ID: 902375017

View in Genome Browser
Species Human (GRCh38)
Location 1:16026517-16026539
Sequence GGCCCTGCAGAGGGAAGGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 663
Summary {0: 1, 1: 1, 2: 4, 3: 60, 4: 597}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902375017_902375027 17 Left 902375017 1:16026517-16026539 CCCACCCTTCCCTCTGCAGGGCC 0: 1
1: 1
2: 4
3: 60
4: 597
Right 902375027 1:16026557-16026579 GTAATGATCGCTGCCTACCTGGG 0: 1
1: 0
2: 1
3: 3
4: 52
902375017_902375026 16 Left 902375017 1:16026517-16026539 CCCACCCTTCCCTCTGCAGGGCC 0: 1
1: 1
2: 4
3: 60
4: 597
Right 902375026 1:16026556-16026578 TGTAATGATCGCTGCCTACCTGG 0: 1
1: 0
2: 1
3: 1
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902375017 Original CRISPR GGCCCTGCAGAGGGAAGGGT GGG (reversed) Exonic
900159155 1:1215346-1215368 GGCCCTGGAGAGGGAGGGAGTGG + Intergenic
900255667 1:1697273-1697295 GCCCCTGCGGAGAGCAGGGTGGG - Intronic
900264337 1:1749896-1749918 GCCCCTGCGGAGAGCAGGGTGGG - Intergenic
900291791 1:1926774-1926796 GGGCATGCTGAGGGCAGGGTGGG + Intronic
900418496 1:2545798-2545820 AGCCCAGGGGAGGGAAGGGTCGG + Intergenic
900496507 1:2978388-2978410 GCCCCACCAGAGGGGAGGGTGGG + Intergenic
900665819 1:3814875-3814897 GGGCCTGCAGGGGGAAGGCACGG + Exonic
900957027 1:5892460-5892482 GGCCCTGCACAGGGTAGTGCTGG - Intronic
901002326 1:6154950-6154972 GGCCCTGCCGGGGGTCGGGTGGG - Intronic
901174664 1:7290202-7290224 GGCCTGGCAGAGGGAAGGGATGG + Intronic
901206803 1:7502190-7502212 GGACCTCCAGAGGGGAGAGTGGG - Intronic
901211290 1:7527553-7527575 GGCCCTGCAGAGGGGCTGGATGG + Intronic
901569187 1:10145636-10145658 GGCCCTGCATAAGGCAGGGAAGG - Intronic
902068115 1:13706166-13706188 GACACTGCAGAGGGAAGGAATGG - Intronic
902211486 1:14907860-14907882 GGCTCTGGGGAGAGAAGGGTTGG - Intronic
902232508 1:15036700-15036722 CTCCATGCAGAGGGAGGGGTAGG + Intronic
902283028 1:15388294-15388316 GGGCCTGGGGAGGGAAGGGAAGG - Intronic
902292777 1:15446277-15446299 GGCCCAGCAGAGGAGAGGGATGG + Intronic
902375017 1:16026517-16026539 GGCCCTGCAGAGGGAAGGGTGGG - Exonic
902379989 1:16048324-16048346 GGCCCTGCAGAGAGAAGGGTGGG - Exonic
902416407 1:16242418-16242440 GGCCATGCTGAGGGAGGGGTGGG - Intergenic
902449788 1:16489801-16489823 AGACATGCCGAGGGAAGGGTTGG + Intergenic
902504647 1:16931259-16931281 AGACATGCCGAGGGAAGGGTTGG - Intronic
903216439 1:21846079-21846101 GTCCCTGCAGTGGGACGGGAAGG - Intronic
903232137 1:21928300-21928322 GGCCCTGCAGAGAGCATGGCTGG + Intronic
903354906 1:22740703-22740725 CGCCAGGCAGAGGGAAGAGTGGG - Intronic
903439155 1:23374521-23374543 TTCTCTGCAGGGGGAAGGGTGGG - Intergenic
903443031 1:23402498-23402520 GGCCCGGCAGTGGGAGGGATGGG - Intronic
904629696 1:31831569-31831591 GGCTGGGCAGAGGGAAGGGAAGG - Intergenic
904871349 1:33620763-33620785 GACCCTGCAGGGTAAAGGGTAGG - Intronic
905182305 1:36175021-36175043 GGCTCTGGAGGGGGAAGGGCTGG - Intronic
905207750 1:36352626-36352648 TGCTCTGCAGGGGGAAGGGAGGG - Intronic
905561032 1:38927456-38927478 GGCCTTGCAGAGGAAAAGGTTGG - Intronic
905651918 1:39662342-39662364 GGCCCTGTTGAGGGTAGGGGTGG - Intronic
905798562 1:40829286-40829308 GGCTCTGCAGAGGAAAGTTTGGG + Intronic
905896200 1:41547463-41547485 GGCCCTGCAGGTGGAGGGGATGG + Intronic
906063048 1:42960714-42960736 GGCCCTGCAGACAGCAGGGGAGG - Intergenic
906071674 1:43021471-43021493 GGGCCTGCAGAGGAAAGCATGGG + Intergenic
906119284 1:43377518-43377540 GGAGCTGCAGAGGGAAGGAGAGG + Intergenic
906128520 1:43442192-43442214 AACCTTGCAGAGGGGAGGGTGGG + Intronic
906208297 1:43998550-43998572 GGCCCTGCAGAAGGAAATGGAGG - Intronic
906639841 1:47435084-47435106 GGCCAGGCAGAGGCAAGGGCTGG + Intergenic
907318941 1:53590776-53590798 GGCCGTGCAGAGGGCAGGGTGGG + Intronic
907331219 1:53672899-53672921 GTCCCAGCAGAGAGTAGGGTAGG - Intronic
907460367 1:54602022-54602044 GGCCTTCCAGAGGGTAGCGTGGG + Intronic
907930805 1:58998095-58998117 GACCCTGCATATGGAAGAGTGGG + Intergenic
908128054 1:61050229-61050251 GCCCCTGGAGAGGGGAGGGCAGG - Intronic
909721469 1:78775876-78775898 GGCTGTGCAGTGGGAAGGGAAGG + Intergenic
912454137 1:109786602-109786624 GGCCCTGCAGAGAGCAGATTTGG - Intergenic
912795748 1:112692580-112692602 GGCCCTGAAGAAGGAAGCCTTGG - Intronic
913069336 1:115285125-115285147 GGACCTGCAGAGAAGAGGGTGGG - Intergenic
913532063 1:119740529-119740551 GACCTTGCAGAGGGAGGGGGAGG + Intronic
913986731 1:143572510-143572532 GCCCCTGAAGAGGGAGTGGTAGG + Intergenic
914205132 1:145520285-145520307 GCCCCTGAAGAGGGAGTGGTAGG + Intergenic
914259407 1:145986289-145986311 GGCCCAGCAGAGAGTAGGGAAGG + Intergenic
914370446 1:147019944-147019966 GCCCCTGAAGAGGGAGTGGTAGG - Intergenic
914484248 1:148093466-148093488 GCCCCTGAAGAGGGAGTGGTAGG + Intergenic
914859609 1:151375023-151375045 GGTGCTCCAGAGGGAAGGATAGG - Intergenic
914922828 1:151859172-151859194 TGACCTGCAGAGCTAAGGGTCGG + Intergenic
914980511 1:152410702-152410724 GGCACTGAAGTGGGAAGGGCGGG - Exonic
915111154 1:153565472-153565494 TGTCCTGCTGAGGGCAGGGTGGG - Intronic
915453206 1:156021027-156021049 GGCACTACAAAGGGAAAGGTGGG - Intergenic
915555364 1:156658013-156658035 GCCCCAGGAGAGGGAAGGTTAGG - Intronic
915563979 1:156703803-156703825 GTTCCTGCAGAGGCAAGGCTGGG + Intronic
915932769 1:160070226-160070248 GGCGCTGCGGAGGGAGGGGGCGG - Exonic
915973779 1:160371657-160371679 GGCCCTGGGGAGGCAGGGGTTGG + Exonic
916291543 1:163172033-163172055 AGCGTTCCAGAGGGAAGGGTGGG + Intronic
916377731 1:164173697-164173719 GGGCCTGGATAGGGAAGGGCAGG - Intergenic
917312842 1:173694713-173694735 GACCCTGAAGGGGGAAGAGTGGG - Intergenic
917512743 1:175681753-175681775 GCAACTGCAGAGGGAAGGGCTGG + Intronic
918066770 1:181106610-181106632 AGCCCTAGAGAGGAAAGGGTAGG + Intergenic
