ID: 902365986

View in Genome Browser
Species Human (GRCh38)
Location 1:15974869-15974891
Sequence ATAAAGAAGCAGACTGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 923
Summary {0: 1, 1: 0, 2: 12, 3: 91, 4: 819}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902365986 Original CRISPR ATAAAGAAGCAGACTGGGCC GGG (reversed) Intronic
900838250 1:5023687-5023709 ACAAAGAAGAACACTTGGCCAGG + Intergenic
901257412 1:7842210-7842232 ATAAAGAATGAGGCTGGGCGCGG + Intronic
901585017 1:10282909-10282931 ATAAAGATGAAGTTTGGGCCGGG + Intronic
901693770 1:10991403-10991425 ATCAAGAAGCTGACAGGGGCCGG - Intergenic
902007488 1:13243876-13243898 AAAAAGAATCCAACTGGGCCAGG + Intergenic
902312262 1:15590206-15590228 ATAAAAATCCAGATTGGGCCAGG + Intronic
902365986 1:15974869-15974891 ATAAAGAAGCAGACTGGGCCGGG - Intronic
902390040 1:16098313-16098335 ATAACCAAGCAGGCTGGGCATGG + Intergenic
902737955 1:18413664-18413686 ACAAAGAAGCTGAGGGGGCCAGG - Intergenic
903124930 1:21241324-21241346 AAAAAGAAACAGACTGGGTGCGG - Intronic
903131167 1:21280360-21280382 ATAAAGAAACAGACTGGGGTGGG + Intronic
903393402 1:22981143-22981165 AGAAAAAAGAAGTCTGGGCCAGG + Intergenic
903410164 1:23136209-23136231 TTAAAGAAACAGACAGGGCCAGG + Intronic
903632790 1:24789225-24789247 ATATAGAAACAGGCTGGGCGAGG + Intronic
903905536 1:26683353-26683375 AGGAAGAAGCAGGCTGGGCATGG - Intergenic
903994375 1:27296682-27296704 ATCAATGAGAAGACTGGGCCAGG - Intronic
904662908 1:32098435-32098457 ATAAGAAAGCTCACTGGGCCAGG + Intronic
906177669 1:43789573-43789595 ATAAAGAAGTAGAATTGGCCAGG + Intronic
906363241 1:45182119-45182141 TAAAAGACACAGACTGGGCCGGG + Intronic
906406910 1:45549478-45549500 AAAAACAATCAGACTTGGCCGGG - Intergenic
906557082 1:46722368-46722390 ATGAAGCAGAAGACTGGGCTAGG - Intergenic
907644229 1:56225367-56225389 GTTAAGAAGCTGACTGAGCCGGG - Intergenic
908114729 1:60929565-60929587 AGAAAGAAGAGGACAGGGCCGGG - Intronic
908463876 1:64372590-64372612 ATAAATAAGCAGAATGGGCTGGG + Intergenic
908519975 1:64932117-64932139 ATAAATAAGAAATCTGGGCCAGG + Intronic
908737723 1:67293270-67293292 AGAAAGATGCAGAGGGGGCCAGG - Intergenic
908909016 1:69050923-69050945 AAAGGGAAACAGACTGGGCCAGG - Intergenic
909034000 1:70576408-70576430 ATAAAAAAATAAACTGGGCCAGG + Intergenic
909654436 1:78014894-78014916 ATAATAGAGCAAACTGGGCCAGG - Intronic
910187267 1:84557563-84557585 AAAAAGAAGGAGGCTGGGCGCGG + Intronic
910358845 1:86395136-86395158 TTAAAGAAACAAACCGGGCCGGG - Intronic
910501035 1:87890882-87890904 ATATAGAAGCTGGCTGGGCTCGG + Intergenic
910921826 1:92356728-92356750 ATAAAAAAGGAAAATGGGCCAGG - Intronic
910939832 1:92521256-92521278 AAAAAGAAGCAGTCTTGGCTGGG - Intronic
910965787 1:92806774-92806796 ATGAAAAAGCAGGCTGGGCTTGG + Intergenic
911122795 1:94312736-94312758 TTAAAGAAGAAGACGGGGCCAGG - Intergenic
912499301 1:110111451-110111473 ATAAAGATGCAGGTTCGGCCAGG + Intergenic
912812210 1:112803011-112803033 ACAAAGAAGCAGGCAGGGGCAGG - Intergenic
913160478 1:116140664-116140686 ATAATAAAGCAGGCTGGGCGCGG + Intergenic
913578344 1:120199822-120199844 TTTAAGAAGCAGACTTGGCTGGG - Intergenic
913629828 1:120698529-120698551 TTTAAGAAGCAGACTTGGCTGGG + Intergenic
914813148 1:151044278-151044300 ATAAAGAAGCTGAAGTGGCCGGG - Intronic
914936638 1:151987293-151987315 AAAAAGAGGAACACTGGGCCGGG - Intronic
915214944 1:154333923-154333945 ATAATGAAGCAGGCCGGGCGCGG - Intronic
915256481 1:154634626-154634648 ATAAAGAATCATAATAGGCCAGG - Intergenic
915377842 1:155413308-155413330 ACAAAGAAGGAGCATGGGCCAGG + Intronic
915599709 1:156914522-156914544 AAAGAGAAGCAGATGGGGCCTGG - Intronic
915918447 1:159956173-159956195 ACAAAGAAGGAGGCTGGGCAAGG + Intergenic
915961478 1:160270440-160270462 ATAAAAAGGCAGTCTGGGCCGGG - Intergenic
916099436 1:161381496-161381518 ACAAAAAAGCACACTTGGCCAGG - Intergenic
916288786 1:163140466-163140488 ATAAAGAAAAAGTCTAGGCCGGG - Intronic
916303416 1:163301626-163301648 ATAAAGACTCATTCTGGGCCTGG - Intronic
916525184 1:165602905-165602927 AAAATGAAGGGGACTGGGCCAGG + Intergenic
916658846 1:166902148-166902170 AGAAAGAAACTGGCTGGGCCTGG - Intergenic
916788654 1:168105276-168105298 TTAAACAAGCAGGCTGGGGCAGG + Intronic
916858022 1:168771448-168771470 ATAAAGTAGCAGAGAGGGCTGGG - Intergenic
917023152 1:170612490-170612512 ATTAAGACACAGACTGGGCCGGG - Intergenic
917029044 1:170669564-170669586 ATAAAAAATCAGACTGGTCTAGG - Intronic
917118625 1:171626370-171626392 AAAAGGAAACAGACTGGGCATGG - Intergenic
917626965 1:176856038-176856060 TTAAAGAACCAGCCTGTGCCAGG + Intergenic
917965281 1:180174867-180174889 ATGAAGAAACAGGCTCGGCCAGG + Intronic
918318099 1:183340051-183340073 TTAAAGAAGGTGACTGGACCAGG - Intronic
918515708 1:185360311-185360333 AGAAAGAACCAAACTGGGCTGGG + Intergenic
919654405 1:200183382-200183404 TAAAAGAAGCAGGCTGGGCATGG + Intergenic
919891010 1:201974612-201974634 ATAAAAAGGCAGCATGGGCCGGG - Intergenic
920620302 1:207539758-207539780 ATTAAGAAGCAAAGTGGGCCAGG + Intronic
920622084 1:207558315-207558337 ATTAAGAAGCAAAGTGGGCCAGG + Intronic
920623699 1:207575373-207575395 ATTAAGAAGCAATGTGGGCCAGG + Intronic
921077268 1:211710067-211710089 TTAAAGAAGCAGTTTAGGCCGGG - Intergenic
921115688 1:212088794-212088816 AGAAAGAAGCTGGCTGGGCACGG + Intronic
921204755 1:212838996-212839018 ATAAAGCAGTGGGCTGGGCCTGG - Intronic
921860220 1:220035440-220035462 ACAAATTAGCAGACTGGGCGTGG - Intronic
921862790 1:220056716-220056738 ATACAGAAGCAGGCTGAGCGTGG + Intergenic
922009211 1:221564287-221564309 ATAAAGAAGCAGCCTTGGCCGGG + Intergenic
922248564 1:223825055-223825077 ATAAAGCAGAAGAATGGGCTAGG - Intronic
922384983 1:225073462-225073484 TTAAAGAAGCAGTCTGGCCATGG + Intronic
922402667 1:225276600-225276622 ATAGAAAAGCAACCTGGGCCAGG + Intronic
922442058 1:225664093-225664115 AAAAACAAACAGACTGGGCATGG + Intergenic
922621223 1:226989739-226989761 ATAAAGAAGCAGCCTGGATGAGG + Intergenic
922893420 1:229079753-229079775 ATCAAAAAGCTGACTGGGCTTGG - Intergenic
923575616 1:235156156-235156178 ATATAAAAGGAGACTGGGCGCGG - Intronic
923655638 1:235913793-235913815 AGAAAGTAGCAAATTGGGCCAGG + Intergenic
923694432 1:236233319-236233341 AAAAAGAAGAAGGCTGGGCACGG + Intronic
923742616 1:236669467-236669489 ATAAATAAAAAGACTCGGCCAGG - Intergenic
923861878 1:237899668-237899690 TTAAAGAACCTAACTGGGCCGGG + Intergenic
924225917 1:241921529-241921551 ATAAAGAAACAGCATGGGCCAGG + Intergenic
924322285 1:242862215-242862237 ATCAAGAAGTAGACCAGGCCGGG + Intergenic
924396360 1:243625426-243625448 AAAATACAGCAGACTGGGCCAGG - Intronic
924861542 1:247928797-247928819 CTAAAGAAACAGGATGGGCCGGG + Intergenic
1063299068 10:4835528-4835550 AGAAAGGTGAAGACTGGGCCTGG + Intronic
1063585978 10:7352713-7352735 ATAAATAAGTACACTGGGGCCGG + Intronic
1063591048 10:7395937-7395959 ATTAAAAGGCTGACTGGGCCAGG + Intronic
1065431781 10:25665606-25665628 AAAAAAAAGCAGGCTGGGCATGG - Intergenic
1065485485 10:26232791-26232813 ATGAAGAAGTAGTCTGGGCGTGG - Intronic
1065707952 10:28488444-28488466 AAAAAGAAAAAGACTGGGGCTGG + Intergenic
1065721169 10:28629836-28629858 AAAAATACGCAGAGTGGGCCGGG - Intergenic
1065791128 10:29261958-29261980 ATAAATAAACAGGCTGGGCATGG - Intergenic
1065832391 10:29626732-29626754 ATAAAGAATCAGGCTGGGCGCGG + Intronic
1065904756 10:30240447-30240469 AAAAAGAAAAAGACTGGGCGTGG + Intergenic
1066230944 10:33432632-33432654 AAAAAGAAGCAGCCTTGGCCGGG + Intergenic
1066563623 10:36696502-36696524 TTAAAGAAACAGTCAGGGCCAGG - Intergenic
1067057479 10:43060703-43060725 CTAGAGAAGCAGAGTGGGGCAGG + Intergenic
1067370285 10:45676281-45676303 AAAAATAAGCAGATTTGGCCGGG + Intergenic
1067404774 10:46011568-46011590 GTAAATATGCAGACAGGGCCGGG - Intronic
1067832537 10:49618535-49618557 AGAAAGAAGCAGAGTGGACATGG + Intronic
1067983535 10:51115547-51115569 ATAAAGAAGAAGGCTGGGTGTGG + Intronic
1068080246 10:52310564-52310586 ATACAGCAGTAGACTGGGCGCGG + Intergenic
1068350935 10:55844431-55844453 AAAAAGTAGCAAACTAGGCCAGG + Intergenic
1068672794 10:59741086-59741108 ATAAAGAAATAGGCTGGGACTGG - Intergenic
1068939180 10:62664177-62664199 GTTAAGAAGCAGACTGTGCAGGG + Intronic
1069541084 10:69294424-69294446 ATAAAAAAGCAGAATCTGCCAGG + Intronic
