ID: 902369203

View in Genome Browser
Species Human (GRCh38)
Location 1:15994730-15994752
Sequence GGCTGGTCACACTGCGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902369188_902369203 16 Left 902369188 1:15994691-15994713 CCCAGTCCCTGGGATGGACCAGC No data
Right 902369203 1:15994730-15994752 GGCTGGTCACACTGCGGAGGGGG No data
902369192_902369203 9 Left 902369192 1:15994698-15994720 CCTGGGATGGACCAGCTGGCCAC No data
Right 902369203 1:15994730-15994752 GGCTGGTCACACTGCGGAGGGGG No data
902369194_902369203 -2 Left 902369194 1:15994709-15994731 CCAGCTGGCCACCTGCTGGCAGG 0: 3
1: 15
2: 1
3: 45
4: 373
Right 902369203 1:15994730-15994752 GGCTGGTCACACTGCGGAGGGGG No data
902369191_902369203 10 Left 902369191 1:15994697-15994719 CCCTGGGATGGACCAGCTGGCCA No data
Right 902369203 1:15994730-15994752 GGCTGGTCACACTGCGGAGGGGG No data
902369197_902369203 -10 Left 902369197 1:15994717-15994739 CCACCTGCTGGCAGGCTGGTCAC No data
Right 902369203 1:15994730-15994752 GGCTGGTCACACTGCGGAGGGGG No data
902369189_902369203 15 Left 902369189 1:15994692-15994714 CCAGTCCCTGGGATGGACCAGCT No data
Right 902369203 1:15994730-15994752 GGCTGGTCACACTGCGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902369203 Original CRISPR GGCTGGTCACACTGCGGAGG GGG Intergenic
No off target data available for this crispr