918782402 1:188718162-188718184 GGGACTTAAGAGGGAAGGGTGGG - Intergenic
919142346 1:193588599-193588621 TTCCCTGCAGAGGGAAAGGAGGG - Intergenic
919536676 1:198796632-198796654 GGCCATGCTGATGGAAGGGGTGG + Intergenic
919767471 1:201136525-201136547 GGCTCTGCAAAGGGAATGCTGGG - Intronic
919880045 1:201895187-201895209 GGCCATGCAGGGTGAAGGGTAGG + Intergenic
920372653 1:205489282-205489304 GGCCATGCCAATGGAAGGGTAGG + Intergenic
921406925 1:214790458-214790480 GGCCCTGTAGGGGGTGGGGTAGG - Intergenic
921576538 1:216841680-216841702 GGCCCTGCAGGCTGAAGGGGAGG - Intronic
922467724 1:225855795-225855817 GGGGCTGCAGTGGGATGGGTGGG - Intronic
922618594 1:226977532-226977554 GGCCCTTCAGTGGGAGGGGCAGG + Intronic
922722512 1:227906056-227906078 GGCCGAGCAGACGGAAGGGAGGG + Intergenic
922724098 1:227914572-227914594 GGCCCTGCGCAGGGTTGGGTGGG + Intergenic
922750030 1:228065956-228065978 GGGCCTACAGATGGAAGGGCAGG - Intergenic
923330261 1:232917336-232917358 GGCCCTGCAGATGGGAGAGGGGG + Intergenic
923461877 1:234215185-234215207 GGCCCTGGAGAGGGATTGGAAGG + Intronic
923614343 1:235524462-235524484 GGCCCTGCAGTGGGGTGGGGTGG + Intergenic
923629845 1:235642610-235642632 GGCCAGGGAGAGGGCAGGGTTGG + Intronic
924052488 1:240092551-240092573 GGGCCTGCCGAGGCTAGGGTCGG + Exonic
924733263 1:246731513-246731535 GGCCCAGCAGAATGAAGGGAGGG + Intronic
1063126785 10:3142804-3142826 AGCCCTGCAGATGGCAGGGCTGG - Intronic
1063460526 10:6212492-6212514 GGCCCTGCCGAGGGAAGGGCCGG - Intronic
1064021219 10:11810708-11810730 GGGCCTGTAGGGGGAAGGGAAGG - Intergenic
1065020269 10:21496740-21496762 GGCGCTGCAGAGGGTACGGTGGG - Exonic
1065155521 10:22866316-22866338 GGCTCTTCAGAAAGAAGGGTGGG - Intergenic
1065240230 10:23696240-23696262 AGCCCTGCAGAGGGCAGGCGAGG + Intronic
1067703356 10:48589270-48589292 GGCTCTGCAGAGGGGAAGGAAGG - Intronic
1067841052 10:49679766-49679788 GGCCCTGCAGGCGGAAGGTGTGG - Exonic
1069571079 10:69494850-69494872 GGCCCCACAGTGGGAAGGGGCGG - Intronic
1069572567 10:69503302-69503324 GCCCCTGCAAAGGAAAGGGAGGG - Intronic
1069920268 10:71811936-71811958 TTCCCTGCAGGGAGAAGGGTTGG - Exonic
1070615005 10:77962753-77962775 GGCCCTGTAAAGGGAATAGTTGG + Intergenic
1071568609 10:86684416-86684438 CCCCCTGCAGAGGGCAGTGTTGG - Intronic
1072961989 10:99937690-99937712 GGCCCAGCTGAGGGCAGGGTTGG - Intronic
1073062588 10:100741453-100741475 GGCCAGGCAGGGGGAAGGGCGGG + Intronic
1073575028 10:104615459-104615481 AGCCCTGCAGATGGGAGGATGGG - Intergenic
1074395762 10:113096830-113096852 CTCCCTCCAGAGGGGAGGGTGGG + Intronic
1074770744 10:116731992-116732014 GGTCCTGCAGAGAGGAGGGGTGG + Intronic
1075521015 10:123143498-123143520 GGTCCTGGAAATGGAAGGGTGGG - Intergenic
1076469943 10:130711266-130711288 GCTCCTGCAGAGGGCAGGGCAGG + Intergenic
1076769558 10:132655662-132655684 AGCCCTGCAGTGGGAGGGGTGGG + Intronic
1077014084 11:392373-392395 GGCCCTGCAGGGGCCAGGCTGGG - Intergenic
1077187177 11:1240613-1240635 GGCCGTGCTGAGGGATGGGACGG - Intronic
1077369128 11:2173392-2173414 GGCCAGGAAGTGGGAAGGGTTGG - Intergenic
1077378124 11:2215161-2215183 GGACCTGCAGAGGCTGGGGTGGG - Intergenic
1077506168 11:2930876-2930898 GTGCCGGCAGAGGGCAGGGTTGG + Intergenic
1077643845 11:3905849-3905871 GCCCTTGCAGGGGGCAGGGTGGG + Intronic
1078048074 11:7936372-7936394 TGCCCTGAATAGGGAGGGGTTGG - Intergenic
1080411399 11:32028653-32028675 GGCCATGGAGAGGGCAGTGTGGG - Intronic
1081803410 11:45875435-45875457 GGACCTGCAGAGGAACAGGTTGG + Intronic
1081836916 11:46163344-46163366 GGCCCTGAGGTGGGAGGGGTAGG - Intergenic
1082009036 11:47438115-47438137 GCCCCTGCAGAGGGCAGGCAAGG - Intronic
1083333295 11:61909056-61909078 GACCCTGGAGAGGGAAGGGAGGG + Intronic
1083438103 11:62656905-62656927 GGCCCTGAGAAGGGAAGTGTTGG - Intronic
1083472196 11:62891441-62891463 GGACATGGACAGGGAAGGGTGGG - Intergenic
1083638122 11:64131167-64131189 GGCACTGCAGAGGGAAATGGGGG + Intronic
1083782574 11:64925829-64925851 GGCTCTGCGGAGGGAACGGCGGG - Exonic
1084049828 11:66592454-66592476 GGCCCTGCTGAGGGCAGAGCAGG - Exonic
1084066191 11:66705645-66705667 GGCACTGGAGAGGGAGGGGCTGG - Intronic
1084420938 11:69060218-69060240 AGCTCTGCAGTGGGCAGGGTTGG - Intronic
1084603836 11:70161605-70161627 GGACCTCTAGAGGGAGGGGTAGG - Exonic
1084666493 11:70579197-70579219 CGCCCAGCACAGGGCAGGGTTGG - Intronic
1084939864 11:72606772-72606794 GCCCAGGCAGAGGGAGGGGTGGG + Intronic
1085281667 11:75335043-75335065 GGCCCTGGAGCGTGAAGGGCTGG + Intronic
1085886336 11:80526729-80526751 GACCCAGAAGAGGGGAGGGTTGG + Intergenic
1086953420 11:92913301-92913323 GACACTGCAGAGAGGAGGGTGGG + Intergenic
1089020997 11:115214777-115214799 AGGCCTGCAGGGGGAAGGGGAGG + Exonic
1089067795 11:115675070-115675092 TGGCCTGCAGAGGGGAGGGTGGG + Intergenic
1089215861 11:116834318-116834340 GGCCCTGCAGAGAGAGGGTAGGG + Intergenic
1089317345 11:117600950-117600972 GGCCCTGCAGGAGGACGGGAGGG + Intronic
1089945066 11:122462034-122462056 GGCCCTGCAGCTGGAGAGGTAGG - Intergenic
1090074944 11:123574496-123574518 GGCCCTGGGGAAGGAAGGGAAGG + Intronic
1091361655 11:134982715-134982737 CGCTCTGCAGCGGGGAGGGTGGG + Intergenic
1092057632 12:5521122-5521144 GGCCCTGCAGAGGTATCGGGAGG + Intronic
1092825699 12:12396430-12396452 GGCCCTGCGGAGGGTGGGGTGGG + Intronic
1096014120 12:48252130-48252152 GGGACTACAGAGGGAATGGTTGG - Intergenic
1096139775 12:49233496-49233518 GGCCCTGGAGATGGAATGTTGGG - Intronic
1096234681 12:49918078-49918100 GGCCCAGCAGTGGGCAAGGTAGG + Intergenic
1096596711 12:52700487-52700509 TTCCATGCAGAGGGAATGGTAGG + Intronic
1098383934 12:69898503-69898525 GCCCCTGCAGAGGGATGGACAGG - Intronic
1099826703 12:87784650-87784672 GGCCCGGCGAAGGGAGGGGTAGG + Intergenic
1100569395 12:95832808-95832830 GACCCAGCAGAGGGCAGGGATGG + Intergenic