1069795322 10:71048181-71048203 AAAATTAAGAAGACTGGGCCAGG + Intergenic
1070189054 10:74094628-74094650 ATCAAGAAGCAGACCAGGCATGG + Intronic
1070228584 10:74539321-74539343 TTAAAGAATTAGACTTGGCCAGG - Intronic
1071214396 10:83382968-83382990 ATTCAGAAGCAGGCTGGGCACGG + Intergenic
1071947865 10:90668342-90668364 AGAGAGAAGCTGAGTGGGCCTGG + Intergenic
1072629090 10:97133255-97133277 AAAAAGATACACACTGGGCCAGG + Intronic
1072698414 10:97621582-97621604 ATTAAGAGGCAGAGTTGGCCGGG + Intronic
1072838591 10:98744230-98744252 AGAAAGCAGCAGACAGGGCTGGG + Intronic
1072953560 10:99869704-99869726 CTAAAGAAGCAGTCTGGCCATGG + Intergenic
1073005823 10:100323562-100323584 ATAAAGATACAGAGTGAGCCGGG - Intronic
1073276720 10:102318185-102318207 ATAAATAAATAGACTGGGCATGG - Intronic
1073485484 10:103815593-103815615 AGAAAGAAAAATACTGGGCCAGG + Intronic
1073712599 10:106061640-106061662 TTAAAAAAGAAGACAGGGCCAGG + Intergenic
1074072392 10:110085807-110085829 ATTAAGAAACAGACTTGGGCCGG + Intronic
1074115002 10:110449918-110449940 ATTAAGAAGGAAATTGGGCCGGG + Intergenic
1074538988 10:114349426-114349448 AGAAAAAAGAAGACTGAGCCAGG + Intronic
1075397355 10:122137290-122137312 AAAAAAAAGCAGAATGAGCCTGG + Intronic
1075762971 10:124870635-124870657 AAAAAGAAAGAGACTGGGCATGG + Intergenic
1075807865 10:125203005-125203027 AAAAAGAATCAGGCTGGGCACGG + Intergenic
1076472684 10:130729752-130729774 ATAAAGAGGCAGTCTGGGCGTGG - Intergenic
1077604252 11:3597191-3597213 ATAAAGATACAGCATGGGCCGGG + Intergenic
1078130652 11:8611565-8611587 AATAAGAAGCAGGCTGGGCGTGG + Intergenic
1078549183 11:12268693-12268715 ATAAAGAGGCCAACTCGGCCGGG + Intergenic
1079253676 11:18807997-18808019 AAAAAGAACAAGGCTGGGCCAGG - Intergenic
1079750838 11:24194797-24194819 AAAAAAAAGGAGACTGGGCATGG + Intergenic
1080469442 11:32530728-32530750 ATCTGGAAGCAGGCTGGGCCAGG - Intergenic
1080541041 11:33265788-33265810 AAAAAAAAGCAAAATGGGCCGGG + Intronic
1080558622 11:33440423-33440445 ATAAAGAAACAAAATAGGCCGGG - Intergenic
1080855982 11:36111890-36111912 AAGATGAACCAGACTGGGCCGGG - Intronic
1081128454 11:39347671-39347693 ATAAATACACAGGCTGGGCCAGG + Intergenic
1081903327 11:46648481-46648503 ATAAAGAAACAACCTTGGCCGGG + Intronic
1082016328 11:47491151-47491173 ATAAAGAAATAGGCTGGGCACGG - Intronic
1082101291 11:48175447-48175469 AAAAAGAAGCAAACTGTGCTAGG + Intergenic
1082757965 11:57096766-57096788 ATAAAGATGGGGTCTGGGCCGGG - Intergenic
1083015748 11:59452108-59452130 AAAAAGAAACAGACTGGGTGTGG - Intergenic
1083182357 11:60995433-60995455 AGAAAGATGCGGGCTGGGCCTGG - Intronic
1083354775 11:62058088-62058110 ATAAAGAATAAAACAGGGCCGGG - Intergenic
1083440912 11:62675948-62675970 ATAAAGCAGCAGGCCGGGCGTGG + Intergenic
1083692232 11:64416667-64416689 ATAAAGAATGAGGCTGGGCGCGG + Intergenic
1083987940 11:66229077-66229099 CTAAAGAATCAGACTTGGCCAGG + Intronic
1084268711 11:68017956-68017978 AGCAAGAAGCAGAGTGGGCAAGG - Intronic
1084314092 11:68333945-68333967 TTAAAGAAGCAGACCAGGCGCGG + Intronic
1084956681 11:72695335-72695357 CTAGAGAATCAGGCTGGGCCAGG - Intronic
1085187593 11:74589556-74589578 ATAAATAAACAGGCTGGGCACGG + Intronic
1085273660 11:75284606-75284628 ATAGAGAGGCAAAATGGGCCGGG + Intronic
1085544241 11:77302110-77302132 ATAAAGAGGTAGCCTGGGCGTGG - Intergenic
1085562195 11:77482282-77482304 ATAAAGAAGCAAAATAGGCCGGG - Intergenic
1085577935 11:77623971-77623993 ATAAAGATGCAGGCCAGGCCCGG + Intronic
1085652190 11:78278358-78278380 AAAAAAAAGCAGACTGGGCACGG - Intronic
1085920182 11:80945042-80945064 ATCAAGCAACAGACTGGGCCAGG - Intergenic
1086040817 11:82476054-82476076 ATAAAAGAGCAGGCTGGGCAGGG - Intergenic
1086259075 11:84916053-84916075 ATTAAGAAGCAGGCCGGGCGCGG + Intronic
1086478188 11:87202740-87202762 AAAAAAAAGCAGACCGGGCACGG + Intronic
1088213471 11:107481943-107481965 ACAAAGATGCAGACTGAGCCTGG + Intergenic
1088291845 11:108247452-108247474 AAAAAGAAACAGACTGGGCTTGG - Intronic
1089200210 11:116720252-116720274 ATCAATAAGGAGACTGGGCTTGG - Intergenic
1089485178 11:118839968-118839990 ATAAACATGCAGGCTGGGCGCGG + Intergenic
1089877402 11:121738219-121738241 AGAAAAAGGAAGACTGGGCCGGG - Intergenic
1090409629 11:126498868-126498890 TTAAAGAAGCTGTGTGGGCCAGG + Intronic
1090792865 11:130106980-130107002 ATAAAAAAGGAATCTGGGCCGGG - Intronic
1090830624 11:130418577-130418599 CTGAAGGAGCAGACAGGGCCTGG + Intronic
1092043094 12:5402915-5402937 TTAAAGTTGCAGACTGAGCCAGG + Intergenic
1092076325 12:5676761-5676783 AGAAGGAAACAGGCTGGGCCCGG + Intronic
1092493386 12:8967429-8967451 ATTAATAACCAGGCTGGGCCAGG + Intronic
1092877929 12:12864699-12864721 ATAAGGAATGAGACTGGGCCGGG + Intergenic
1094497011 12:30994895-30994917 AGAAGGAAGAAAACTGGGCCGGG + Exonic
1095203748 12:39415550-39415572 TTAAAGAAGCATTCTCGGCCGGG - Intronic
1095565463 12:43618200-43618222 ATAAAGAAGGAGGCCGGGCGCGG - Intergenic
1095864010 12:46951710-46951732 ATAAAGAATGAGGCTGGGCGTGG + Intergenic
1096062570 12:48714201-48714223 CTAAAGAAGTAGATTAGGCCGGG - Intronic
1096100418 12:48967593-48967615 ATATAAAAACAGACTGGGCCGGG - Intronic
1096126415 12:49123076-49123098 ATAAAGAATCTGGCTGGGCCAGG + Intergenic
1096130352 12:49154119-49154141 ATAAAAAAGTAGAGAGGGCCAGG - Intergenic
1096168830 12:49449507-49449529 TTAAAAACCCAGACTGGGCCAGG - Intronic
1096305863 12:50474640-50474662 CAAAAGAAACAGAATGGGCCAGG - Intronic
1096362885 12:51003245-51003267 ACAAAAAAGCAGGCTGGGCACGG + Intronic
1096366591 12:51033411-51033433 AGAAAGAAAGAGACAGGGCCTGG - Intergenic
1096489357 12:52005328-52005350 CTAGAGAAGAAGACTGAGCCAGG + Intergenic
1096855905 12:54482699-54482721 AAAAATGAGCAGAGTGGGCCGGG + Intergenic
1097353028 12:58569974-58569996 ATCAAGAAACAGACTTGGCCAGG + Intronic
1098643103 12:72862610-72862632 AAATATAAGCAGACTTGGCCTGG - Intergenic
1099548693 12:84015832-84015854 AAAAAGAAACAAACTAGGCCAGG + Intergenic
1099610655 12:84864613-84864635 ATAGAGATTAAGACTGGGCCAGG - Intronic
1099976750 12:89553782-89553804 TTAAAGAACAAGAATGGGCCAGG + Intergenic
1100320099 12:93482879-93482901 AAAAAGAACCAGATTGGGCAAGG - Intronic
1100552998 12:95664346-95664368 ATAAATAAATAGACTGGGCATGG - Intronic
1101606302 12:106249163-106249185 AGAAAGAAGCAGACTGAGTGAGG - Intronic
1102085204 12:110131641-110131663 ATAAAGTAGTTGAATGGGCCAGG - Intronic
1102128636 12:110506481-110506503 ATAAATGAACAGACTTGGCCAGG - Intronic
1103650888 12:122431694-122431716 AAAATCAAGCAGACTTGGCCAGG + Intergenic
1103746454 12:123127897-123127919 AAAAAGAGGCAGGCTGGGCGCGG - Intronic
1104322573 12:127765559-127765581 ATAAAAAAGTAAACTGGGCTGGG - Intergenic
1104610251 12:130221653-130221675 ATAAGGAAAAAAACTGGGCCAGG - Intergenic
1104849713 12:131866538-131866560 AGAAAGTAGTTGACTGGGCCTGG + Intergenic
1105389995 13:19966729-19966751 AAAAACAAGCAGGCTGGGCGCGG - Intronic
1105493781 13:20912359-20912381 AAAAAAAAGAAGGCTGGGCCTGG + Intergenic
1105720053 13:23104106-23104128 ATAATGATGCAGGCTGGGCACGG - Intergenic
1105723728 13:23141104-23141126 ATAAAGAACCAAATAGGGCCGGG + Intergenic
1106025282 13:25950093-25950115 AAAAATAAGCAGTCTGGGCTGGG - Intronic
1106031848 13:26011641-26011663 AGAAATAAACAGACTGGGCATGG + Intronic
1106207122 13:27609449-27609471 AAAAAGAATCACTCTGGGCCAGG - Intronic
1106313113 13:28570934-28570956 ATAAAGAATCTGGCTGGGCACGG - Intergenic
1106505402 13:30366799-30366821 ATCAAGAAGCATTCTTGGCCAGG - Intergenic
1106726637 13:32493213-32493235 AAAAAGAAAGAGACTGGGCACGG - Intronic
1107055895 13:36103103-36103125 TTAAAGAAAAAGACAGGGCCAGG + Intronic
1107130436 13:36888462-36888484 ATAAAGAAACAGCCTGAGACTGG - Intronic
1107443394 13:40448366-40448388 ATAACGAGGCAGACTGTTCCAGG - Intergenic
1108150736 13:47531289-47531311 AGAAAAAAGCAGCTTGGGCCTGG + Intergenic
1108190211 13:47930622-47930644 ATAAATGAGCAAACTGGGCATGG + Intergenic
1108355595 13:49626309-49626331 AAAAAGAAGCAGGCTGGGACAGG - Intergenic
1108562457 13:51659215-51659237 ATAAATAAGCAGGCTGTGCGCGG - Intronic
1108604926 13:52027965-52027987 ATAAAGCAGCAGGCTGGGTGTGG + Intronic
1108823007 13:54376723-54376745 ATAAAAAATCAGGCTGGGCATGG + Intergenic
1109109935 13:58303945-58303967 GTCAAGAAGCAGAGTTGGCCGGG + Intergenic
1109299833 13:60579649-60579671 AAAAAAAATTAGACTGGGCCGGG + Intergenic
