840 X:17356417-17356439 GGTAGAGGACAGAGGGAAGGAGG + Intergenic
1187370883 X:18705103-18705125 AAAAGAAGAGAGAGGGAAGGAGG - Intronic
1187397185 X:18928813-18928835 GAGAGGAGGGAGAGGAAAGGTGG + Intronic
1187424559 X:19165366-19165388 ACAAGCAGACAGAGGGAAGGAGG + Intergenic
1187459908 X:19477790-19477812 GGGAGAAGAAAGAGGGAGGGAGG + Intronic
1187500375 X:19833716-19833738 GAGAGAAGACCCTGGGAAGGAGG - Intronic
1187531000 X:20096602-20096624 GAAAGTAGACTGGGGGGAGGTGG + Intronic
1187731287 X:22257766-22257788 AAGAAGAGAGAGAGGGAAGGAGG - Intergenic
1187887703 X:23905008-23905030 AGGAGTAGGCAGAGGAAAGGGGG - Intronic
1188651717 X:32638831-32638853 GAGAGTGGATAGAGAAAAGGAGG - Intronic
1189197146 X:39162252-39162274 GAGAGAAGAAGGAAGGAAGGTGG - Intergenic
1189271042 X:39752177-39752199 GTGAGGAAACAGAGAGAAGGTGG + Intergenic
1189570405 X:42289892-42289914 CAGAGGAGACAGAGAGAAAGAGG - Intergenic
1189571415 X:42301924-42301946 GAGAGGAGAAAGAGGGAGGAGGG - Intergenic
1189748382 X:44193704-44193726 GTGTGTAGACAGAGGGAGAGTGG + Intronic
1189818035 X:44843982-44844004 GAGAGGAGACAGAAAGAGGGTGG + Exonic
1190434182 X:50407427-50407449 AAGAGTACACAGTGAGAAGGTGG - Intronic
1190515896 X:51223289-51223311 GAGAGGAGAAGGAGGAAAGGAGG - Intergenic
1190707561 X:53043419-53043441 GAGAGAAGACAGGGGGAACAAGG - Intergenic
1190984773 X:55490184-55490206 GGGAGTTGACGGAGGGAGGGAGG + Intergenic
1191675230 X:63785687-63785709 GGGAGTATGCAGAGGGAGGGTGG - Intergenic
1191784825 X:64906073-64906095 GACAATAGACAGAGGGCAGTAGG - Intergenic
1192264755 X:69530611-69530633 GAGAGTGGAGATACGGAAGGGGG + Exonic
1193269737 X:79515291-79515313 GAGAGGACAGAGAAGGAAGGAGG - Intergenic
1193742982 X:85241274-85241296 GAGAGGAGAGAGAAGGAGGGCGG + Intergenic
1193941352 X:87683159-87683181 GGGAGTAGACTGAGGAATGGAGG - Intergenic
1194068118 X:89286841-89286863 GAGAGAAGAGTGAGTGAAGGAGG - Intergenic
1194599169 X:95899414-95899436 GTGAGGATACAGAGAGAAGGTGG - Intergenic
1194976130 X:100397957-100397979 GAGTGAAGAGAGAGGAAAGGAGG - Intronic
1195669086 X:107453918-107453940 GAAAGGAGAGAGAGGGAAAGAGG + Intergenic
1196738390 X:119001215-119001237 GAGAGAGGAGAGAGGGAGGGAGG + Intronic
1196770816 X:119291501-119291523 GACAGGAGAGAGAGTGAAGGGGG - Intergenic
1196968687 X:121085543-121085565 GAGAATAGTAAGGGGGAAGGGGG - Intergenic
1197347950 X:125346923-125346945 GAGAAGAGAGAGAGAGAAGGAGG + Intergenic
1197532498 X:127646899-127646921 GAGAGAAGAGAGAGGGAGAGGGG + Intergenic
1197611439 X:128643482-128643504 GAGAGTAGGGTGAGGGAATGAGG - Intergenic
1197816275 X:130501834-130501856 GGGAGAAGACAGATGGAAGAAGG - Intergenic
1197949809 X:131882174-131882196 GAGGATAGCCAGAGGTAAGGTGG + Intergenic
1197979902 X:132206185-132206207 AAGAGAAGAAAGAGGGAGGGAGG + Intronic
1199052387 X:143252183-143252205 GATAGTAGAAAATGGGAAGGAGG - Intergenic
1199286440 X:146059709-146059731 GGTAGAAGACAAAGGGAAGGAGG - Intergenic
1199493961 X:148432357-148432379 GAGAGTAGACAAAGGAAATTAGG - Intergenic
1199637531 X:149827236-149827258 GAGAGGAAAGAGAGGGAGGGGGG + Intergenic
1199662271 X:150063812-150063834 GAGAGTAGCCGGAGCAAAGGAGG - Intergenic
1199706604 X:150431558-150431580 GAGGGTGGACGGAGGGAAGAGGG - Intronic
1200268710 X:154661271-154661293 GAGAGAAGAGAGAGTGAAGGAGG - Intergenic
1200722264 Y:6621002-6621024 GAGAGAAGAGTGAGTGAAGGAGG - Intergenic
1201015945 Y:9601540-9601562 GAGAGTTGGCAGAAGGAATGGGG - Intergenic
1201256350 Y:12112007-12112029 GAGAAGAGAGGGAGGGAAGGGGG - Intergenic
1201422531 Y:13815392-13815414 GAGAATAGACAAAGAAAAGGAGG + Intergenic
1201711773 Y:17000540-17000562 GGAAGGAGATAGAGGGAAGGAGG - Intergenic
1201936933 Y:19419783-19419805 GAGAGTAGAGACATGGAGGGAGG - Intergenic