1101479659 12:105084617-105084639 GGCCTTGCAGCTGGTAGGGTGGG - Intergenic
1102525895 12:113512206-113512228 GGCCCTGCAGAGCTAGGGGTGGG + Intergenic
1102549163 12:113678651-113678673 GGCCCGGCAGAGGGCAAGGTTGG + Intergenic
1103484554 12:121273989-121274011 GGCCCTGCTGGGGGCAGGGAAGG + Intronic
1104048829 12:125183277-125183299 GGCGCTGCAGAAGGAAGGTCAGG - Intergenic
1104487647 12:129165198-129165220 GCCCCTGGAGAGGGTAGGATGGG + Intronic
1104600812 12:130152163-130152185 TGCCCTGAACAGGGAAGGGAGGG + Intergenic
1104813801 12:131634262-131634284 GGACCTGCACAGGGATGGGGAGG + Intergenic
1104814908 12:131640071-131640093 GGCACTGCAGGTGGAGGGGTTGG - Intergenic
1105024213 12:132837949-132837971 AGCCCTGCACTGGGAAGGGAAGG - Intronic
1105300045 13:19125159-19125181 GGCCCTGGACAGGGAAGAGATGG - Intergenic
1105699637 13:22926502-22926524 GGAGCTGCGGAGGGAAGGGGAGG + Intergenic
1105806239 13:23953213-23953235 GGCCCTGCAGATGGAGTTGTTGG - Intergenic
1105851523 13:24340188-24340210 GGAGCTGCTGAGGGAAGGGGAGG + Intergenic
1105996131 13:25673836-25673858 GGCTCTGCACAGGGAAAGGAGGG + Intronic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1107014138 13:35695310-35695332 GGCCCAGGAGTGGGAGGGGTGGG - Intergenic
1108186421 13:47892647-47892669 GTACCTGCACAGAGAAGGGTAGG + Intergenic
1108554713 13:51581792-51581814 GGACCTGCAGTGGAGAGGGTTGG - Intergenic
1110478289 13:75943789-75943811 GGGCCTGCCGGGGGAAGGTTGGG + Intergenic
1111901327 13:94202767-94202789 GGCCCCTCAGAGGGATGGGATGG + Intronic
1112173092 13:96994152-96994174 GTCCCTGCAGCAGGCAGGGTCGG - Intronic
1112879914 13:104094334-104094356 TTCCCAGCAGAGGGAATGGTTGG - Intergenic
1113628440 13:111863680-111863702 GGCCGTCCATAGGGAAGGGATGG + Intergenic
1113749780 13:112769150-112769172 GGCCGGGCATGGGGAAGGGTAGG - Intronic
1113864723 13:113513350-113513372 GGCCCTGCAGAGGCAGAGCTGGG + Intronic
1114266991 14:21078429-21078451 GGCACTGCAGAGGGATGGGGGGG + Exonic
1114522154 14:23346642-23346664 GGCCGCTCAGAGGGCAGGGTTGG + Exonic
1114559362 14:23579160-23579182 AGCTCTGCAGAGGGAAGGGCAGG + Intergenic
1115346544 14:32348800-32348822 GGCCCTGCAGAGTGTTGGGTGGG - Intronic
1116356424 14:43936874-43936896 GGCAGTGCAGAGGGAAATGTGGG - Intergenic
1116540208 14:46093137-46093159 GCCCATGCAGAGGGAAGGGAGGG - Intergenic
1117400921 14:55358022-55358044 GTCCCAGAATAGGGAAGGGTGGG - Intronic
1117457395 14:55912102-55912124 GGCCTAGCAGAGGGAGGGATGGG - Intergenic
1118720009 14:68587200-68587222 GGCACTGCAGAGGTTGGGGTTGG + Intronic
1119180972 14:72605060-72605082 GGCACTGTAGAGGGCAGGTTTGG + Intergenic
1119428920 14:74553059-74553081 AGCCCTGCAGAGAGAGGGCTTGG + Exonic
1119458934 14:74781823-74781845 GGCCCTGCAGAAGACAGGGAAGG - Exonic
1119925431 14:78489067-78489089 GGCCCTGGAGAGGGAGAGCTTGG + Intronic
1120830381 14:88992671-88992693 GGCCCTGCAGCCAGAAGGGAAGG - Intergenic
1121332125 14:93056219-93056241 GGCCAAGCAGAGGGAACTGTCGG + Intronic
1121336945 14:93083387-93083409 GGCCCTCCCCAGGGCAGGGTGGG + Intronic
1121661718 14:95640111-95640133 GGCCCTGCAGAGTGCTGGGGTGG - Intergenic
1122306116 14:100767883-100767905 TGCCCTGCAAAGGCAGGGGTAGG + Intergenic
1122713218 14:103676131-103676153 TCCTCTGCAGAGGGAAGTGTAGG + Intronic
1122922553 14:104886021-104886043 GGCCCTGTGGAGAGGAGGGTGGG - Exonic
1122967201 14:105136930-105136952 GGAGCTGCAGAGGGAAAGGGAGG - Intergenic
1123000927 14:105293702-105293724 GACTGTGCAGAGAGAAGGGTGGG - Intronic
1123076331 14:105669158-105669180 GGCTCTGCAGAGAGAAGATTGGG + Intergenic
1123091031 14:105742382-105742404 GGCTCTGCAGAGAGAAGATTGGG + Intergenic
1123096670 14:105770146-105770168 GGCTCTGCAGAGAGAAGATTGGG + Intergenic
1123096717 14:105770334-105770356 GGCTCTGCAGAGAGAAGATTGGG + Intergenic
1123096763 14:105770522-105770544 GGCTCTGCAGAGAGAAGATTGGG + Intergenic
1123696304 15:22881455-22881477 GGACCTGCAGATGGATGGGACGG + Intronic
1125019626 15:34971848-34971870 GGCCTTCCAGAGGGTTGGGTGGG - Intergenic
1125531779 15:40418334-40418356 GGGCCTGCTGTGGGCAGGGTGGG - Exonic
1125675962 15:41502769-41502791 GCCTCTGCAGAGGGTGGGGTGGG - Exonic
1126884191 15:53132122-53132144 GGCCCCTCAGAAGGAAGGGTGGG + Intergenic
1128087278 15:64894810-64894832 GGCCCTGCAGAGAGAGGGGAGGG + Intronic
1128225719 15:65999968-65999990 GGCAGTGCACAGGGAAGGGAAGG + Intronic
1128691173 15:69726017-69726039 GTCCCTGCAGAGGGGCTGGTTGG - Intergenic
1128772749 15:70294651-70294673 GGCCCTGGGGCGGGAAGGGTTGG + Intergenic
1129322584 15:74783066-74783088 GGCCCTGTACAGGGAAGGGCAGG - Intronic
1129516926 15:76162701-76162723 GGCCCTGAAGCTGGCAGGGTGGG + Intronic
1129584466 15:76848856-76848878 GGCCCTGCCTAGTGAAGAGTAGG - Intronic
1129584707 15:76850325-76850347 GGCCCTGCCTAGTGAAGAGTAGG - Intronic
1129700848 15:77768074-77768096 GGCCCCACAGAGGGGAGGGGAGG - Intronic
1129718420 15:77864953-77864975 GGCCCTGCACAGAGCAGGGGTGG - Intergenic
1129752836 15:78077731-78077753 GGCCGTGCGGAGCGAAGGGGCGG - Intergenic
1129761205 15:78130352-78130374 TGCCATGCAGAGGGCAGGGAAGG + Intronic
1130063964 15:80589727-80589749 GGCTTAGCAGAGGGAAGGCTGGG - Intronic
1130098936 15:80877320-80877342 GGCCCTGCAGAAGGGAGCCTAGG - Intronic
1130678722 15:85977811-85977833 GGGGCTGCAGAGGGAGAGGTGGG - Intergenic
1132357323 15:101181576-101181598 GGGGCTGGAGAGAGAAGGGTCGG - Intronic
1132550850 16:553296-553318 GGACCTGTGGAGGGCAGGGTGGG - Intronic
1132574069 16:656697-656719 GGCCGTGCTGAGGGGAGGGCAGG - Intronic
1132641346 16:979961-979983 GGCACTGCAGACGGAGGTGTGGG + Intronic
1132743826 16:1428645-1428667 GGGCCTGCGGAGGGAAGGGCGGG - Intergenic
1132905519 16:2280693-2280715 GGCCTTGCTGAGTGAAGGGATGG - Intronic
1132937158 16:2486972-2486994 GGCCCTGGAGGAGGAAGGGTTGG - Intronic
1132941867 16:2512535-2512557 GGAGCTGGAGAGGGAAGGGCAGG + Intronic
