ID: 902374494

View in Genome Browser
Species Human (GRCh38)
Location 1:16023907-16023929
Sequence GCCATCGGGTGTGTGGTCCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902374485_902374494 21 Left 902374485 1:16023863-16023885 CCCTCGGGGTGCTCATGGCCCTG 0: 2
1: 0
2: 0
3: 21
4: 180
Right 902374494 1:16023907-16023929 GCCATCGGGTGTGTGGTCCGAGG 0: 1
1: 0
2: 0
3: 3
4: 66
902374483_902374494 29 Left 902374483 1:16023855-16023877 CCTGATGACCCTCGGGGTGCTCA 0: 2
1: 0
2: 2
3: 8
4: 90
Right 902374494 1:16023907-16023929 GCCATCGGGTGTGTGGTCCGAGG 0: 1
1: 0
2: 0
3: 3
4: 66
902374489_902374494 2 Left 902374489 1:16023882-16023904 CCTGGTCAGCTATGCCATGAACT 0: 1
1: 0
2: 1
3: 8
4: 77
Right 902374494 1:16023907-16023929 GCCATCGGGTGTGTGGTCCGAGG 0: 1
1: 0
2: 0
3: 3
4: 66
902374488_902374494 3 Left 902374488 1:16023881-16023903 CCCTGGTCAGCTATGCCATGAAC 0: 1
1: 0
2: 4
3: 13
4: 100
Right 902374494 1:16023907-16023929 GCCATCGGGTGTGTGGTCCGAGG 0: 1
1: 0
2: 0
3: 3
4: 66
902374486_902374494 20 Left 902374486 1:16023864-16023886 CCTCGGGGTGCTCATGGCCCTGG 0: 2
1: 0
2: 3
3: 24
4: 249
Right 902374494 1:16023907-16023929 GCCATCGGGTGTGTGGTCCGAGG 0: 1
1: 0
2: 0
3: 3
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902374494 Original CRISPR GCCATCGGGTGTGTGGTCCG AGG Exonic
900374557 1:2347517-2347539 GTCATGGGGTGTGTGGGCCTGGG - Intronic
902292993 1:15447160-15447182 GCCATGGGGTCTGTGCTGCGGGG - Intronic
902374494 1:16023907-16023929 GCCATCGGGTGTGTGGTCCGAGG + Exonic
916370887 1:164092996-164093018 TCCATCTGGTGTGGGGTCTGTGG - Intergenic
924113579 1:240724107-240724129 GCCATCGGGTGTGTGGCGAGCGG - Intergenic
1068120173 10:52776674-52776696 GCCATGGGGTGGGTGGTCAGAGG + Intergenic
1069827463 10:71262869-71262891 CCCATCGACTGTGTGGTCCCAGG - Intronic
1073109837 10:101055127-101055149 GCTATGGGGTTTGTGGTCCAGGG + Intergenic
1073608705 10:104922058-104922080 GGCACCGCGTGTGTGGTCGGAGG + Intronic
1077288839 11:1779549-1779571 GCCATCAGGTGGGTGGTGCTGGG + Intergenic
1077726699 11:4682260-4682282 GGCATCGTGGCTGTGGTCCGCGG - Exonic
1083319700 11:61838218-61838240 GCTTTGGGGTGTGTGGTCCGGGG + Intronic
1091403807 12:196658-196680 GGCCTCAGGTGTGTGGTCAGGGG + Intronic
1104709837 12:130977732-130977754 GCCTTCAGCTGTGTGGTCTGTGG + Intronic
1104909495 12:132233455-132233477 GCCATCGAGTGTGTGGCACTAGG - Intronic
1104909527 12:132233647-132233669 GCCATCGAGTGTGTGGCACTAGG - Intronic
1104909592 12:132234031-132234053 GCCATCGAGTGTGTGGCACTAGG - Intronic
1104909697 12:132234655-132234677 GCCATCGAGTGTGTGGCACTAGG - Intronic
1104909703 12:132234703-132234725 GCCATCGAGTGTGTGGCACTAGG - Intronic
1104909768 12:132235087-132235109 GCCATCGAGTGTGTGGCACTAGG - Intronic
1104909784 12:132235180-132235202 GCCATCGAGTGTGTGGCACTAGG - Intronic
1113117602 13:106890275-106890297 TCCATCCGTTGTGTAGTCCGAGG + Intergenic
1128653139 15:69434957-69434979 GCCCTCAGGTGTGTAGGCCGTGG + Intronic
1136288085 16:29255596-29255618 GCCCTGGGGTGTGTGTTCTGGGG + Intergenic
1141938465 16:87258170-87258192 GCCATGGGGTTTGTGGTGTGAGG - Intronic
