ID: 902365331

View in Genome Browser
Species Human (GRCh38)
Location 1:15969470-15969492
Sequence GCGGGCCATGCCACGGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902365317_902365331 17 Left 902365317 1:15969430-15969452 CCTACAAAACCGGTCCCTGGTGC 0: 3
1: 16
2: 31
3: 72
4: 108
Right 902365331 1:15969470-15969492 GCGGGCCATGCCACGGCTGGTGG 0: 1
1: 0
2: 1
3: 6
4: 133
902365322_902365331 3 Left 902365322 1:15969444-15969466 CCCTGGTGCCAAAAAGGTTGGGG 0: 887
1: 1622
2: 1379
3: 833
4: 583
Right 902365331 1:15969470-15969492 GCGGGCCATGCCACGGCTGGTGG 0: 1
1: 0
2: 1
3: 6
4: 133
902365327_902365331 -5 Left 902365327 1:15969452-15969474 CCAAAAAGGTTGGGGGCTGCGGG 0: 1
1: 3
2: 94
3: 607
4: 1176
Right 902365331 1:15969470-15969492 GCGGGCCATGCCACGGCTGGTGG 0: 1
1: 0
2: 1
3: 6
4: 133
902365319_902365331 8 Left 902365319 1:15969439-15969461 CCGGTCCCTGGTGCCAAAAAGGT 0: 583
1: 993
2: 866
3: 618
4: 415
Right 902365331 1:15969470-15969492 GCGGGCCATGCCACGGCTGGTGG 0: 1
1: 0
2: 1
3: 6
4: 133
902365324_902365331 2 Left 902365324 1:15969445-15969467 CCTGGTGCCAAAAAGGTTGGGGG 0: 46
1: 995
2: 1690
3: 1497
4: 961
Right 902365331 1:15969470-15969492 GCGGGCCATGCCACGGCTGGTGG 0: 1
1: 0
2: 1
3: 6
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902365331 Original CRISPR GCGGGCCATGCCACGGCTGG TGG Intronic