1132981909 16:2742623-2742645 GTCCCTGCAAAGGGCAGAGTGGG - Intergenic
1133008733 16:2898483-2898505 GTCCCTGCAGAGGGCAGAGGGGG + Intronic
1133057025 16:3150431-3150453 GGGCCTGCTGCGGGGAGGGTGGG + Intergenic
1133079061 16:3304310-3304332 TTCCAGGCAGAGGGAAGGGTAGG - Intronic
1133221238 16:4319998-4320020 GCCCCTGCTGGGGGATGGGTGGG + Intronic
1133318656 16:4899443-4899465 GGCCCTGCAGGAGGTAGGGAAGG - Intronic
1133497004 16:6328267-6328289 GGCACTGGAGGGGAAAGGGTGGG + Intronic
1133610180 16:7426137-7426159 GACCCTGCCTAGGCAAGGGTGGG - Intronic
1134090082 16:11386906-11386928 GGCCCTGCAGAGGGGTGAGGAGG - Intronic
1134644808 16:15857488-15857510 GGCTGTGCAGCGTGAAGGGTAGG + Intergenic
1135162919 16:20113436-20113458 GGACCTGGAGGGGTAAGGGTGGG + Intergenic
1135623647 16:23976865-23976887 GTTACTGCAGAGGGAAGGGTAGG + Intronic
1136349061 16:29695251-29695273 GGCTCTGGAGAGGGGAGGGGAGG - Intronic
1136365310 16:29806734-29806756 GGCCCAGCACGGGGAAGGGGGGG - Exonic
1136461960 16:30417080-30417102 AGCACTGCAGAGGGAACGGCAGG - Intronic
1137517371 16:49158495-49158517 GGCCCTGCAGAGTTAAGGGGTGG - Intergenic
1137587958 16:49675466-49675488 GGCACCGCTGAGGGAGGGGTGGG - Intronic
1137690397 16:50422892-50422914 GGCCCTGCAGAGGGCAAATTAGG + Intergenic
1138093273 16:54193789-54193811 GGCACTGCAGAGGGAAAGGCCGG - Intergenic
1138320510 16:56107269-56107291 GGCACTGGAGAGGGTAGGGGTGG - Intergenic
1139467025 16:67159592-67159614 GGCCCTGCAGGAGAGAGGGTGGG - Intronic
1139483712 16:67244860-67244882 GGCCCTCTAGAGGGAAGAGGTGG - Intronic
1140743511 16:77962127-77962149 GGCCCTGCAGATGTGAGGGGTGG - Intronic
1141169185 16:81680507-81680529 GGCCCCGGAGAGGAAAGGGTGGG + Intronic
1141432470 16:83977558-83977580 GGCTCTGTGGAGGGATGGGTGGG - Intronic
1141662093 16:85446887-85446909 GCCCGTGCAGAGGGAACGGAAGG - Intergenic
1141788968 16:86220096-86220118 GGCCCTTCGGAAGGAGGGGTCGG - Intergenic
1141881817 16:86865319-86865341 GCCCCTGCAGGGGGTTGGGTGGG - Intergenic
1142118071 16:88370739-88370761 GGCCGAGCTGTGGGAAGGGTGGG + Intergenic
1142141637 16:88475277-88475299 GGGCCATCAGAGGGGAGGGTGGG + Intronic
1142178999 16:88658138-88658160 AGCCCTGCTGAGGGCAGGGGGGG + Intronic
1142228405 16:88888453-88888475 GGCCCTGCAGGGGTGTGGGTGGG + Intronic
1142276663 16:89122355-89122377 GGCCCTACAGAGGGCAGGGGAGG - Intronic
1142621630 17:1169092-1169114 GGCCCTGCAGGGGAAAGAGGAGG + Intronic
1143090875 17:4448544-4448566 GGCAGGGCAGAGGGAAGGCTGGG - Intronic
1143490591 17:7283366-7283388 GGGCCTGCAGCTGGCAGGGTGGG + Intronic
1143601195 17:7947396-7947418 GTAGCTGGAGAGGGAAGGGTTGG - Intronic
1144750861 17:17647161-17647183 GGGGCTGCAGGGGGAAGGGATGG + Intergenic
1146229478 17:31095270-31095292 GGGGCGGCGGAGGGAAGGGTGGG - Exonic
1146305323 17:31725828-31725850 GGGCCTGCTGAGGGGAGGGGAGG + Intergenic
1146399783 17:32493724-32493746 GGCCGTGTAGAGGGCGGGGTGGG + Exonic
1146399937 17:32494381-32494403 GACCCTGCAGAGGGAAGGGGTGG - Exonic
1146585809 17:34080582-34080604 GTACCTGCAGAGGGAAGGATGGG + Intronic
1146845327 17:36178711-36178733 GGCCCTGGAGAGGGGTGGGCAGG - Intronic
1146873543 17:36390554-36390576 GGCCCTGGAGAGGGGTGGGCAGG - Intronic
1146880901 17:36441642-36441664 GGCCCTGGAGAGGGGTGGGCAGG - Intergenic
1146913111 17:36660663-36660685 GGCCCGGCAGAGAGCAGGGAAGG + Intergenic
1147018311 17:37510282-37510304 AGCCCTGCAGTGGGAAGGCCTGG - Intronic
1147065846 17:37922319-37922341 GGCCCTGGAGAGGGGTGGGCAGG + Intergenic
1147375471 17:40020147-40020169 GGGCATGGAGAGGGAAGGGAGGG + Intronic
1147845011 17:43398985-43399007 GGCTCTGCAGAGGCAGCGGTTGG + Exonic
1148145618 17:45362769-45362791 GTCCTTGCAGAGGGGAGGGAAGG + Intergenic
1148157482 17:45432200-45432222 GGCCCTGGTGAGGGAAGAGGTGG - Intronic
1148166948 17:45490459-45490481 GGCGGTGCAGGGGGAAGGCTGGG + Intronic
1148735757 17:49864083-49864105 TGTCCTGCAGGCGGAAGGGTGGG + Intergenic
1148765678 17:50037067-50037089 GGGCCTGCAAAGGGCAGGGAAGG + Intergenic
1149443251 17:56692732-56692754 GTCCCTCCAGTGGGAAGGGGTGG - Intergenic
1150398127 17:64836863-64836885 GGCGGTGCAGGGGGAAGGCTGGG + Intergenic
1150431395 17:65120804-65120826 GGCCCTACAGAGTGAAGGACAGG + Intergenic
1151215638 17:72574925-72574947 GGGCCTGGAGAAGGGAGGGTGGG - Intergenic
1151411803 17:73935425-73935447 CTCCCTGCAATGGGAAGGGTTGG - Intergenic
1151576702 17:74956052-74956074 GGCTCTGCAGGGGGCAGGGAGGG - Intronic
1151683432 17:75633699-75633721 GGCCTTCCTGAGGGCAGGGTGGG + Intronic
1151714545 17:75824833-75824855 GGGCCTGAGCAGGGAAGGGTGGG + Exonic
1152068882 17:78125564-78125586 GTCCCTGCAGAGGGACGGGGGGG + Intronic
1152122465 17:78427150-78427172 GACCCTGCAGTGGGTGGGGTGGG - Intronic
1152494391 17:80660836-80660858 GCTCCTGCTGAGAGAAGGGTGGG - Intronic
1152537445 17:80959050-80959072 GGCCCAGCAGAGGGGAGGCCTGG + Intronic
1152633324 17:81420410-81420432 GGCCCAGCAGCGGGAAGACTGGG - Intronic
1152789813 17:82273056-82273078 GGGTCTGGAGAGGGGAGGGTTGG - Intronic
1152873595 17:82772798-82772820 GCCCCTGCACAGGGATGGGGTGG + Intronic
1152938021 17:83152003-83152025 GGCCCTGCAGGGTCAAGGGGAGG + Intergenic
1153627805 18:7038399-7038421 GGCCCTCCAGTGGCGAGGGTGGG - Intronic
1154064043 18:11090029-11090051 GGCTCTTCTGAGAGAAGGGTAGG + Intronic
1154369361 18:13745065-13745087 GGCCCAGCAGTGGGAAAGCTAGG + Intronic
1155373008 18:25123609-25123631 TTCCTTGCAGAGGGAAGGGAGGG + Intronic
1155687580 18:28574368-28574390 TGCCCTGAAGAGAAAAGGGTGGG + Intergenic
1156923049 18:42546118-42546140 GGCCCTTCAGAGGCAAGAGGAGG + Intergenic
1157849100 18:51030641-51030663 GGCCCGGCCGGGGGAAGGGGAGG - Intronic
1158400484 18:57116987-57117009 GGCCCTGCTGAGGGACAGGGGGG - Intergenic
1159359401 18:67381392-67381414 GGCTCTGCCCAGTGAAGGGTGGG + Intergenic