1142211040 16:88808566-88808588 GCCATCGGGAGTGTGGCTGGGGG + Exonic
1144757885 17:17691290-17691312 GCCAGCTGGTGTGTGGTTCCGGG - Intronic
1146910660 17:36646467-36646489 GCCATAGGGTCAGTGGTCCTGGG + Intergenic
1148698799 17:49576266-49576288 TCTATCTGGTGAGTGGTCCGAGG + Exonic
1151742819 17:75995574-75995596 GCCAGCGGGTGTCAGGTCCATGG - Intronic
1152146257 17:78570509-78570531 GCCATCAGATGTGTGGGCCTAGG - Intronic
1156463445 18:37334401-37334423 GCCCTCGGATGTGGGGTCCTGGG + Intronic
1157478795 18:48039865-48039887 GCCCTCGGGTGTGGGGCACGGGG - Intronic
1161106709 19:2447386-2447408 GGCAGCGGGTGTGTGGGCAGCGG + Intronic
1161221460 19:3119997-3120019 GCCCTCGTCTGTGTGGTCAGTGG + Intronic
1162158754 19:8696980-8697002 GGCATGGGGTGGGTGGTCAGAGG + Intergenic
1165136486 19:33673100-33673122 GCCCAGGGCTGTGTGGTCCGTGG + Intronic
1165916519 19:39264384-39264406 GCGACCGAGTGTGTGGGCCGCGG + Intergenic
934856965 2:97735477-97735499 GCCATCGGGTGGGTGGGGCCGGG + Intronic
937202993 2:120217754-120217776 GCCCTCGGCAGTGTGGTCCAAGG - Intergenic
937345069 2:121120453-121120475 GCCACCTGGTTTGTGGTCCTTGG + Intergenic
938343260 2:130549261-130549283 GCCATGGGCTGTGTGCTCCCGGG - Intronic
938346573 2:130571461-130571483 GCCATGGGCTGTGTGCTCCCGGG + Intronic
947538664 2:230958788-230958810 GCCATAGGGTGAGAGGTCCTTGG - Intronic
1172163859 20:32886824-32886846 GACAGTGGGTGTGTGGTCCTGGG - Intronic
1176427060 21:6554644-6554666 GCCATCCAGTCTGTGGTCCCTGG - Intergenic
1179702551 21:43162966-43162988 GCCATCCAGTCTGTGGTCCCTGG - Intergenic
1179782699 21:43712482-43712504 GGCGTGGGGTGTGTGATCCGTGG - Intergenic
1180065654 21:45410948-45410970 GCCATAGGGTGTGTGGACTCGGG - Intronic
1183174011 22:36209217-36209239 CCCATCGGGTGTATGGACTGGGG + Intergenic
1185092901 22:48785952-48785974 GCCCTCGGGTGTGTGGTGAAGGG - Intronic
951913006 3:27770779-27770801 GGCAAGGGGTCTGTGGTCCGTGG - Intergenic
959663525 3:108896148-108896170 GCCAGGGGCTGTGGGGTCCGGGG + Intergenic
969369164 4:6720380-6720402 GCTGTGGGGTGTGGGGTCCGCGG + Intergenic
1002861132 6:1080503-1080525 GGCCTCGGCAGTGTGGTCCGTGG - Intergenic
1006985898 6:38175325-38175347 GCCATCAGGTGTCTGCGCCGGGG - Intronic
1019355951 7:579096-579118 TCCATGGGGTGGGTGGTCTGTGG - Intronic
1019526114 7:1481240-1481262 GCGAGCGGGTGGGTGATCCGAGG - Intronic
1019550500 7:1599898-1599920 ACCTTCGGGGCTGTGGTCCGAGG + Intergenic
1032470329 7:132173930-132173952 GCCACCAGCTGTGTGGTCCCAGG + Intronic
1037786864 8:21908551-21908573 GTCACCAGGTGTGTGGTCCTGGG - Intergenic
1038688787 8:29742524-29742546 GCCTTAGGGTGTGTGGCCCTGGG - Intergenic
1049254131 8:141604945-141604967 GCCCTTGGCTGTGTGTTCCGTGG + Intergenic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1053365847 9:37521958-37521980 GCCATCAGGTGGCTTGTCCGAGG - Intronic
1055347058 9:75350430-75350452 TCCATCGGGAGGGTGGTCAGAGG - Intergenic
1057306929 9:93917994-93918016 GGCCTCGGGTGGATGGTCCGGGG - Intergenic
1057705189 9:97390725-97390747 GCTCTCAGGTGTGTGGTCTGTGG - Intergenic
1062349150 9:136130711-136130733 GGCGTCGGGGGTGTGGTCCCTGG - Intergenic
1198386375 X:136133049-136133071 TCTATCGGGAGTGTGGTCAGCGG - Intergenic