1109799512 13:67358009-67358031 ATAAAGAAACAGGCCGGGCGCGG - Intergenic
1109839714 13:67905657-67905679 ATAAGGATGCAGCATGGGCCAGG - Intergenic
1109991927 13:70069871-70069893 AGAAAGAAGCAGATGAGGCCGGG + Intronic
1111911413 13:94316420-94316442 ATAAAGAAACAGAATGGGCCGGG + Intronic
1112123867 13:96443233-96443255 TTAAAAAAGCAGACTAGGCCGGG + Intronic
1112417547 13:99216398-99216420 AAAAATAAACACACTGGGCCGGG - Intronic
1112547588 13:100386674-100386696 ATAAAGCAGCACACAGGGCTGGG - Intronic
1113453177 13:110427443-110427465 ATAAAGAAACAAACTTGGCTGGG - Intronic
1113531181 13:111028730-111028752 TTTAAGAAGCAGGCTGGGCGCGG + Intergenic
1113581014 13:111429121-111429143 AGAATGAAAAAGACTGGGCCGGG - Intergenic
1113928169 13:113952571-113952593 AAACTGAGGCAGACTGGGCCTGG + Intergenic
1114272326 14:21108813-21108835 ATAAAGAATAAGAGTGGGCCGGG - Intergenic
1114520464 14:23331139-23331161 ATAAAAAGGAATACTGGGCCAGG - Intergenic
1114612704 14:24052771-24052793 AGAAGGAAGCAGGCTGGGACGGG - Intronic
1114701523 14:24683259-24683281 ATAAAGAGACAGACTGAGCCTGG - Intergenic
1114709892 14:24767586-24767608 AAAAAAAAGGAGACTGGGCTAGG - Intergenic
1115691380 14:35847508-35847530 ATAAAGAAGGAAACTCAGCCTGG - Intronic
1116020399 14:39453558-39453580 ATAAAAAATCAGCCAGGGCCGGG - Intergenic
1116217860 14:42043587-42043609 TAAAAAAAGCAAACTGGGCCAGG - Intergenic
1116237063 14:42292683-42292705 ATAAAGAATAAGATTAGGCCAGG + Intergenic
1117130560 14:52682601-52682623 AGAAAGACACAGACTGGGCCGGG + Intronic
1117344058 14:54815625-54815647 ATCAGGAAGCAGGATGGGCCTGG - Intergenic
1117392835 14:55278975-55278997 ATAAAGAAACAGGGTGGGCATGG - Intronic
1117488877 14:56226259-56226281 ATGGAGAAGCAGCCTGGGCCTGG - Intronic
1117669372 14:58090918-58090940 AGAAAGAAGCACAGTGGGCCAGG + Intronic
1118559303 14:67061329-67061351 ATAAAGACCTAAACTGGGCCAGG - Intronic
1118938981 14:70315208-70315230 ATCAAGGAGCAGGCTTGGCCTGG - Intergenic
1120620877 14:86763112-86763134 ATAAAGAAGCACATGGGGGCCGG + Intergenic
1120757607 14:88258582-88258604 AGAAAGAAGAAGACGCGGCCGGG - Intronic
1121398723 14:93652553-93652575 ACAAAAACTCAGACTGGGCCAGG - Intronic
1122231360 14:100307596-100307618 CTAAAGAAGGAAGCTGGGCCCGG - Intergenic
1122605718 14:102946316-102946338 GTTAAGAAGCAGACGAGGCCGGG - Intronic
1122621991 14:103064066-103064088 ATAAAGAAACAAAATAGGCCAGG + Intergenic
1123583397 15:21736723-21736745 CTAAAGAAGCATTCTGAGCCAGG - Intergenic
1123620047 15:22179320-22179342 CTAAAGAAGCATTCTGAGCCAGG - Intergenic
1124345241 15:28917922-28917944 AGAAAGGAGCAGAATGGGGCGGG - Intronic
1124521293 15:30408221-30408243 ATATAGAAGGAGAGAGGGCCCGG - Exonic
1124537369 15:30557996-30558018 ATATAGAAGGAGAGAGGGCCCGG + Exonic
1124761286 15:32449591-32449613 ATATAGAAGGAGAGAGGGCCCGG - Exonic
1124777348 15:32599472-32599494 ATATAGAAGGAGAGAGGGCCCGG + Exonic
1124991040 15:34674015-34674037 ATAAAGCAGAAGACAGGGCTTGG - Intergenic
1125106890 15:35982153-35982175 AAAATGAAGCAGTCTGGGTCCGG + Intergenic
1125564575 15:40666688-40666710 ATAACAAATCAGACTGAGCCTGG + Intergenic
1125818913 15:42610840-42610862 AGAAAGAATCAGTTTGGGCCAGG - Intronic
1125843181 15:42824949-42824971 ATAAAAAAGCAGAGGAGGCCAGG + Intronic
1126034409 15:44533749-44533771 AAAAAGAAGAAGGCTGGGCGCGG - Intergenic
1126153314 15:45542448-45542470 AAAATGAAGTAGGCTGGGCCCGG - Intergenic
1126228995 15:46303520-46303542 ATAATGAAGAAAACTGGACCTGG + Intergenic
1126287350 15:47028177-47028199 AGAAAGAATCAAACTGGGCTGGG + Intergenic
1126616466 15:50586726-50586748 ATAAAAACTCAGACTGGGCATGG + Intronic
1126757368 15:51937644-51937666 ACAAAGAAGCCTTCTGGGCCAGG - Intronic
1126961295 15:53998096-53998118 AAAAAGAACAAGATTGGGCCAGG - Intergenic
1127456553 15:59160712-59160734 TTAAAGAAATTGACTGGGCCCGG - Intronic
1127495044 15:59502872-59502894 AAAAAGAAGCAGGCTGGGCAGGG - Intronic
1127837940 15:62805892-62805914 ATAAAAATGCACACAGGGCCAGG + Intronic
1127997309 15:64160938-64160960 ATAAAAAAACAGGCTGGGCATGG - Intronic
1128395027 15:67216146-67216168 ATAAAGAAGAAAATTAGGCCAGG + Intronic
1128440649 15:67705437-67705459 AAAAAAAAGCAGACTAGGCTGGG + Intronic
1128486511 15:68095824-68095846 ATGAAGAAAAAGAATGGGCCAGG - Intronic
1129001063 15:72334323-72334345 ATAAAGAATGAGGCTGGGCGTGG - Intronic
1129549963 15:76437985-76438007 ATAAAAAAGAAAAATGGGCCGGG + Intronic
1130084321 15:80764596-80764618 AGACAGAATCAGACAGGGCCAGG - Intergenic
1130219568 15:82007857-82007879 ATAAATAAGCAAGCTGGGCATGG + Intergenic
1130436216 15:83902563-83902585 AGAAAGAATTAGACTTGGCCAGG - Intronic
1130791627 15:87161437-87161459 ATAAAGATCCAGGCTGGGCATGG + Intergenic
1130925805 15:88384899-88384921 ATAAAGATTCAGTCTAGGCCAGG - Intergenic
1131040483 15:89260973-89260995 ACAAAGAAGCAGGCCGGGCATGG + Intronic
1131957197 15:97748935-97748957 ATAAACAAACATCCTGGGCCAGG - Intergenic
1132386007 15:101400347-101400369 AGAAGGAAGCTGCCTGGGCCAGG - Intronic
1202970842 15_KI270727v1_random:236916-236938 AAAAAGAAGTAGGCTGGGCATGG + Intergenic
1132473680 16:121325-121347 GTAAAAAGGCACACTGGGCCAGG + Intronic
1132720776 16:1314616-1314638 AGAAGGAAGCAGGCTGGGCCTGG + Intronic
1133106674 16:3515068-3515090 GTAAAGAAGCAAATTGGGGCTGG + Intronic
1133346581 16:5075197-5075219 TAAAAGAAACAGAATGGGCCAGG - Intronic
1133961270 16:10495611-10495633 ATTAAGAGGTAGACTAGGCCAGG + Intergenic
1134014043 16:10876303-10876325 ATAAAGTAGATGGCTGGGCCAGG - Intergenic
1134300879 16:12989591-12989613 AGAAAAAAACAGGCTGGGCCAGG - Intronic
1134643702 16:15849740-15849762 AAAATGAAGCAGCCTGGGCGCGG - Intronic
1134868590 16:17631178-17631200 ATAAAGAACTATTCTGGGCCAGG + Intergenic
1134893395 16:17861689-17861711 ATAAAGATTCAGAGGGGGCCAGG - Intergenic
1134979354 16:18594542-18594564 ATAAAAAAGCAGCCCAGGCCGGG - Intergenic
1135010624 16:18874573-18874595 AAAAAAAAGCAGGCTGGGCGCGG + Intronic
1135261682 16:20986149-20986171 AAAAACAAAAAGACTGGGCCGGG - Intronic
1135412569 16:22246229-22246251 GTACAGAAGAAGACTGGGCATGG + Intronic
1136134763 16:28248870-28248892 ATAAAGAAGGAGGCCGGGCGTGG + Intergenic
1136278647 16:29194090-29194112 ACAAGGAAGGAGACTGGGTCTGG + Intergenic
1136527098 16:30838485-30838507 ATAAACAAACAGATTAGGCCAGG + Intronic
1136853322 16:33631774-33631796 ATCAAGAAACAGACCAGGCCGGG - Intergenic
1137031343 16:35527028-35527050 ATAGAGAGGCAGCCAGGGCCTGG - Intergenic
1137264299 16:46856190-46856212 ATAAAGGGGCAGACTGGGCTTGG + Intergenic
1137569793 16:49557882-49557904 CTAGAGAAGGAGTCTGGGCCTGG + Intronic
1137585343 16:49660922-49660944 TTAAAGATACAGACTGGGGCTGG + Intronic
1138298589 16:55908104-55908126 ATAAAGAATCAGACAGGGCAGGG - Intronic
1138826742 16:60329928-60329950 ATAAATAAACAGTCTGGGCGTGG - Intergenic
1139334440 16:66221367-66221389 ATAAAGAACCACACTGGACCAGG - Intergenic
1139334796 16:66224224-66224246 ATAAAGAACCACACTGGACTGGG - Intergenic
1139673773 16:68509297-68509319 AAAAAAAAACAGACTGGGCGTGG - Intergenic
1139678510 16:68541585-68541607 ATAAAAACGCAGGCCGGGCCCGG - Intronic
1139741246 16:69036978-69037000 AAAAAGAAGAAGGCTGGGCATGG + Intronic
1139762175 16:69193773-69193795 ATAAAGAACCAGACAGGTCTCGG + Intronic
1139897212 16:70297202-70297224 ATAAATAAATAGACTGGGCACGG - Intronic
1139916932 16:70434141-70434163 AAAAAGACTCAGACTTGGCCAGG + Intronic
1140238567 16:73180956-73180978 TTAAAGAAGCACAATGGGCCAGG - Intergenic
1140447004 16:75037631-75037653 ACAAACAAGAAGAGTGGGCCAGG - Intronic
1140779110 16:78277573-78277595 ACACTGAAGCAGATTGGGCCAGG - Intronic
1140851039 16:78934807-78934829 GAGAAGAAGCAGACTGGGCATGG + Intronic
1140954418 16:79849095-79849117 ATAAATCAGCAGGCTGGGGCTGG + Intergenic
1140999923 16:80298549-80298571 ATAAAGAGACATACTTGGCCTGG - Intergenic
1141111231 16:81272411-81272433 GTAGAAAAGCAGTCTGGGCCGGG - Intronic
1141113065 16:81286180-81286202 CTTAAGAAGCAAAATGGGCCAGG - Intronic
1141157722 16:81609088-81609110 AGAAGAAAGCAGACTGGGGCAGG - Intronic
1142083037 16:88160171-88160193 ACAAGGAAGGAGACTGGGTCTGG + Intergenic
1203114917 16_KI270728v1_random:1480219-1480241 ATCAAGAAACAGACCAGGCCGGG - Intergenic
1142594838 17:1024489-1024511 ATATAAAAACAGTCTGGGCCAGG + Intronic