1159651750 18:70986415-70986437 GGCAATGCAGAGGGAAATGTAGG + Intergenic
1159925868 18:74268617-74268639 GCCACTCCAGAGGGTAGGGTGGG + Intronic
1160007034 18:75075370-75075392 CTCCCTGCAGAGGGCAGGGCTGG + Intergenic
1160203042 18:76810806-76810828 GGACCTGCAGAGGGCAGGCCAGG - Intronic
1160276914 18:77445418-77445440 GGTACTGCAGAAGGAAGCGTTGG - Intergenic
1160467168 18:79089096-79089118 GGCGATGCAGGGGGAAAGGTTGG + Intronic
1160702127 19:512746-512768 GGCTGTGCAGGGGGAAGGGACGG - Intronic
1160901160 19:1429400-1429422 GGCACTGCAGAGGGAACGGCAGG - Intronic
1161320310 19:3637953-3637975 GGCCCTGGAGAAGGGAGGGACGG - Intronic
1161355075 19:3814520-3814542 GGCCCTGAGAAGGGAAGGGATGG - Intronic
1161455378 19:4367181-4367203 GGGCCTGCAGGGGGAGGGGGAGG + Intronic
1161505393 19:4640842-4640864 GGACCTGCACAGGCAAGGGCTGG + Intronic
1161560209 19:4968983-4969005 GGCCCGGCGGAGGGGAGGGGCGG + Intergenic
1161865889 19:6832005-6832027 TTCCCTACAGAGGGAGGGGTGGG + Intronic
1161871943 19:6877008-6877030 GGCCCTGCAGAGTTGCGGGTGGG - Intergenic
1162022508 19:7874221-7874243 GGCCCGGCTGGGGGAGGGGTCGG - Intronic
1162025256 19:7890181-7890203 GTTCCTGCTGGGGGAAGGGTGGG - Intronic
1163115263 19:15185227-15185249 GGGGCTGCAGAGGGAAGGTGAGG + Intronic
1163154811 19:15433850-15433872 GAGCCTGCAAAGGGGAGGGTGGG - Intronic
1163473732 19:17512705-17512727 GGCCTGGCCGAGGGAAGAGTGGG + Intronic
1163689410 19:18730554-18730576 GTCACTGCAGAGGGACGGGGAGG - Intronic
1163726178 19:18924373-18924395 CGCCCGGCAGAAGGAAGGATCGG - Intronic
1164527369 19:29022130-29022152 GGCCCAGCACAGGGAAGGTGCGG - Intergenic
1164564192 19:29314444-29314466 GGAACTGCAGAGGGATGGTTGGG + Intergenic
1164575526 19:29403353-29403375 TGCCCTGGAGAAGGAAGGCTGGG + Intergenic
1165824695 19:38699036-38699058 GCCCCTGCAGATGGAGGGGGTGG + Intronic
1166067073 19:40366204-40366226 GGCACTGCAGAGTGAAGAGCAGG + Intronic
1166124165 19:40703735-40703757 GGGCCTGCTGAGGGACGGGACGG - Exonic
1166311823 19:41967337-41967359 GGGCCTGCAGAGGGGAGAGCAGG + Exonic
1167299702 19:48671631-48671653 GGCCCTGGGGAGGGGAGGGAAGG + Intronic
1167359042 19:49020198-49020220 GGGACTGCAGAGGAAAGGGCTGG - Intergenic
1167366725 19:49058435-49058457 GGGACTGCAGAGGAAAGGGCTGG - Exonic
1167428888 19:49443139-49443161 GGCCCAGGACAGGGAAGGGCCGG - Intergenic
1167473798 19:49689104-49689126 GGCCCTGAGGGTGGAAGGGTGGG - Exonic
1168033889 19:53703521-53703543 GCCACTGCAGAGGCCAGGGTCGG + Intergenic
1168063219 19:53905743-53905765 GGACGGGGAGAGGGAAGGGTAGG - Intronic
1168333163 19:55581004-55581026 GGACCTGGAGAGGGGAGGGAAGG + Intergenic
1168544718 19:57240797-57240819 GGCCCGGCGCAGGGAAGGGGTGG + Intronic
925294062 2:2766251-2766273 TGCCCTGCGCAGTGAAGGGTGGG + Intergenic
925920510 2:8634637-8634659 GGCACTTCAGATGGAAGGGGTGG - Intergenic
925988560 2:9235385-9235407 AGCCCTGGAAAGGGAAGGGCTGG - Intronic
926757676 2:16249383-16249405 GGCCGTGCAGAAGGGAGGGTCGG + Intergenic
927132342 2:20071399-20071421 AGCCCTGAAGCGGGAAGGCTGGG - Intergenic
927868943 2:26611221-26611243 GGCCCTGCAGCCCGAAGGCTAGG - Intronic
929594234 2:43166100-43166122 GTCCCTGGAGAGGGAAGGACAGG + Intergenic
929601696 2:43208528-43208550 AGCCCTGCATTGGGAAGGGATGG + Intergenic
930839057 2:55825724-55825746 GGCCCTGCCTGGTGAAGGGTGGG - Intergenic
931651365 2:64471856-64471878 GGCCTTGGAGTGGGTAGGGTAGG - Intergenic
932348478 2:71012016-71012038 GGCCCAGCAGAGGGGAAGGGCGG + Intergenic
932494238 2:72138616-72138638 AGCCCTGCAGAGGGAGTGGCAGG + Intronic
932847817 2:75153232-75153254 AGCTCAGCAGAGGGCAGGGTAGG + Intronic
935194431 2:100803976-100803998 TGGACAGCAGAGGGAAGGGTGGG + Intergenic
935328133 2:101956373-101956395 GGCCCTGCAATGTTAAGGGTAGG + Intergenic
935334856 2:102006798-102006820 GGCCCTGCCGATGGCCGGGTGGG + Intronic
935677481 2:105608482-105608504 GGACCTGCAGAGGAGAGGTTGGG - Intergenic
936087816 2:109481196-109481218 GGCCCTGCAGACGTCAGGTTGGG + Intronic
936091830 2:109506504-109506526 GGCCTTGCAGAGGGTGGGGCAGG + Intergenic
937302056 2:120848584-120848606 GACCCTGGGGAGGGAAGAGTTGG + Intronic
937311282 2:120904878-120904900 GGCCCAGCAGAGAGAAGGGAGGG + Intronic
937460956 2:122085556-122085578 GGCATGGCAGGGGGAAGGGTGGG - Intergenic
937984346 2:127631877-127631899 GCCTCAGCAGTGGGAAGGGTTGG + Intronic
938192880 2:129299577-129299599 GGCTCTGGAGCTGGAAGGGTGGG - Intergenic
938292214 2:130156297-130156319 GGCCCTCCAGAAGCCAGGGTGGG + Intronic
938464333 2:131516670-131516692 GGCCCTCCAGAAGCCAGGGTGGG - Intergenic
938639887 2:133266946-133266968 GGCCCGGCGGAGGGGAGGGGAGG - Intronic
938657711 2:133451636-133451658 TGCCCTGCAATGGGAAGGGGAGG - Intronic
938766059 2:134461089-134461111 GGCACTGCAGAGGGGAGTGACGG - Intronic
940344981 2:152619646-152619668 GGAGGTGCAGAGGGAAGGGGAGG - Exonic
940449892 2:153824128-153824150 GAGCCTGCAGAGGAAAGGGAAGG + Intergenic
944037078 2:195307938-195307960 GGCTCTGCAGGGGGTGGGGTGGG - Intergenic
945109541 2:206349246-206349268 GGCAATGCAGAGGGAAATGTGGG - Intergenic
945119678 2:206444122-206444144 GGCCCTGCAGAGGAAAGCGAAGG + Intronic
946063043 2:216961173-216961195 GTCCTTGTAGAGGGAGGGGTAGG + Intergenic
946195055 2:218027871-218027893 GGCCCTGCAGACTGCAGGCTGGG + Intergenic
946278947 2:218652112-218652134 GGCCCTGCAGAGGGCCAGGGAGG + Intronic
946415335 2:219537327-219537349 GGCCCTGGAGAAGGCAGGGTGGG + Intronic
946441648 2:219701933-219701955 GGACAAGCAAAGGGAAGGGTGGG + Intergenic
947119760 2:226801310-226801332 TGCACTGCAGAGGGAAGGTGGGG + Intergenic
947792813 2:232877435-232877457 GGGCCTTTGGAGGGAAGGGTTGG + Intronic
948379048 2:237540563-237540585 GACCCTGCAGAGGTAGGGGCAGG + Intronic
948385271 2:237576907-237576929 TGGCCGGCAGAGGGAAGGGCAGG - Intronic
948770409 2:240248772-240248794 GGCCCTGCAGAGGGTGAGGCAGG - Intergenic
