ID: 902367384

View in Genome Browser
Species Human (GRCh38)
Location 1:15985702-15985724
Sequence GCTTCCGGGAAGTCACATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902367378_902367384 26 Left 902367378 1:15985653-15985675 CCCAGATCCAACTTTTTTTGGTA No data
Right 902367384 1:15985702-15985724 GCTTCCGGGAAGTCACATCATGG No data
902367380_902367384 19 Left 902367380 1:15985660-15985682 CCAACTTTTTTTGGTAGAAGCAT No data
Right 902367384 1:15985702-15985724 GCTTCCGGGAAGTCACATCATGG No data
902367379_902367384 25 Left 902367379 1:15985654-15985676 CCAGATCCAACTTTTTTTGGTAG No data
Right 902367384 1:15985702-15985724 GCTTCCGGGAAGTCACATCATGG No data
902367376_902367384 30 Left 902367376 1:15985649-15985671 CCGGCCCAGATCCAACTTTTTTT No data
Right 902367384 1:15985702-15985724 GCTTCCGGGAAGTCACATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902367384 Original CRISPR GCTTCCGGGAAGTCACATCA TGG Intergenic
No off target data available for this crispr