1142647755 17:1326361-1326383 TTAAAAATGCAGTCTGGGCCGGG + Intergenic
1142857465 17:2739388-2739410 ATAAACAAACAGGCTGGGCGCGG + Intergenic
1143000479 17:3791728-3791750 ATAATGAATCAGAATGGGGCTGG + Intronic
1143049071 17:4107752-4107774 ATAAAGAAATAGGCTGGGCATGG + Intronic
1143654018 17:8282635-8282657 ATAAAGAACTTGACTGGGCCAGG - Intergenic
1143986197 17:10916503-10916525 ATAAAGAGGGAGAAAGGGCCTGG + Intergenic
1144175919 17:12707413-12707435 ACACAGAAGCAGGCTGGGCACGG + Intronic
1144591116 17:16524650-16524672 ATAAAGAAACAGTCATGGCCGGG + Intergenic
1145272542 17:21412557-21412579 AGAAAGAGGCAGCCAGGGCCGGG - Intronic
1145892398 17:28426366-28426388 GGAAACAAGCAGCCTGGGCCAGG - Intergenic
1145949954 17:28809056-28809078 AGAAATAAGCAGGATGGGCCGGG + Intronic
1146401258 17:32501726-32501748 ATAAAGAGACAGACAGGGCAAGG - Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146932320 17:36786246-36786268 GTAAAGAAGTACACTTGGCCGGG + Intergenic
1147204535 17:38827232-38827254 AGAAAGAAACAGGCTGGGCTCGG + Intergenic
1147234687 17:39048658-39048680 AAAATGAGGCAGACTAGGCCAGG + Intergenic
1147253635 17:39168362-39168384 ATAAAGACCCAGACTGGGAATGG - Intergenic
1147407686 17:40224539-40224561 TTAAAGAAGCAGGCTGGGCCGGG - Intronic
1147432218 17:40379027-40379049 GAAAAGAAGCAACCTGGGCCTGG - Intergenic
1147498214 17:40937605-40937627 ATAAAGAAGCAGTCTGGGGGCGG + Intronic
1147744114 17:42684627-42684649 AGAAAGAAGCAGAGGGGGGCCGG + Intronic
1148186051 17:45644548-45644570 CTAATGAAGCACACTGGGCTTGG + Intergenic
1148602736 17:48906809-48906831 TTAAAAAAGAAGTCTGGGCCGGG - Intergenic
1148629978 17:49099969-49099991 AAAAAGAGGTAGACTCGGCCGGG + Intergenic
1148668610 17:49393317-49393339 TAAAAGATACAGACTGGGCCAGG - Intronic
1148753602 17:49960338-49960360 ACAAATGAGGAGACTGGGCCGGG - Intergenic
1148841052 17:50497491-50497513 AAAAAGAAGCAGAAGGGGCCAGG + Intergenic
1149714246 17:58772166-58772188 ATATAGATGCAGGCTGGGCGCGG + Intronic
1149757633 17:59200780-59200802 TTAAAAAAACAGGCTGGGCCCGG - Intronic
1149939337 17:60846224-60846246 ATAAAGAAGTAGAATGGGGCTGG - Intronic
1150142526 17:62742308-62742330 ATAAGGAAGGAGGCTGGGCATGG - Intronic
1150365976 17:64584650-64584672 AGAAAGTAGCAGTCTTGGCCAGG - Intronic
1150556699 17:66261234-66261256 AAAAAAGAGCAGATTGGGCCTGG - Intergenic
1150769221 17:68027284-68027306 ATAAAAAAGAAGGCTGGGCCAGG + Intergenic
1150875782 17:68968794-68968816 CTAAAGAAGGAGATGGGGCCAGG - Intergenic
1151168413 17:72224633-72224655 ATAAGGATGCCGACTGGGCATGG + Intergenic
1151496708 17:74462423-74462445 AAAAAGAATCAGGCTGGGCGTGG - Intergenic
1151598554 17:75092618-75092640 ATAAAGACACACACTTGGCCGGG - Intronic
1151668907 17:75560779-75560801 ATAAATAAACAAACTGGGCCAGG - Intronic
1152179609 17:78810573-78810595 GTTAGGAAGCAGCCTGGGCCTGG - Intronic
1152401446 17:80068947-80068969 AGCAGGAAGCAGACAGGGCCGGG - Intronic
1152773471 17:82185325-82185347 ATAAAAAAGAAGGCTGGGCATGG + Intronic
1152843525 17:82585593-82585615 ATAAAAGAGGAAACTGGGCCGGG - Intronic
1153281608 18:3419713-3419735 AGAAAAAAGCAGGCTGGGCACGG + Intronic
1153664698 18:7358473-7358495 ATAAAGAAAGAAATTGGGCCGGG + Intergenic
1153683484 18:7522871-7522893 AGAAATAAGGAAACTGGGCCAGG + Intergenic
1154181789 18:12144846-12144868 TTAAAAAAGCAGTCTGGGCTGGG + Intergenic
1154182114 18:12146738-12146760 TTAAAAAAGCAGTCTGGGCTGGG - Intergenic
1154271630 18:12925481-12925503 AAAAAGAGACAGGCTGGGCCGGG + Intronic
1155291926 18:24351055-24351077 ATAAAAAATCAGGCTGGGCACGG + Intronic
1155295867 18:24384281-24384303 AGAAACTAGCAGACTGGGCGTGG + Intronic
1156414910 18:36877960-36877982 TAAAAGACACAGACTGGGCCGGG - Intronic
1156429669 18:37058420-37058442 ATAAACAAGTAGGCTGGGCATGG + Intronic
1156564629 18:38173203-38173225 ATAATGAAGCTATCTGGGCCTGG - Intergenic
1156671967 18:39481667-39481689 ATAAAGAATCAGATTCGGCCGGG + Intergenic
1156694870 18:39753996-39754018 TTAAAGAAGCATTCTGGGCCAGG - Intergenic
1157884271 18:51351327-51351349 ATGAAGAAGCTGGCTGGGCATGG - Intergenic
1158171318 18:54603851-54603873 ATAAAAAAGAAGACTGGGTGCGG - Intergenic
1159827140 18:73227296-73227318 AGAAAGAAGCAACCTGGGCGAGG - Intronic
1160103294 18:75944786-75944808 ATAAAAATGCAGGCTGGGCATGG + Intergenic
1160282660 18:77507112-77507134 ATAAAAATAAAGACTGGGCCAGG + Intergenic
1160852362 19:1198811-1198833 ATAAAGAGGCAGAGTGAGCCGGG - Intronic
1161078787 19:2300326-2300348 CTAAAGAATCAGCCTGGGGCCGG - Intronic
1161381569 19:3968121-3968143 AAAAAGAACCAGGCAGGGCCAGG - Intronic
1161469562 19:4449446-4449468 CTAAACCGGCAGACTGGGCCGGG - Intronic
1161564030 19:4989629-4989651 AAGAAGAAGAAGACTGGGCATGG - Intronic
1161796364 19:6388949-6388971 ATAAATAAGTAGGCTGGGCACGG + Intronic
1161864450 19:6823732-6823754 ATACAGAAAAAGACTGAGCCTGG - Intronic
1161906160 19:7158203-7158225 AAAATGAAGCATAATGGGCCAGG + Intronic
1162757627 19:12869729-12869751 ATGAAGAAACAGTCTCGGCCAGG - Intronic
1162962174 19:14134931-14134953 AAAAAGAAGAAGACGGGGCACGG + Intronic
1163022003 19:14486924-14486946 ATAAAGAAGCGGGCCGGGCGCGG - Intronic
1163138222 19:15329066-15329088 AAAAAAAAGCAGAATGCGCCGGG - Intronic
1163207561 19:15814798-15814820 GTAAAGAATCAGGGTGGGCCGGG - Intergenic
1163305837 19:16478310-16478332 TTCCAGAAGAAGACTGGGCCAGG + Intergenic
1163457476 19:17416398-17416420 AAAAAAAAGCAGGCTGGGCACGG - Intronic
1163651007 19:18517724-18517746 AAAAAGAAAAAAACTGGGCCAGG + Intronic
1163716454 19:18875253-18875275 AGAAAGAAACAGGCTGGGCGCGG + Intronic
1163750185 19:19072248-19072270 ATAAGGAATCAGACAGGGCTGGG - Intronic
1164263116 19:23585849-23585871 ATAAGAAAGCACCCTGGGCCAGG - Intronic
1166196738 19:41211308-41211330 ATAAAGAGGCGGGCTGGGCACGG + Intergenic
1166344457 19:42156640-42156662 AGAAGGAGGCAGACTGGGCCTGG + Intronic
1166543048 19:43618321-43618343 ATAAATAAGTAGGCTGGGCGCGG - Intronic
1166588181 19:43969642-43969664 TTAAAGAAGCAGTCTGGGCCAGG - Intronic
1166614417 19:44230308-44230330 TTAAAGAACCATTCTGGGCCGGG - Intronic
1166630656 19:44403630-44403652 AAAATGAAGCAGGCTGGGCATGG - Intergenic
1166642800 19:44508683-44508705 AAAAAGAAGAAAACTGGGCCAGG - Intronic
1166682148 19:44775596-44775618 ATAAATAAATAGATTGGGCCGGG - Intergenic
1166779788 19:45335619-45335641 AAAAATAAACAGGCTGGGCCCGG + Intronic
1166958876 19:46485943-46485965 TCTAAAAAGCAGACTGGGCCGGG + Intronic
1167127344 19:47559073-47559095 AGAAATAAAAAGACTGGGCCAGG + Intergenic
1167385696 19:49161923-49161945 AGAAAGAAGTAGCCAGGGCCAGG - Intronic
1167554606 19:50186622-50186644 AGAAAGGAGTTGACTGGGCCGGG + Intergenic
1167632652 19:50635201-50635223 AAAAAGGAGCACTCTGGGCCAGG - Intronic
1168016294 19:53575970-53575992 ACAAAAAAACAGACTGGGCACGG - Intronic
1168058254 19:53875552-53875574 AAAAAGAAGGAGTCGGGGCCGGG + Exonic
1168084965 19:54038837-54038859 ATAGTGAAAGAGACTGGGCCGGG - Intergenic
1168723204 19:58566149-58566171 AAAAAGAAGAGGAATGGGCCAGG + Intronic
927593009 2:24373049-24373071 TTAAAGAAACAGAATGGGCCGGG + Intergenic
927623742 2:24690357-24690379 GTAAAAAAGCAGCCTTGGCCAGG + Intronic
927837903 2:26415774-26415796 ATACAGAAGTTGGCTGGGCCTGG + Intronic
927925669 2:27011912-27011934 ATAAAGAAGAAAACTGGGCCAGG + Intronic
928288565 2:30016144-30016166 AAAAGCAAGCAGACTCGGCCGGG + Intergenic
928431654 2:31223821-31223843 ATAAAGAAACAGAAGCGGCCAGG - Intronic
928482883 2:31701012-31701034 ATTAAAAAGGAGACTGGGCACGG + Intergenic
929002166 2:37358120-37358142 AAAAAGAAACAGCCTGGGCATGG + Intronic
929147727 2:38721508-38721530 AAAAAGAAGCAGAGTGGTCAGGG - Intronic
929450501 2:42033754-42033776 GTAAAGGAGCAGGCTGGGCACGG + Intergenic
929724393 2:44409030-44409052 ATATAGAAGCAGGCTGGGTGCGG - Intronic
930075800 2:47404598-47404620 AAAAGGAAGGAGACTGGCCCAGG + Intronic
930175045 2:48292972-48292994 AAAAAGAAGGAGGCTGGGCAGGG + Intergenic
931274170 2:60729645-60729667 TTAAATAGGCAGACTCGGCCGGG + Intergenic
931300802 2:60976055-60976077 TTAAAGAAGGAGGCTGGGCCAGG - Intronic
931408907 2:62009312-62009334 AGAAAGAATAAGACTGGGCATGG + Intronic
931565072 2:63607538-63607560 AAAAAGAAGAGGACTGGGCGCGG + Intronic
932288141 2:70553853-70553875 AAAAAGACGCAGACTAGGCAGGG + Exonic
932379646 2:71270344-71270366 TTAAAGAAGCAGTCTGGGCCGGG - Intergenic