948825312 2:240571024-240571046 GGCCGTGCAGGCTGAAGGGTTGG + Intronic
1168887947 20:1273191-1273213 GTCCCTGCAGAGGAAAAGTTGGG + Intronic
1168981388 20:2006913-2006935 CGCCCTGCGGAGGCAAGGGAAGG - Intergenic
1170765325 20:19285030-19285052 GGCAGGGCAGAGGGAAGGGGAGG - Intronic
1171133191 20:22674025-22674047 GGTGCAGCAGAGGGCAGGGTGGG + Intergenic
1171418277 20:24998578-24998600 TGCCCTCCAGAGAGCAGGGTGGG + Intergenic
1171517815 20:25751397-25751419 TGCCTTGCTGAGGGAAGCGTGGG - Intergenic
1171801690 20:29626428-29626450 GGCTTGGCAGAGGGAAGGTTCGG + Intergenic
1173473995 20:43345681-43345703 GGCCTTGCAGAAGGTAGGGGCGG - Intergenic
1173669259 20:44786373-44786395 GGCCCTGCCTGGGGAAGGATGGG - Intronic
1173747163 20:45446624-45446646 AGCCCTGAGGAGGGAAGTGTGGG - Intergenic
1174008331 20:47428273-47428295 TGTCCTGCAGAGGGAAGGGAAGG - Intergenic
1174076604 20:47941877-47941899 GGCCATGCAGAGGGAGCGGCAGG - Intergenic
1174295091 20:49540102-49540124 GGCAGAGCAGAGGGAGGGGTAGG + Intronic
1174448694 20:50607283-50607305 GAACATGCACAGGGAAGGGTGGG + Intronic
1174522236 20:51140759-51140781 GGACCTGCAGAGGCTATGGTGGG + Intergenic
1175521612 20:59605488-59605510 GGCCCGGCAGTGGGGAGGGAGGG - Intronic
1175553452 20:59831627-59831649 GGCCCTGCAGAGGGGTGGGGCGG - Intronic
1175901727 20:62362549-62362571 GGCCCTGCAGAGGGAACGGGAGG + Exonic
1176072541 20:63234653-63234675 GGCCTTGCATAGGAAAGGGTTGG + Intergenic
1176243162 20:64084277-64084299 GGCCCTGCCGAGGGGCGGGCAGG - Exonic
1177412557 21:20749252-20749274 GAGCCTACTGAGGGAAGGGTAGG - Intergenic
1179490228 21:41736483-41736505 GGCACTGCAGAGGGAGGGGCAGG - Intergenic
1179584670 21:42366937-42366959 GACCTTGCAGGGGGAAGGGAAGG + Intergenic
1179659321 21:42864453-42864475 TGCCCTGCAGAGGGATGGAGGGG + Intronic
1179729704 21:43360861-43360883 AGTCCCGCAGCGGGAAGGGTGGG - Intergenic
1179788751 21:43743616-43743638 GACCCTGCAGAGGGGTGGCTGGG - Intronic
1180074040 21:45453721-45453743 CACCCTGCAGATGGCAGGGTGGG + Intronic
1180107041 21:45625913-45625935 GGCCCTGGAGGGGTGAGGGTTGG - Intergenic
1180206419 21:46264160-46264182 GGCCCTGCAGAGGGACTGTGAGG - Exonic
1180606634 22:17063980-17064002 AGCCCTGCCAAGGGAAGGATGGG + Intergenic
1181467560 22:23118385-23118407 GGCCCTGGAGAGAGCAGGATGGG + Intronic
1181614914 22:24047344-24047366 AGTCCTGCAGAGGGAAGGCCTGG - Intronic
1181980337 22:26761561-26761583 GGCCATGCAGTGGGAAGTGGTGG + Intergenic
1182048234 22:27293136-27293158 GTACGTTCAGAGGGAAGGGTGGG - Intergenic
1182331593 22:29554968-29554990 GGCCCTGCAGAATGAGGGTTGGG + Exonic
1182482849 22:30620898-30620920 GGCCCTGCAGAGTTAAGGAATGG + Intronic
1182520409 22:30881612-30881634 GGCCCGGCAGAGGGACTGGCAGG - Intronic
1182795175 22:32986588-32986610 TGTCTGGCAGAGGGAAGGGTAGG + Intronic
1183253374 22:36745514-36745536 TGCCCTGCACAAGGAAGGGAGGG + Intergenic
1183410728 22:37653760-37653782 TGTCCTGCAGAGGGAAGGAGAGG - Exonic
1183520872 22:38295401-38295423 GGCCGTCCACAGGGAAGGGCAGG + Intronic
1183614806 22:38937377-38937399 GGCCCTATGGAGGGAAGGGAAGG + Intergenic
1183977827 22:41523460-41523482 GGCCCTGCAGAGGCACTGGGGGG + Intronic
1184410998 22:44326399-44326421 TGCCCAGCAGAGGGAGGGGATGG - Intergenic
1184504227 22:44891348-44891370 GTCCCTGCAGAGGAAACGGCTGG - Exonic
1185067990 22:48641560-48641582 GGGCGTGCAGGGGGAAGGGGAGG - Intronic
1185290373 22:50022707-50022729 GGACCTGCAGAGTTAAGAGTGGG - Intronic
950397977 3:12748828-12748850 GTCCCTGGGGTGGGAAGGGTGGG - Intronic
953417029 3:42728394-42728416 AGCCTTGCACAGGGGAGGGTGGG - Intronic
953458174 3:43060612-43060634 GGCCCGGCAGCTGGAAGGGTAGG + Intergenic
954337463 3:49928100-49928122 GTACCTGCATGGGGAAGGGTTGG + Intronic
954389965 3:50263619-50263641 GGTCCTGCAGAGGGGAGGCATGG + Intergenic
959669875 3:108964461-108964483 GGGTCTGAAAAGGGAAGGGTAGG - Intronic
960224955 3:115158040-115158062 GGCAGTGCAGAGGGAAATGTAGG + Intergenic
960275168 3:115720908-115720930 GGCTCAGGAGAGGGGAGGGTGGG - Exonic
960650389 3:119941945-119941967 AGCTCTGGAGAGGAAAGGGTAGG - Intronic
960822516 3:121749591-121749613 GGACTCGCAGAGGGAAGAGTTGG + Intronic
961438515 3:126936269-126936291 GCCCTTGCAGAGCGAAGGGGAGG + Intronic
961443204 3:126965091-126965113 GGCCCTGCACAGGGAAGCTGGGG + Intergenic
962199781 3:133391745-133391767 GGCCCTGCAGCAGGATGGGTTGG - Intronic
962774844 3:138649632-138649654 GGCCCTGCTGCTGGAAGGGCAGG + Intergenic
962850871 3:139307390-139307412 GGCTCTGCAGAGGGCAGTGGAGG - Intronic
963056977 3:141193882-141193904 GAGCTTTCAGAGGGAAGGGTGGG + Intergenic
963745814 3:149124405-149124427 GTCCCTGCAGGGGGAAGGAGTGG - Intergenic
964523972 3:157597257-157597279 AGCCCTGCACAGGACAGGGTGGG - Intronic
965579344 3:170250489-170250511 GGGCCTGCAGAGAAAGGGGTAGG - Intronic
966851317 3:184166774-184166796 GGCCCAGCAGTGGGTGGGGTGGG + Intronic
966950286 3:184811142-184811164 TGCCTAGCTGAGGGAAGGGTGGG - Intergenic
967891931 3:194369788-194369810 GTCACTGCAGAGGGCAGTGTTGG + Intergenic
967996564 3:195171260-195171282 TGCCCTCCTGTGGGAAGGGTAGG - Intronic
968045356 3:195620866-195620888 GGCCCTCCAGATCTAAGGGTGGG + Intergenic
968063661 3:195746267-195746289 GGCCCTCCAGATCTAAGGGTGGG + Intergenic
968085279 3:195871352-195871374 GGGACTGCAGAGGGAACGTTAGG - Intronic
968285187 3:197504510-197504532 GACCCTGCAGACGGAGGGATGGG - Intergenic
968448187 4:663031-663053 GGGGCTGCAGAGCGCAGGGTGGG + Intronic
968453241 4:684762-684784 GCCCCGGCAGAGGGCGGGGTGGG + Exonic
968706732 4:2081903-2081925 GGCCCTGCAGTGGGAAAGCGAGG + Intronic
968876210 4:3269203-3269225 GGCCCTGAGGAGGGGAGGGCAGG + Intronic
969198264 4:5580626-5580648 GAGCCTGCAGAGGGAAGAGCAGG - Intronic
969582103 4:8071584-8071606 GGTCCTGCAGAGGGAAGCCAGGG + Intronic
969647564 4:8441204-8441226 GGCCATGCTGAAGGAAGGGAGGG + Exonic