932717722 2:74114559-74114581 TTAAAAAAGCAGGCTGGGCATGG + Intergenic
933182787 2:79245950-79245972 ATGAAGAAGCAGGCTGGGTTTGG - Intronic
933236077 2:79866007-79866029 ATAAAAAAGCAGGCTGGCCGCGG - Intronic
933569160 2:83988818-83988840 AAAAAAAAAAAGACTGGGCCTGG + Intergenic
933657127 2:84897949-84897971 ATGAAGAAGCAAAACGGGCCTGG + Intronic
934475400 2:94590051-94590073 AGAGAGAAGCAGCCTGGGACTGG - Intronic
934730653 2:96654602-96654624 AGAAAGATCCAGACTTGGCCGGG + Intergenic
934864988 2:97800452-97800474 TTATAAAAGCAGAGTGGGCCGGG + Intronic
934970879 2:98763111-98763133 ATAAAGACACAGATTAGGCCAGG + Intergenic
935232446 2:101110679-101110701 ATAAAGAACCAGAACAGGCCAGG + Intronic
936418099 2:112337915-112337937 TTAAAAAAAAAGACTGGGCCAGG - Exonic
936891603 2:117376981-117377003 ATAAAAAAGAAAACTGGGCCAGG - Intergenic
937743810 2:125387198-125387220 AGAAAAAAGCAGACTAGGCGTGG + Intergenic
937984745 2:127633429-127633451 ACCAAGGAGCAGGCTGGGCCAGG - Intronic
938304536 2:130243029-130243051 ATAAAAAATCAGGCTGGGCACGG - Intergenic
938457206 2:131474385-131474407 AAGAAGAAGAAGACTGGGCGCGG - Intronic
938897731 2:135768855-135768877 ATAAAAAATCAGGCTGGGCACGG - Intronic
939240096 2:139547044-139547066 ATTAAAAAACAGACGGGGCCGGG - Intergenic
941042643 2:160640421-160640443 ATGAAAAAGGAGACTGGGCTTGG - Intergenic
941310601 2:163925614-163925636 TTAAAGAAGCCTACAGGGCCAGG - Intergenic
941455186 2:165706550-165706572 AGAAAGTAACAGAGTGGGCCGGG - Intergenic
941462478 2:165788031-165788053 TTAAAAAGGCAGATTGGGCCAGG + Intronic
941868313 2:170357080-170357102 ATATAAAAACAGACTAGGCCAGG - Intronic
941940986 2:171037144-171037166 ATTAAGAAGCATGATGGGCCTGG + Intronic
941969782 2:171337155-171337177 AAGAGGAAGCAGACTGGGCATGG - Intronic
942160786 2:173184611-173184633 ATTAGGTAGCAAACTGGGCCTGG + Intronic
942236156 2:173907947-173907969 AGACAGAGTCAGACTGGGCCTGG + Exonic
942289732 2:174457014-174457036 TTAAAAAAGAAAACTGGGCCAGG + Intronic
942444019 2:176066605-176066627 CTAGTGAAGCAGCCTGGGCCTGG - Intergenic
942609306 2:177726215-177726237 ATAAACAGGCAGACTGGCCTGGG - Intronic
942958813 2:181805240-181805262 ATAAAGAAGAAGTATGGGCTTGG + Intergenic
942978935 2:182054954-182054976 ATTAAAAAACACACTGGGCCAGG - Intronic
944790480 2:203119719-203119741 ATAAAGAATGCAACTGGGCCGGG - Intronic
946051010 2:216862636-216862658 AAAAATAAGCAGATTGGGCTAGG + Intergenic
946714221 2:222536105-222536127 AGAAAGAAGCAAACGGAGCCTGG - Intronic
946730955 2:222709045-222709067 CAAAAGAGGCAGACTGGGCCTGG + Intronic
946747046 2:222856603-222856625 ATGAAGAAGAAGAGTTGGCCGGG + Intergenic
946947284 2:224833945-224833967 AGAAAAAAGTAGAGTGGGCCAGG - Intronic
947287616 2:228533963-228533985 AAAAAGAAGAAGGCTGGGCATGG + Intergenic
947714081 2:232331182-232331204 GGAAAGAAGCGGACTTGGCCGGG + Intronic
948102533 2:235386325-235386347 ATTAAGCAGCAGGCTGGGCACGG - Intergenic
948648045 2:239421228-239421250 AGAAAAAAACAGGCTGGGCCTGG + Intergenic
948672990 2:239580505-239580527 GTAAATAAGAAAACTGGGCCGGG + Intronic
948979111 2:241483742-241483764 ATGAAGAAGGAGGCTGGCCCTGG - Intronic
949081272 2:242101818-242101840 ATAAAGAAACAGGCTGGGCACGG - Intergenic
1170003411 20:11640024-11640046 ATAAAAAAGAAGGCTGGGCACGG + Intergenic
1172028678 20:31967154-31967176 ACAAGGAAGCAGCCTGGGGCTGG - Intergenic
1172232241 20:33344594-33344616 ATTACAAAGCAGGCTGGGCCCGG + Intergenic
1172280626 20:33705304-33705326 CGAAAAAAGCAGACTTGGCCAGG + Exonic
1172285155 20:33734999-33735021 TTAAAAAGGCAGCCTGGGCCAGG - Intronic
1172824850 20:37772641-37772663 ATTAAAACTCAGACTGGGCCGGG - Intronic
1172911169 20:38410204-38410226 ATAAAGAAAAAAACAGGGCCGGG - Intergenic
1172972702 20:38885061-38885083 AAGAAGAAGAAGACTGGGCGTGG + Intronic
1173100302 20:40081588-40081610 ATAAAGAAGCAAGCTGGTCATGG + Intergenic
1173107544 20:40151945-40151967 ATAAAATAGCAGGCTAGGCCAGG - Intergenic
1173238805 20:41274858-41274880 CTTAAGAATCAAACTGGGCCAGG + Intronic
1173510330 20:43623048-43623070 GGAAAGAAGCAGATAGGGCCTGG + Intronic
1173592286 20:44234194-44234216 ATAAAAAAGAACACTGGGGCAGG - Intergenic
1173816344 20:45991446-45991468 ATCAAGAAGTAGGATGGGCCAGG + Intergenic
1174236117 20:49093619-49093641 AGAAAAAAGCAGAGAGGGCCAGG + Intronic
1174243006 20:49153264-49153286 AAAAAGAAGCACAAAGGGCCGGG + Intronic
1174259334 20:49282364-49282386 ATAAAAATGTAGATTGGGCCGGG - Intergenic
1174349852 20:49959210-49959232 ATAAAGTTGCATTCTGGGCCGGG - Intergenic
1174440538 20:50548699-50548721 ATAAATAAACATACTTGGCCAGG - Intronic
1174796059 20:53523426-53523448 AAAAAGATGAAAACTGGGCCGGG + Intergenic
1175104817 20:56607363-56607385 AATAAAAAGAAGACTGGGCCAGG + Intergenic
1175110590 20:56645312-56645334 AGAAACAAGCAGACCGGGCGCGG - Intergenic
1175110686 20:56645902-56645924 AAAAACAAACAGTCTGGGCCGGG + Intergenic
1175325163 20:58120792-58120814 ATAAAAAAACAGGCTGGGCATGG + Intergenic
1176368617 21:6049199-6049221 ATAAAGAAACAAACTGAGACTGG - Intergenic
1177182146 21:17756001-17756023 AAAAATAAGCAGCCTGGGCACGG - Intergenic
1177743437 21:25181557-25181579 ATAAAGAATCAGGCTGGGCGCGG + Intergenic
1178142079 21:29695766-29695788 AAAAAATAGCAGCCTGGGCCAGG - Intronic
1178839584 21:36128102-36128124 TTTAAGAAAAAGACTGGGCCGGG - Intergenic
1179754902 21:43489343-43489365 ATAAAGAAACAAACTGAGACTGG + Intergenic
1180063290 21:45398496-45398518 AAAAAAAATCAGTCTGGGCCAGG + Intergenic
1180204676 21:46251308-46251330 GTAAAGAAGCAGGCTGGGCTTGG + Intronic
1180208287 21:46276891-46276913 ATAAATAAGCAGGCTGGGTGCGG - Intronic
1180635451 22:17259670-17259692 TTTAAGAAGCAGAGTCGGCCGGG + Intergenic
1180846785 22:18987322-18987344 ATAAATAAGTAGGCTGGGCACGG + Intergenic
1180864984 22:19113074-19113096 CTAAAGAAACAGTATGGGCCAGG + Intronic
1180989110 22:19923494-19923516 GTTAACAAGCAGACTGGGCGTGG + Intronic
1181100509 22:20535847-20535869 AGAAAGAAGCAGGCTGAGCACGG - Intronic
1181670391 22:24423244-24423266 AAAAAGAGGGAGGCTGGGCCCGG + Intronic
1181751435 22:24991754-24991776 AGAAAGGAGGAAACTGGGCCAGG - Intronic
1182102967 22:27670686-27670708 AGAAAGAAGCAGGCTGGGGAAGG - Intergenic
1182225097 22:28791585-28791607 AGAAACAGGAAGACTGGGCCAGG - Intergenic
1182886981 22:33782569-33782591 ATAAAGAATCAAATTGGGCTGGG + Intronic
1183436883 22:37801511-37801533 ATAAAGAAGTAAATTAGGCCAGG - Intergenic
1183619177 22:38962662-38962684 TTAAAAAATCAGAGTGGGCCGGG + Exonic
1183711981 22:39510251-39510273 ATAAAAAAACAAAATGGGCCGGG - Intronic
1183902522 22:41017269-41017291 ATGCAGAAGCAGGCTGGGCACGG - Intergenic
1184515768 22:44961243-44961265 ATAAAAAATCAGTCTGGGCACGG - Intronic
1184748938 22:46473227-46473249 ACAAAGAAGCTGAATGTGCCTGG + Intronic
1185408319 22:50670046-50670068 AAAAAGAATCAGGCTGGGCGTGG + Intergenic
949747908 3:7316116-7316138 ATGAAGGAGCACACTGGGCATGG + Intronic
949885676 3:8691606-8691628 ATAAGGATGCAGCATGGGCCGGG - Intronic
950010697 3:9721628-9721650 AAACAGAAGCAGAGTAGGCCTGG + Intronic
950037077 3:9893966-9893988 ATAGAGAAGTAGACTGGGTATGG + Exonic
950331555 3:12159750-12159772 ACAAAGAAGCAGGCTGGGCGTGG + Intronic
950396869 3:12740404-12740426 TTAAAAAAGCATTCTGGGCCAGG + Intronic
950803188 3:15572128-15572150 TTTAAAAAGCAGACTGGGCATGG - Intronic
951206021 3:19926648-19926670 ATAAAAAAGCAGGCTGGGCGTGG - Intronic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951983208 3:28588293-28588315 AGAAAGAAGTAGACAAGGCCAGG - Intergenic
952137485 3:30439677-30439699 ATAAAGAAGTAAACTTGGCTGGG + Intergenic
953211767 3:40881647-40881669 AAAAAGAACTAGACTGGGCACGG - Intergenic
953595404 3:44307976-44307998 ATAAAAATTCAGACTGGGCCAGG + Intronic
953649705 3:44790974-44790996 ATTAAGAAACAGAAGGGGCCGGG - Intronic
954009751 3:47625523-47625545 ATATAGAAGTAGGCTGGGCACGG - Intronic
954046366 3:47934589-47934611 ATAAGAAAGCAGACTGGGCCAGG - Intronic
954093998 3:48308267-48308289 TTAAGAATGCAGACTGGGCCAGG - Intronic
954195184 3:48992308-48992330 ATAAAATAGCAGACAGGGCCGGG + Intronic
955366878 3:58318365-58318387 TTCAAGAAGTAGGCTGGGCCCGG + Exonic
955636648 3:61037204-61037226 TAAAAAAAGCAGACTGGGCCGGG - Intronic
956111886 3:65878219-65878241 ATAAGAATGCAGACTTGGCCGGG + Intronic
956777112 3:72574455-72574477 ATAAAGACTCAGGCTGGGCATGG + Intergenic