969693847 4:8724018-8724040 GGCGCTGCAGAGGAGAGGGCTGG + Intergenic
970528010 4:16952419-16952441 AGCCCTGCAGAGGGAAGGAGTGG - Intergenic
971299591 4:25430850-25430872 GGCCCAGAGGAGGGAAGGGAGGG - Intergenic
976482012 4:85556657-85556679 GGCACTGCCGAGTGAAGGGTAGG + Intronic
977919447 4:102626937-102626959 GGCCTTGGAGAGGGCAGTGTGGG - Intergenic
978145938 4:105372024-105372046 GCCCCTGCAGAAGTAACGGTGGG + Intronic
978600111 4:110418834-110418856 GGGCAAGCAGAGGGAAGGGGCGG + Intronic
979168242 4:117564411-117564433 GGGACTGGAGGGGGAAGGGTGGG - Intergenic
981617549 4:146657274-146657296 GGTCCAGGGGAGGGAAGGGTGGG + Intergenic
983693045 4:170495866-170495888 GGCCTGTCAGAGGGTAGGGTTGG + Intergenic
984758213 4:183342999-183343021 GGCCCTGCAGGAGGGAGGGAGGG - Intergenic
984916526 4:184730088-184730110 TGCCTTGCAGAGGGAAGGACAGG + Intronic
986280473 5:6318032-6318054 GCCTCTGGAGAGGGCAGGGTGGG + Intergenic
986284176 5:6347818-6347840 GTCCCTGAAGAACGAAGGGTGGG + Intergenic
986385352 5:7227942-7227964 GGACCTGGAGAGTGGAGGGTAGG - Intergenic
986460318 5:7963654-7963676 TGCCCTGCTGAGGAAAGGGATGG + Intergenic
986478283 5:8158398-8158420 GGCTCTGCAAATGGAAGGGAAGG + Intergenic
986625605 5:9720999-9721021 TGCCCTGCAGCAGGCAGGGTGGG - Intergenic
987298843 5:16578820-16578842 GGCTTTGCAGGGGGAAGGCTGGG - Intronic
990635879 5:57725697-57725719 AGCCCTCCAGAGGAAAGGATAGG + Intergenic
991715444 5:69447237-69447259 GACTCTGCAGAAGGAAGGGAAGG + Intergenic
996361748 5:122655849-122655871 GGCCTTGCAAAGAGAAGGGAGGG - Intergenic
997610697 5:135213606-135213628 GGTGACGCAGAGGGAAGGGTGGG + Intronic
998059751 5:139110727-139110749 GGCAGTGCACAGGGCAGGGTGGG - Intronic
998462549 5:142320496-142320518 GCCCCAGCACACGGAAGGGTGGG + Intronic
998509460 5:142699281-142699303 TGACCTGCAGAGGGCAGTGTTGG - Intergenic
999205030 5:149841698-149841720 AGCCTAGCAGAGGGAAGGGGTGG - Intronic
999327386 5:150651534-150651556 TGACCTGGTGAGGGAAGGGTTGG + Exonic
999399449 5:151253204-151253226 GGGACTGCATCGGGAAGGGTGGG - Exonic
1001009400 5:168084606-168084628 GGCCAGGCAGAGGGAAAGGCTGG + Intronic
1002133580 5:177095514-177095536 GGCCCTGCAGAGGGAGTGGAGGG - Exonic
1002433934 5:179220053-179220075 TGCCCAGCAGAGGGAAGGCTTGG - Intronic
1002471668 5:179439300-179439322 GGCTCTTGGGAGGGAAGGGTTGG - Intergenic
1002601173 5:180354556-180354578 GACCCTGCATAGTGGAGGGTTGG - Intergenic
1003041720 6:2694232-2694254 GTCCCTGCAGAGGGAAAAGTAGG - Intronic
1006251997 6:32795467-32795489 GGCCATACAGATAGAAGGGTTGG - Intergenic
1006797478 6:36741053-36741075 GCCCCTGCTGTGGGAAAGGTGGG - Exonic
1007075683 6:39064769-39064791 GGCCCTGCAGAGGCAAGGCGGGG - Intronic
1007257516 6:40539151-40539173 GGCCCTGCAGAGGTGAGGCCAGG - Intronic
1007747927 6:44054663-44054685 GGCACTGCAGAGGTCAGAGTGGG + Intergenic
1007751326 6:44073588-44073610 GGCCCTGGAGATAGAGGGGTGGG + Intergenic
1007765162 6:44155564-44155586 GGCCCTCCAGATAGGAGGGTGGG - Intergenic
1008220852 6:48852130-48852152 GGCAGTGCAGAGGGAAATGTGGG - Intergenic
1008711460 6:54232833-54232855 GGTTCTCCAGAGGGAAGGATGGG - Intronic
1009377528 6:62990829-62990851 GGCAATGCAGAGGGAACTGTGGG - Intergenic
1009531066 6:64816201-64816223 GCCTTTGCAGAGGGAATGGTAGG - Intronic
1011034410 6:82957715-82957737 GGACCTGCTGGGGGAAGGGGTGG + Intronic
1011088640 6:83570861-83570883 GGCAGTGCAGAGGGAAATGTGGG + Intronic
1011295061 6:85817661-85817683 GGGCATCCAGAGAGAAGGGTCGG + Intergenic
1014407484 6:121069242-121069264 GGCAGTGCAGAGGGAAATGTGGG + Intergenic
1016761938 6:147747327-147747349 GGCCCTGCAAATGGAGGGGCAGG + Intergenic
1017156184 6:151324501-151324523 GGCACAGCAAAGAGAAGGGTGGG - Intronic
1018099691 6:160426460-160426482 GAACCTGCCGAGGGAAGAGTGGG - Intronic
1018872557 6:167794640-167794662 AGCCCTGCCAAGGGGAGGGTGGG + Intronic
1019076935 6:169395294-169395316 GGGCCTGTAGAGAGAAGGGCAGG - Intergenic
1019376065 7:692816-692838 AGCCCTGGACAGGGAAGGGCAGG + Intronic
1019398521 7:836806-836828 ACCCCTGCAGAGGGAAAGGATGG + Intronic
1019548656 7:1591404-1591426 GGTCCTGCAGGGAGAAGGGGCGG - Intergenic
1019702643 7:2481417-2481439 GGCCCTGGAGTGAGAAGAGTTGG + Intergenic
1019743800 7:2688522-2688544 GGTCCTGCAGAGGGAAGGCCGGG + Intronic
1020271703 7:6600401-6600423 CGCCCTGCAGAAGGAAGGAGGGG + Intronic
1020283840 7:6664925-6664947 GACCCTGCAGAAGGAAAGGAGGG - Intergenic
1020548624 7:9568793-9568815 TGCCCTGAAGAGGGAAGAGAAGG - Intergenic
1021555621 7:21915126-21915148 GCAGCTGCAGAGGGAAGGGAAGG + Intronic
1023600697 7:41879164-41879186 GGACCTGGAGAGGAAAGGCTGGG + Intergenic
1025639659 7:63354413-63354435 GGCCCTTCAGAGGGAAAGGGCGG - Intergenic
1025643040 7:63393679-63393701 GGCCCTTCAGAGGGAAAGGGCGG + Intergenic
1025979987 7:66397488-66397510 GTCCCTGCAGATGGGTGGGTAGG - Intronic
1026046055 7:66905883-66905905 GGCCCTGGTGAGGAAAGAGTTGG - Intergenic
1026255827 7:68710271-68710293 GGGCCTGTTGAGGGTAGGGTTGG + Intergenic
1026674674 7:72418762-72418784 AGCCCTTCAGAGGGCAAGGTGGG + Intronic
1026901983 7:74042595-74042617 AGCCCTGCGGAGGGGAGGATGGG - Exonic
1027220387 7:76210257-76210279 GGCCCTGATGAGAGAAGGGGTGG - Intronic
1028987259 7:97018248-97018270 GGCCGAGCTGAGGGAAGGGAGGG - Intergenic
1029251480 7:99239819-99239841 GGGCCAGCAGAGAGAAGGGTGGG - Intergenic
1029440288 7:100583506-100583528 GGCCCTTCTCAGGGAAGGGCAGG + Intronic
1029706311 7:102278126-102278148 GGCTCTGGAGATGGGAGGGTCGG + Intronic
1029716007 7:102326313-102326335 GGCCTTTTAGGGGGAAGGGTGGG - Intergenic
1030391410 7:108932324-108932346 GGCACTGAAGAGGGAAAGGAAGG - Intergenic
1030393343 7:108954291-108954313 GGTCCTGCAGAGGAAAGAGAGGG + Intergenic
1030655411 7:112162286-112162308 GGCCCTGCAGAGTGGAGGAGGGG - Intronic