956820933 3:72953606-72953628 ATAAACAATGAGAGTGGGCCGGG - Intronic
957690071 3:83555752-83555774 TTAAAGAAGCAGTCTGGGCTGGG + Intergenic
957798628 3:85044968-85044990 ATATAGAAGTAGAGTGTGCCAGG - Intronic
957829699 3:85500805-85500827 AAAAAGTAGCAGGCTGGGCACGG - Intronic
958650594 3:96931542-96931564 TTAAAGAAGCAGTCTGGCCATGG + Intronic
959000545 3:100959193-100959215 CTAAAGAATAAGGCTGGGCCGGG + Intronic
960575581 3:119226492-119226514 AGAAAGAAACAGAAGGGGCCAGG + Intronic
960720200 3:120618050-120618072 ATAAAAATGTAGATTGGGCCAGG - Intergenic
961170586 3:124795194-124795216 ATAAAGAGGAATTCTGGGCCGGG + Intronic
962498984 3:135969933-135969955 ATAAATGAGCAAAGTGGGCCAGG - Intronic
962541129 3:136383658-136383680 ATAAAGAAACAGGCACGGCCAGG + Intronic
962615314 3:137120553-137120575 TTAAAGATACAGATTGGGCCGGG - Intergenic
963122997 3:141792110-141792132 ATAAACATTCAGACTGGGCGTGG + Intronic
963308258 3:143678114-143678136 ATGAAGAGGCAGGCTGGGCGCGG - Intronic
964350121 3:155794274-155794296 ATAAACAAGCAAACTAGGCCGGG - Intronic
964389209 3:156180232-156180254 ATAAGGAAGCAGACTTGGAGAGG + Intronic
966248052 3:177830893-177830915 ATAAAGAAGCAGCATGGGAGTGG + Intergenic
966620582 3:181958972-181958994 ATAATAAAAAAGACTGGGCCGGG - Intergenic
967749156 3:193094134-193094156 ACAAAGAAACAAATTGGGCCAGG - Intergenic
967920920 3:194613825-194613847 ATAAAAAAACAGAATAGGCCGGG + Intronic
968076277 3:195817425-195817447 AAGAAGAAGGAGGCTGGGCCGGG - Intergenic
968080485 3:195843111-195843133 TTAAAAAAACAGACTGGGCATGG + Intergenic
968466396 4:753650-753672 AAAAAAAAGAAGACTGGACCAGG + Intronic
968679951 4:1910968-1910990 ATAAAGATGCAGACAAGGCCAGG - Intronic
968844441 4:3032186-3032208 GTGAAAAAGCAGAATGGGCCGGG + Intronic
968848601 4:3062323-3062345 ATAAAAATGTAGACTAGGCCGGG - Intergenic
968877710 4:3282570-3282592 TTAAAAAAGCAGGCTGGGCGTGG - Intergenic
969018695 4:4123849-4123871 ATAAAGATACAGCATGGGCCGGG + Intergenic
969038978 4:4279027-4279049 CTAAAAAAGAAGGCTGGGCCAGG + Intronic
969236541 4:5869385-5869407 AGAAAGAAGTAAACTGGGCCAGG + Intronic
969377680 4:6773684-6773706 AAAAAGAACCAGGCTGGGCGTGG + Intergenic
969735292 4:8984856-8984878 ATAAGGATGCAGCATGGGCCGGG - Intergenic
970798120 4:19939366-19939388 ATAAATATGAAGACTGGGCCGGG + Intergenic
971323027 4:25620692-25620714 TAAAAGAAGAAGGCTGGGCCAGG - Intergenic
971788296 4:31134164-31134186 TAAAAGAAGTAGAATGGGCCAGG + Intronic
972244088 4:37226178-37226200 AGAGAAAAGCAGACAGGGCCAGG + Intergenic
972392469 4:38626678-38626700 ATAAAGAATTAGGCTGGGCACGG - Intergenic
972508382 4:39743306-39743328 ATAAAAAAGAAGAATAGGCCAGG + Intronic
972600398 4:40566941-40566963 ATGAAGACACAGAATGGGCCGGG - Intronic
972673823 4:41240176-41240198 AAAAAGAAACAAGCTGGGCCAGG + Intergenic
973874921 4:55208045-55208067 TAAAAGACACAGACTGGGCCAGG + Intergenic
973937542 4:55863188-55863210 ATAAAAAAACAGGCTGGGCTTGG - Intronic
974713725 4:65638445-65638467 GTAAATAGGCAGACTGGGCACGG + Intronic
974788393 4:66652968-66652990 AGAAAGAAGCATATTTGGCCGGG + Intergenic
975196377 4:71529574-71529596 CTAAAGAAGCAGAATTGCCCAGG + Intronic
975649560 4:76579176-76579198 ATAAATAAACAGGCTGGGCGTGG + Intronic
975886260 4:78969016-78969038 ATGAAGAAACAGACCTGGCCAGG - Intergenic
975998267 4:80341069-80341091 TCAAAGAAGCAGTCTGGGCCAGG - Intronic
976080391 4:81348275-81348297 ATTTAGAAGCAGACTGGCCTAGG - Intergenic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
976718182 4:88145637-88145659 ATAAAGGAACACTCTGGGCCAGG + Intronic
977006381 4:91572664-91572686 TTAAAGAAGCAGTCTGGGCTGGG + Intronic
977234131 4:94486704-94486726 ATAAAAAAACAGATTAGGCCAGG + Intronic
978458998 4:108929549-108929571 AAAAAGATGCAGGCTGGGCGTGG + Intronic
978745446 4:112189088-112189110 ATAAAGAATTAGATTGGGCCGGG + Exonic
979116424 4:116829956-116829978 TTAAGGAAGCATTCTGGGCCAGG - Intergenic
979598858 4:122564266-122564288 ATGAAGAAGGAAACTGAGCCAGG - Intergenic
979655154 4:123183913-123183935 ATAAATAAGCAAGCTGGGCATGG - Intronic
980958019 4:139447960-139447982 TAAAAGTAGTAGACTGGGCCGGG - Intergenic
981737757 4:147970795-147970817 ATAAAGATGTAGACTGAGCATGG + Intronic
981806384 4:148720493-148720515 ATAAAGAAGCTGAACTGGCCAGG + Intergenic
982004996 4:151054853-151054875 AGAAAGAAGCAATCTAGGCCGGG + Intergenic
982102887 4:151985610-151985632 TTAAAGAAGCATAATGGGCAAGG + Intergenic
982266851 4:153545580-153545602 ACAAAGAAACAGTTTGGGCCTGG - Intronic
982859772 4:160434448-160434470 TTAAATAAGCAGACTGGGCTTGG + Intergenic
984408556 4:179366294-179366316 ATAAAGAAGATAAGTGGGCCGGG + Intergenic
984467743 4:180122947-180122969 ATAAACAAGTAGGATGGGCCAGG + Intergenic
985770198 5:1805032-1805054 TTTAAGAAGTAAACTGGGCCAGG + Intronic
986061510 5:4196060-4196082 AAAAAAAAAAAGACTGGGCCGGG - Intergenic
987783668 5:22470706-22470728 ATAGAAAAGAAGACTGGGCAAGG - Intronic
988561245 5:32283561-32283583 ATAAGAATGCAGACTGGGCCAGG - Intronic
989127830 5:38074181-38074203 TTAAAGAAGCTGGCTGGGCATGG - Intergenic
989535916 5:42563322-42563344 AAAAAGAATCAGGCTGGGCACGG + Intronic
989626838 5:43437809-43437831 TTAAAGAAGCAGGATGGGTCTGG + Intergenic
989800719 5:45535305-45535327 ATAGAGAAGCAGGCTGGGCATGG + Intronic
990055815 5:51576927-51576949 ATTAAAAAGCAGACAAGGCCGGG + Intergenic
990439862 5:55833646-55833668 ATTAAGAACCAGACCTGGCCGGG + Intergenic
990446324 5:55897138-55897160 ATAAAGAAACAGGCTGGGCATGG - Intronic
991067474 5:62439580-62439602 AAAAAAAAAAAGACTGGGCCAGG - Intronic
991381792 5:66035801-66035823 ATAAGTAATCAGACTGGGCGTGG + Intronic
991475896 5:67019157-67019179 ATATACAAGAAGACTGGGGCGGG + Intronic
992656584 5:78916334-78916356 AGAAGAAAGGAGACTGGGCCTGG + Intronic
993564663 5:89458310-89458332 ATATAAAAGCAGACTGGGCAAGG - Intergenic
993880089 5:93351484-93351506 AAAAAGAAGGGGAGTGGGCCGGG + Intergenic
994631361 5:102292118-102292140 TTTAAAAAGCAAACTGGGCCAGG - Intronic
995312429 5:110729178-110729200 AAAATAAAGAAGACTGGGCCAGG - Intronic
995513341 5:112929609-112929631 ATAAAGAAACTGACCAGGCCAGG + Intergenic
995563098 5:113404160-113404182 ATAAAGAAACAAACTGGGCCGGG - Intronic
996148886 5:120010746-120010768 AGAAAAATGCAGACTGGGCATGG - Intergenic
996531301 5:124530066-124530088 ATAAACAAACAAACTGGGCGCGG - Intergenic
996721080 5:126630909-126630931 ATAAATAAGCAAGCTGGGCGTGG - Intergenic
996731083 5:126718065-126718087 ATAAAAAACCAGGCTGGGCCCGG - Intergenic
996740674 5:126795919-126795941 AAAAAAAAGCATCCTGGGCCAGG - Intronic
996953555 5:129156838-129156860 TTAAAGAAGAAGTCTGGGCATGG - Intergenic
996987269 5:129582865-129582887 ATTAAAAGACAGACTGGGCCGGG - Intronic
997020955 5:130001172-130001194 ATAAAAAAGAAGGCAGGGCCAGG - Intronic
997454458 5:134006445-134006467 TTAAAGAACCAATCTGGGCCGGG + Intergenic
997590303 5:135068162-135068184 ATGAAGAAGCAGATCAGGCCAGG - Intronic
997951896 5:138249117-138249139 ATGAAGAAGCAGCCCGGGTCTGG - Intergenic
997989070 5:138528849-138528871 TAATACAAGCAGACTGGGCCAGG + Intronic
998293530 5:140941608-140941630 ATTAAGAAGCAGGATGGGCTGGG - Intronic
998575351 5:143309567-143309589 GTAAAGAAGAAACCTGGGCCGGG - Intronic
998660078 5:144226866-144226888 ATAAAGAAATAGATTTGGCCAGG - Intronic
998800125 5:145860761-145860783 ATAAAGAAACAGATTGGGAGAGG - Intronic
999950368 5:156642760-156642782 TTAATAAAGAAGACTGGGCCAGG - Intronic
1000319834 5:160125455-160125477 ATAAAAAAGCAGACCAGGCTGGG - Intergenic
1000701550 5:164457493-164457515 ATAAAGAATGACCCTGGGCCAGG + Intergenic
1000931609 5:167258662-167258684 ATAAAAAAGCAAAGTGGCCCAGG - Intergenic
1001995130 5:176151270-176151292 ATAAAGAAACAGGCCGGGCGCGG - Intergenic
1002122868 5:177019242-177019264 ATAAAGAAACAGACTAGGAAAGG - Intronic
1002308579 5:178298750-178298772 CTAAAGGAGCAGAATGGGCCAGG + Intronic
1002533204 5:179861587-179861609 ACAAACAAGCAGACCGGGCATGG + Intronic
1002907891 6:1465666-1465688 ATAAATAAACAGGCTGGGCATGG + Intergenic
1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG + Intronic
1003757159 6:9134937-9134959 ATATAAAAGAGGACTGGGCCGGG - Intergenic
1004277893 6:14254258-14254280 GTAAAGAGTCAGACAGGGCCGGG - Intergenic
1004581876 6:16962310-16962332 TGAAAGAAGTAGACTGGGCTAGG - Intergenic
1004700215 6:18071739-18071761 TTATAGAAGCAGACTGGGGTGGG - Intergenic
1004765267 6:18719810-18719832 ATAAAGAGGAAGATTGGGCCCGG - Intergenic
1004969391 6:20891826-20891848 AGAAATAAGCAGGATGGGCCAGG - Intronic
1005449056 6:25955388-25955410 GTAAAGAAGCCGGCTAGGCCAGG + Intergenic
1005558038 6:27008089-27008111 ATAAAGATGCTCACTGGGCCGGG + Intergenic
1005621310 6:27623052-27623074 ATAAAGAAGCAGACAGTACAAGG + Intergenic
1005634550 6:27740885-27740907 TTAAATATACAGACTGGGCCAGG - Intergenic
1006113104 6:31760663-31760685 ATAGGGAAGGAGACAGGGCCTGG - Intronic
1006292249 6:33147303-33147325 AGAAGAAAGCAGGCTGGGCCTGG + Intergenic
1006426896 6:33970132-33970154 ATAAAAGAGCAAAATGGGCCAGG + Intergenic
1006547577 6:34792372-34792394 GGAGAGAGGCAGACTGGGCCCGG - Intronic
1006876372 6:37300704-37300726 ATAATGAAAGAGACTGGCCCTGG - Intronic
1006948937 6:37805544-37805566 ATAAATAAGTAGGCTGGGCGTGG - Intergenic
1007440329 6:41854019-41854041 AAAAAGAAGCAGGGTAGGCCAGG + Intronic
1007479790 6:42142419-42142441 AAAAAGAAGCAGACGGTGCAGGG - Exonic
1007754238 6:44088538-44088560 ATGAAGAAGGAGGCTGGGCACGG - Intergenic
1007776644 6:44227706-44227728 ATCAAGAACCAGGGTGGGCCAGG - Intronic
1007867005 6:44982503-44982525 ATAAAGAATCGGGCTGGGCATGG - Intronic
1008000801 6:46357831-46357853 ATAAAGAAGCAGCTAGGGCAAGG + Intronic
1008298474 6:49805861-49805883 TTAAAGAAGCAGTCTGGGCCTGG - Intergenic
1008482587 6:52001719-52001741 AAAAAGAAGGAGGCTGGGCGTGG - Intronic
1008752046 6:54746705-54746727 TTAAAGAAACAGGCTGGGCTTGG - Intergenic
1010213477 6:73381688-73381710 ATAAAAAACCAGGCTGGGCGCGG + Intronic
1010388522 6:75310056-75310078 ATAAGGAAGCAAACTGGGGTTGG - Intronic
1010429831 6:75766030-75766052 AGAAAAAAGCAGGCTGGGCATGG + Intronic
1011256137 6:85423092-85423114 AAAAAGGAGCATCCTGGGCCAGG + Intergenic
1011645081 6:89450044-89450066 AGAAAGAATCAGGCTGGGCACGG + Intronic
1011709691 6:90039677-90039699 ATAAAGAAGTACTCTTGGCCAGG - Intronic
1011825912 6:91305209-91305231 ATAAAGAAGTAGGCGAGGCCGGG + Intergenic
1012572149 6:100742628-100742650 TTAAAGAAGCAGTCTGGCCATGG + Intronic
1012810023 6:103945065-103945087 AAAAAGAGGCAAACTGGGCCTGG - Intergenic
1014044284 6:116866320-116866342 AGAAAAAAGCAGGCTGGGCGCGG - Intergenic
1014100742 6:117509058-117509080 AGAAATAAGCAGTCAGGGCCAGG - Intronic
1014570716 6:123004615-123004637 ATGAAAAAGCAGACCAGGCCAGG + Intronic
1014742576 6:125163424-125163446 ATAAAGAAGTAAATTGGGCATGG + Intronic
1015193963 6:130504916-130504938 TTAAAAAATCAGATTGGGCCGGG - Intergenic
1015753609 6:136585805-136585827 TTAAAGAAGCAGTGTGGGCTGGG - Intronic
1015986430 6:138888602-138888624 AAAAAGAAGTAGGCTGGGCGCGG - Intronic
1016114861 6:140267608-140267630 ATAAAAAATTAAACTGGGCCAGG - Intergenic
1016340252 6:143054413-143054435 ATAAAGAAACAGAAAAGGCCAGG - Intergenic
1017786076 6:157758280-157758302 AAAAAGAAGCAGATGAGGCCAGG + Intronic
1017892665 6:158652216-158652238 ATAAATAAACAGGCTGGGCTCGG - Intronic
1018705750 6:166462104-166462126 AGAAGGAAGCAGGCAGGGCCAGG - Intronic
1020016779 7:4835996-4836018 AGCAGGAAGCAGACTGGCCCTGG + Intronic
1020578389 7:9963482-9963504 ATCAGGAAGCAGGCTGGGCATGG + Intergenic
1021358862 7:19687641-19687663 TAAAAGACACAGACTGGGCCGGG - Intergenic
1021734107 7:23625950-23625972 ATAAAGAATCAGTCAAGGCCAGG - Intronic
1022252591 7:28623176-28623198 ATAAAGAAGTAGATGGGGACAGG - Intronic
1022395528 7:29985109-29985131 AAAAGGAAGGAGACTGGGCTGGG + Intronic
1022584081 7:31588333-31588355 AGAAAGTAGCAGTCTTGGCCAGG + Intronic
1022788139 7:33659618-33659640 ATAAAGAAACAAATTGGTCCAGG - Intergenic
1022869831 7:34464615-34464637 AGAAATATGCAGACTGAGCCTGG - Intergenic
1023199559 7:37681145-37681167 AGAAAGTAGCAGATTGGGCTGGG - Intergenic
1023316645 7:38944595-38944617 AAAAAGGAGTAAACTGGGCCAGG + Intergenic
1023560802 7:41471465-41471487 AGAAAGAAAAAGTCTGGGCCAGG + Intergenic
1023909958 7:44546832-44546854 ATAGAAAAGCAGGCTGGGCATGG + Intergenic
1024259403 7:47562678-47562700 AGAAGGCAGCAGACTAGGCCTGG - Intronic
1024493062 7:50008878-50008900 ATAAAGACACATACTGGGCCAGG + Intronic
1024493066 7:50008935-50008957 ATGAAGACACATACTGGGCCAGG + Intronic
1024820030 7:53317725-53317747 TTAAAGAAGCAGACCCGGCTGGG + Intergenic
1025087109 7:56032363-56032385 ACAAGGAAGCAGACTTGGGCGGG + Intronic
1025234493 7:57224944-57224966 ATAAAAACCAAGACTGGGCCGGG - Intergenic
1025716067 7:63956657-63956679 AAAAATAAGGAGACTGGGCATGG - Intergenic
1026225446 7:68436267-68436289 ATCAAGAAGCAGTGTGGGCCGGG - Intergenic
1026575057 7:71564969-71564991 TTAAAGTATCAGGCTGGGCCGGG + Intronic
1026632532 7:72049796-72049818 AAAAAGAAATAGACTTGGCCCGG - Intronic
1026988233 7:74568351-74568373 AAAAAGAAGGAGAAAGGGCCGGG + Intronic
1027332587 7:77114953-77114975 AAAAAAAATCAGACTAGGCCGGG - Intergenic
1027679720 7:81205154-81205176 AAAAAAAAGAGGACTGGGCCGGG + Intergenic
1029131312 7:98333300-98333322 TTAAATGAGCACACTGGGCCAGG + Intronic
1029214873 7:98940439-98940461 AAAAATAAACAGGCTGGGCCAGG - Intronic
1029246587 7:99206450-99206472 ATAAAAAACCAGGCTGGGCTGGG - Intronic
1029249591 7:99226278-99226300 AAAAATAATCAGCCTGGGCCAGG + Intergenic
1029310958 7:99663804-99663826 ATAAAGAAGGAGATTGGGGAAGG - Intronic
1029561592 7:101306541-101306563 CTAAAGAGGCAGGCTGGGCACGG + Intergenic
1029618279 7:101673705-101673727 ACCAAGAGGCAGACTGGGCGCGG + Intergenic
1029783193 7:102756360-102756382 AAAAAAAATCAGACTAGGCCGGG + Intronic
1030356109 7:108544229-108544251 ATAAAGAAGGACATTGGGCCAGG + Intronic
1030391512 7:108933897-108933919 AAGAACAAGCAGAGTGGGCCGGG + Intergenic
1031245918 7:119311189-119311211 ATACTAAAGAAGACTGGGCCAGG + Intergenic
1031366924 7:120912715-120912737 ATAAAGAAGCATTATGGGCTGGG + Intergenic
1032059536 7:128713008-128713030 CTAAAAAATCAGAATGGGCCGGG + Intronic
1032833485 7:135652142-135652164 TTTAAGAAGATGACTGGGCCGGG + Intergenic
1033083764 7:138323046-138323068 ATAAAGAAGAAAATTGGACCAGG + Intergenic
1033212359 7:139469448-139469470 ATAAATAAGTAGGCTGGGCGTGG - Intronic
1034153623 7:148936498-148936520 ATAAATAAGCAAGCTGGGCATGG + Intergenic
1034757015 7:153632018-153632040 GCAAAGAACCAGACTGGGCATGG - Intergenic
1035194294 7:157203080-157203102 ATAAAGGGGCTGACTGTGCCTGG - Intronic
1035820549 8:2587237-2587259 ATAAAGAAGCTTTTTGGGCCAGG - Intergenic
1035949925 8:4008898-4008920 ATACTGAATCAGACTGGGCGCGG - Intronic
1035952820 8:4042835-4042857 AAAAAAAAGCAGGCTGGGCACGG + Intronic
1036955651 8:13185600-13185622 TAAAAGACACAGACTGGGCCGGG - Intronic
1036956636 8:13194715-13194737 ATAAGAAAGCAGGCTGGGCATGG + Intronic
1037533337 8:19801555-19801577 AATAACAAGCAGACTGGGCCAGG + Intergenic
1037860715 8:22403621-22403643 ATATATAAGTAGACAGGGCCGGG + Intronic
1037874132 8:22530535-22530557 ATAAAAAGGAAGAATGGGCCGGG + Intronic
1037883197 8:22582871-22582893 AAAAGTAAGGAGACTGGGCCGGG - Intronic
1037968124 8:23149532-23149554 AAAAAAAAGTAGACTGGGCGTGG - Intronic
1038289174 8:26233655-26233677 TTAAAAATGTAGACTGGGCCGGG - Intergenic
1038835536 8:31117081-31117103 GCAAAGAAGCAGTCTGGGCTTGG + Intronic
1039746362 8:40431558-40431580 GTAAAGAAACAGAATCGGCCAGG + Intergenic
1039898450 8:41733026-41733048 AAAATGAAACAGACTGGGCGCGG - Intronic
1040009396 8:42648707-42648729 ACAAAACAGGAGACTGGGCCGGG + Intergenic
1040031769 8:42831515-42831537 ATAAAGGAGCAGACAGGGCCAGG - Intergenic
1040503113 8:48022424-48022446 AAAAAGATGCAGGCTGGGCGTGG - Intronic
1041065363 8:54077503-54077525 ATAAAAAAGTAGTCTGGGCACGG + Intronic
1041250866 8:55933930-55933952 ATAAAGAAGGAGCTTTGGCCAGG + Intronic
1042108256 8:65351818-65351840 ATAAAATACCAGACTGGGCATGG - Intergenic
1042326937 8:67538952-67538974 TAAAAGACACAGACTGGGCCGGG - Intronic
1042455595 8:68998801-68998823 ATAATAAAGCAGGCTGGGCGTGG - Intergenic
1042492643 8:69417486-69417508 ATTAAAAAGTAGACTGGGTCTGG - Intergenic
1042752315 8:72171276-72171298 TTAAAGAAACAGAATGGGCCTGG + Intergenic
1043167606 8:76923833-76923855 CAAATAAAGCAGACTGGGCCTGG - Intergenic
1043317232 8:78937836-78937858 AAAAAAAAGCAGGCTGGGCACGG - Intergenic
1043377505 8:79667189-79667211 ATGAAGAAGCAGGCCGGGCACGG + Intergenic
1043653068 8:82623591-82623613 ATAAAAATGCACACTTGGCCGGG - Intergenic
1043943596 8:86225015-86225037 ATAGGGAAGCAGACTGGACATGG - Intronic
1044018307 8:87073804-87073826 CTAAAGAAGCAGTCTGGGCCGGG + Intronic
1044041005 8:87368343-87368365 ATAAAAAAGTAGATTGGGCATGG + Intronic
1044365656 8:91342218-91342240 ATAAAGAAGCTGGCTGAGCACGG - Intronic
1044374184 8:91449803-91449825 ATAAAGAAGATGAAAGGGCCGGG - Intergenic
1045048339 8:98300569-98300591 ATAGAGAGGCTGACAGGGCCAGG + Intergenic
1045092010 8:98755849-98755871 CTAAAGAAGCAGGCCGGGCACGG + Intronic
1045735621 8:105293281-105293303 GTAAAAAAGAAGAGTGGGCCTGG + Intronic
1045756728 8:105552461-105552483 GCAAAGAAGCACACTGTGCCAGG + Intronic
1045828026 8:106424226-106424248 GTAAAGAATCAGACTGGGTGTGG - Intronic
1046068292 8:109221753-109221775 AAAAAGAACAAGACAGGGCCAGG + Intergenic
1046399541 8:113686763-113686785 TTAAAAAAGCAGGCTGGGCTCGG - Intergenic
1046903275 8:119545291-119545313 AAAAAAAAAAAGACTGGGCCGGG - Intergenic
1047385522 8:124405759-124405781 ATAATAAAGAAGATTGGGCCAGG - Intergenic
1047428314 8:124766920-124766942 AAAAAAAAGCAGACAAGGCCGGG + Intergenic
1047504885 8:125471457-125471479 AAAATGAAAGAGACTGGGCCAGG + Intergenic
1047598417 8:126402236-126402258 ATAAAGAAGGAAAAAGGGCCCGG + Intergenic
1047964112 8:130033017-130033039 ATAATGAAACAGACTCGGCTGGG + Intergenic
1048341751 8:133545352-133545374 TTACAAAGGCAGACTGGGCCAGG + Intronic
1049483879 8:142841290-142841312 AGAAGAAAGCAGACTGGCCCTGG - Intronic
1049506121 8:142999714-142999736 ATTAAGAATCAGATTTGGCCTGG - Intergenic
1049545028 8:143226519-143226541 ACAAAGACCCAGCCTGGGCCTGG - Intergenic
1049915284 9:311545-311567 AACAAAAAGGAGACTGGGCCAGG - Intronic
1049994363 9:1020554-1020576 ATTAAGAAGCAAACTTGGCCAGG - Intergenic
1050014589 9:1220341-1220363 AAAAAAAAGCAGCCAGGGCCAGG - Intergenic
1050344364 9:4671897-4671919 ATAATGATGCAGAGTGGGGCTGG - Intergenic
1051277784 9:15414037-15414059 ATATAGAATTAGACTGGGCGCGG - Intergenic
1051317515 9:15857717-15857739 CTAAAGAATGAAACTGGGCCAGG - Intronic
1052015424 9:23459006-23459028 AGAAGTAAGCAGACAGGGCCGGG + Intergenic
1052271632 9:26633785-26633807 ATAATGAAGCAGGCCGGGCGCGG - Intergenic
1052854648 9:33399730-33399752 AGAGAGAAGCAGCCTGGGACTGG + Intronic
1052965582 9:34338200-34338222 AAAAAAAATCAGACTGGGCATGG + Intronic
1053311625 9:37024405-37024427 AAGAAGAAACTGACTGGGCCAGG + Intronic
1053379504 9:37636767-37636789 ATCAAAAAGCAGATGGGGCCCGG - Intronic
1053682667 9:40496011-40496033 AGAGAGAAGCAGCCTGGGACTGG + Intergenic
1053714752 9:40875639-40875661 TAAAAGACACAGACTGGGCCGGG + Intergenic
1053797000 9:41735588-41735610 TTAAAAAATCAGACTTGGCCAGG - Intergenic
1053932649 9:43124352-43124374 AGAGAGAAGCAGCCTGGGACTGG + Intergenic
1054281047 9:63128918-63128940 AGAGAGAAGCAGCCTGGGACTGG - Intergenic
1054295766 9:63331525-63331547 AGAGAGAAGCAGCCTGGGACTGG + Intergenic
1054393785 9:64636020-64636042 AGAGAGAAGCAGCCTGGGACTGG + Intergenic
1054428433 9:65141233-65141255 AGAGAGAAGCAGCCTGGGACTGG + Intergenic
1054501947 9:65880312-65880334 AGAGAGAAGCAGCCTGGGACTGG - Intronic
1055040369 9:71864512-71864534 TTAAATATGAAGACTGGGCCAGG - Intronic
1055514025 9:77019498-77019520 AGAGAGAAGCAGAGAGGGCCTGG + Intergenic
1055638447 9:78299804-78299826 ATAAAGAATTAGACAAGGCCGGG - Intronic
1056046690 9:82725737-82725759 AAAAAGAAGCAGACCAGGCGCGG + Intergenic
1056069436 9:82970531-82970553 ATAAAGAAACAGGCTTAGCCGGG - Intergenic
1056142369 9:83695486-83695508 ATAAAAAAGGGGACTGGGCATGG - Intronic
1056268882 9:84926525-84926547 AAAAAGAAAGAAACTGGGCCGGG - Intronic
1056526623 9:87448589-87448611 AGAAAAAAACAGAGTGGGCCGGG + Intergenic
1056863681 9:90210687-90210709 ATAAGGATGCAGCATGGGCCGGG - Intergenic
1056916229 9:90748760-90748782 ATAAGGATGCAGCGTGGGCCAGG + Intergenic
1057050439 9:91919713-91919735 ATGAAGGAGCAGAGTGGGCTGGG - Intronic
1057055813 9:91959858-91959880 AGAGAGAAGCAGGCTGGGCACGG - Intergenic
1057169090 9:92950120-92950142 AAAAAGAAGCAGGTGGGGCCAGG + Intronic
1057255955 9:93547248-93547270 ACAAAGATGCAGACTGGGTTAGG + Intronic
1057414169 9:94846613-94846635 AGAAAGAAGCTGGCTGGGCATGG + Intronic
1057579059 9:96269606-96269628 TAAAAGAAGCAGATTAGGCCGGG + Intronic
1058443165 9:105029274-105029296 ATAAAGAATCAGGATGGGCTGGG - Intergenic
1058701693 9:107606035-107606057 ATGAAAAAGAAGACTGGGCCGGG - Intergenic
1058854675 9:109049502-109049524 ACAAAAAAACAGACTGGGCGCGG - Intronic
1059502508 9:114767006-114767028 ATAAGGAAACAGGCTGGGCATGG - Intergenic
1059625954 9:116066296-116066318 AGAAAGAAGCAGAATTGGGCAGG - Intergenic
1060108242 9:120888269-120888291 GTGAAGAAGGAGGCTGGGCCAGG - Intronic
1060649218 9:125310826-125310848 AAAAAGAAGAAGGCTGGGCGCGG - Intronic
1060923140 9:127436759-127436781 CTAAAGATGCAGCCTGGGCCAGG + Intronic
1061170754 9:128952086-128952108 ATTAATAATCAGACTCGGCCAGG - Intronic
1061186528 9:129057899-129057921 ATAAAGAAGAAAAATGGACCGGG - Intronic
1061216191 9:129223408-129223430 TTAAAGAAGCAGAGCGGGCCGGG - Intergenic
1062104764 9:134748946-134748968 AAAAAGAAAGAGACTGGGCGCGG + Intronic
1062297840 9:135843030-135843052 TAAAAGACACAGACTGGGCCGGG + Intronic
1062635644 9:137489183-137489205 ATGAAGACGCAGCCTGTGCCAGG + Intronic
1185595975 X:1307294-1307316 GTAAAGGAGAAGAGTGGGCCTGG - Intronic
1185648456 X:1631622-1631644 ATGAACAAGCAGACCGGGCGCGG + Intronic
1185738233 X:2509680-2509702 ATAAAGAGGTATTCTGGGCCGGG + Intergenic
1186496022 X:10013936-10013958 TTAAAAAAGAAGAATGGGCCGGG - Intergenic
1186742025 X:12528613-12528635 AGAAATTACCAGACTGGGCCAGG - Intronic
1187372730 X:18724081-18724103 ATAAAAAATGAGACGGGGCCAGG - Intronic
1187497285 X:19806219-19806241 ACAAAACAGTAGACTGGGCCAGG + Intronic
1187646143 X:21348990-21349012 TTAAAGAAGCAGTCTGGGCCGGG - Intergenic
1187654490 X:21454872-21454894 ATAAGGTAGCAGGCTGGGACAGG + Intronic
1187924796 X:24239815-24239837 AGAAAAAATCAGACTGGGCGCGG - Intergenic
1188814275 X:34692006-34692028 CAAAAGAAAAAGACTGGGCCGGG - Intergenic
1189654997 X:43235786-43235808 ATAAAGAAGCTGACTTTGCCGGG + Intergenic
1189757872 X:44289974-44289996 AGAAAGACGTAGACCGGGCCGGG - Intronic
1189919175 X:45886714-45886736 AAAAGTAAGCAGAGTGGGCCGGG + Intergenic
1190048705 X:47133146-47133168 AAAAAGAAGTAGACTGGGGCCGG + Intergenic
1190087638 X:47409631-47409653 AAAAAGAAGCTGGCTGGGCATGG - Intronic
1190087687 X:47409937-47409959 ATGAAGAAGGAGGCTGGGCGCGG - Intronic
1190737055 X:53262561-53262583 TGGAAGGAGCAGACTGGGCCAGG + Intronic
1190887257 X:54540945-54540967 ATAAGGAAGAAGGCTGGGCAGGG - Intronic
1193300150 X:79880074-79880096 ATAAAGAAGTAGGCTAGGCGCGG + Intergenic
1193344948 X:80394682-80394704 ATAAATAAGCAGGCTGGGCATGG - Intronic
1193629256 X:83862234-83862256 AGAAAGAAAAAGAGTGGGCCGGG + Intronic
1194225407 X:91250464-91250486 GTAAAGAATCAGAGGGGGCCGGG - Intergenic
1194415003 X:93601331-93601353 AGAAAGAAGCAAATTAGGCCGGG + Intergenic
1195241594 X:102958489-102958511 ACAAAGAACCAGGCTGGGCATGG - Intergenic
1195935141 X:110118206-110118228 ACAAAGAAATATACTGGGCCAGG - Intronic
1195995014 X:110722953-110722975 AAAAAAAAACAGAATGGGCCAGG + Intronic
1196283749 X:113855673-113855695 ATACAGAACCAGGCTGGGCATGG + Intergenic
1196436184 X:115676686-115676708 ATAAAGAAGCAGCTTGGGTACGG + Intergenic
1196900491 X:120378292-120378314 CCAAAGAACCACACTGGGCCTGG - Intronic
1197188001 X:123609733-123609755 ATAAAAAAGCAGAGTCGGCCAGG + Intronic
1197722279 X:129753350-129753372 ACAAAGAAGCAAGCTGGGCGCGG + Intronic
1197948707 X:131871256-131871278 AGAAAGAAACAGGCTGGGCGCGG + Intergenic
1198082610 X:133253328-133253350 AAAAAGTAGCATTCTGGGCCGGG + Intergenic
1198202561 X:134436479-134436501 AAAAAAAAGCAGGCTGGGCGCGG - Intergenic
1199971876 X:152867390-152867412 TTAAAGATGTACACTGGGCCGGG - Intronic
1200561944 Y:4715373-4715395 GTAAAGAATCAGAGGGGGCCGGG - Intergenic
1201352283 Y:13057036-13057058 ATAAAGAAGGGGACCGGGCGTGG + Intergenic
1201548070 Y:15188645-15188667 AAAAAAAAGAATACTGGGCCGGG + Intergenic
1201765685 Y:17571669-17571691 CAAAAGAAGCAGTCTGGGCTTGG + Intergenic
1201835867 Y:18334320-18334342 CAAAAGAAGCAGTCTGGGCTTGG - Intergenic
1202334318 Y:23790819-23790841 ATCAAGAAGCACGCTGGGACTGG - Intergenic
1202536450 Y:25879240-25879262 ATCAAGAAGCACGCTGGGACTGG + Intergenic