1031406885 7:121396431-121396453 GGCCGGCCAGAGGGAAGGGCCGG + Intergenic
1031972959 7:128077081-128077103 GGCCCTGCACAGGGCTGGATTGG + Intronic
1033598833 7:142874859-142874881 AGCCCTGTTGAGGGAAGGGATGG + Intronic
1034268300 7:149791572-149791594 GGCCCTGCAGCCGGACGTGTGGG + Intergenic
1034320215 7:150173157-150173179 GGCAGTGCAGAGGGAAATGTGGG - Intergenic
1034954866 7:155327954-155327976 GGCCTTGGAGAGGGAGGGCTGGG - Intergenic
1035039758 7:155919400-155919422 GGCCCTGCAGAGGCCAGCATGGG + Intergenic
1035516042 8:232804-232826 GGCCTGGCGGAGGGAAGGATGGG - Intronic
1035543757 8:462737-462759 GACTCAGAAGAGGGAAGGGTAGG + Intronic
1035600192 8:892723-892745 GGCGGGGCAGAGGGATGGGTAGG + Intergenic
1035877942 8:3211944-3211966 GGGCCAGGACAGGGAAGGGTGGG + Intronic
1036149836 8:6287000-6287022 AGCAGTGCAGAGGGAAGCGTGGG + Intergenic
1036294177 8:7522013-7522035 GACCCTGCAGAGGAAGGGGTCGG + Intergenic
1036328385 8:7798978-7799000 GACCCTGCAGAGGAAGGGGTCGG - Intergenic
1036645214 8:10608307-10608329 GGCCCTGGAGACTGAAGGGGAGG - Exonic
1036662317 8:10716249-10716271 AGCCCTGCCCAGGGAAGGGCTGG - Intergenic
1036904893 8:12699877-12699899 GGCCCAGCAGAGGGGAAGGGCGG - Intergenic
1037800727 8:22033872-22033894 AGCCCTGCAGAGGGCTGGGGTGG - Intronic
1037934499 8:22906138-22906160 GTCCCTGGAGAGTGAGGGGTGGG - Intronic
1038703715 8:29874899-29874921 GGGACTGGAGAGGGAAGAGTGGG - Intergenic
1038780566 8:30565832-30565854 GGCCCTGCAGAGGAAAGGCATGG - Intronic
1038861780 8:31395952-31395974 GGCCCTGCAAATGTTAGGGTGGG - Intergenic
1039430089 8:37519317-37519339 GGGACTGCAGAGGGCAGGGGTGG - Intergenic
1039473218 8:37826524-37826546 GTCCCTGGAGAAGGAAGGGAAGG - Intronic
1039842862 8:41306509-41306531 GTCCCTGTGGAGGGGAGGGTGGG - Intronic
1041559346 8:59197135-59197157 GGCCCTGGAGTGGGAAGGAAAGG - Intergenic
1041723581 8:60998217-60998239 GGACATGCAGAGGGAAAGGAGGG + Intergenic
1042373934 8:68026444-68026466 GGCACTGCAGAAAGAAGGTTTGG + Intronic
1044157340 8:88863779-88863801 GTCCCTACAGAAGGAAGTGTAGG - Intergenic
1044598337 8:93979888-93979910 GGCTCTGGAGAGCGCAGGGTTGG - Intergenic
1044625002 8:94228102-94228124 GGCACTGCAGAGGGGAAGGCAGG - Intergenic
1045685772 8:104710120-104710142 CTCCATGCAGAGGGCAGGGTGGG - Intronic
1046725030 8:117664976-117664998 TTCCCTGGAGAGGGAAGAGTAGG + Intergenic
1047187499 8:122647165-122647187 TCCCCTGCAAAGGGAAGGGAAGG + Intergenic
1047207547 8:122815204-122815226 GGCACTGCAGTGGGCAGGGTCGG + Intronic
1047208042 8:122819191-122819213 GTGCCTGCAGTGGGAAGGCTGGG + Intronic
1047368008 8:124230061-124230083 GACACTGGAGTGGGAAGGGTGGG - Intergenic
1047498452 8:125425285-125425307 GGCCCTGGAGAGGTAATGGGAGG - Intergenic
1047694679 8:127391688-127391710 GGCCCCCCAGAGGGAATGGTAGG - Intergenic
1047722829 8:127657669-127657691 GACCCAGCAGAGGGAAGGCAGGG + Intergenic
1047732375 8:127737698-127737720 GGCGGTGGAGAGGGAAGGTTGGG + Intronic
1048170054 8:132097581-132097603 GGCCTTGCAGAGGAAAGGACAGG + Intronic
1049335028 8:142079759-142079781 GTCCCTGCAGAGAGGAGGGGAGG - Intergenic
1049373552 8:142278816-142278838 GGGCCTGCAGAAGGAGGGGGAGG + Intronic
1049378530 8:142300931-142300953 CACCCAGCAGAGGGGAGGGTGGG + Intronic
1049451616 8:142665002-142665024 GGCCCTGCAGGGGGACCGGAGGG + Exonic
1049603649 8:143519311-143519333 GGGCCAACACAGGGAAGGGTGGG + Intronic
1049621317 8:143599554-143599576 GGCGCTGCAGGGGGCAGGGCTGG - Exonic
1049688012 8:143946713-143946735 GGGCCTGCAGCGGGAAGGGGAGG - Intronic
1049905030 9:208731-208753 GGCCCTACAGAGGGGAAAGTTGG - Intergenic
1051028904 9:12649831-12649853 GCCCCTGCAGAGTTAAGAGTAGG - Intergenic
1051717931 9:20004384-20004406 GCACCTGCAGTGGGAAGAGTGGG + Intergenic
1051889056 9:21924724-21924746 GGCCCTGGGTAGGGAAGGGAAGG - Intronic
1052139870 9:24967410-24967432 GGACTTGGAGTGGGAAGGGTGGG + Intergenic
1053458694 9:38251557-38251579 GGTCCTGCATGGGGGAGGGTGGG + Intergenic
1055640275 9:78314259-78314281 TGCTCTGCAGAGGGCTGGGTGGG + Intronic
1055640292 9:78314339-78314361 TGCTCTGCAGAGGGCTGGGTGGG + Intronic
1055640309 9:78314419-78314441 TGCTCTGCAGAGGGCTGGGTGGG + Intronic
1055640325 9:78314499-78314521 TGCTCTGCAGAGGGCTGGGTGGG + Intronic
1055885961 9:81063476-81063498 GGCAGTGCAGAGGGAAATGTGGG + Intergenic
1056315690 9:85387547-85387569 GGCCATGCAGATGGAAGAGCAGG - Intergenic
1057139565 9:92718372-92718394 GGCCCTGAGCAGGGGAGGGTAGG + Intronic
1057396324 9:94683633-94683655 GCCCATGAAGAGTGAAGGGTGGG + Intergenic
1057913959 9:99041474-99041496 GGCTCTGCAGAGGGGTGGGTGGG + Intronic
1058413732 9:104763855-104763877 GCCCCTGGAGAAGGAAGGGGAGG - Intergenic
1059134878 9:111795305-111795327 AGCCTTTCAGAGGTAAGGGTGGG + Intergenic
1059352778 9:113677289-113677311 GGTTCTGAAGACGGAAGGGTAGG - Intergenic
1059435044 9:114270953-114270975 GGTAGTGCAGAGGGCAGGGTGGG - Intronic
1059657499 9:116369655-116369677 GGGCCCACAGAGGGAAGGGTGGG - Intronic
1060770251 9:126327051-126327073 GGCCCTGCAGCCGGGAGGGCGGG + Intronic
1060779419 9:126400598-126400620 GGCCCTGCAGTGGGCAGGGAGGG + Intronic
1060789152 9:126474050-126474072 GGCTCTGCCAAGGAAAGGGTAGG + Intronic
1060826763 9:126692167-126692189 TGCCCTGCCCAGGGATGGGTAGG - Intronic
1061716626 9:132522299-132522321 GACACTGCAGCCGGAAGGGTGGG + Intronic
1061754811 9:132804889-132804911 GGGCCTGCAGAGGCAGGGGCAGG - Intronic
1061921224 9:133783588-133783610 GCCCCTGCACAGGGGAGGGCAGG + Exonic
1061922766 9:133791236-133791258 GGCCCTGCAGAGGCCAGGCTTGG - Intronic
1062003606 9:134228714-134228736 CGCCCTGCAGAGGGAGGAGAAGG - Intergenic
1062327221 9:136018054-136018076 AGCTGTGCAGAGGGAGGGGTGGG + Intronic
1062399848 9:136367525-136367547 GGCCCGTCACAGAGAAGGGTTGG + Intronic
1062401955 9:136376683-136376705 GGCCCACCAGAGGGATGGCTTGG - Intronic
1062449340 9:136609031-136609053 AGCCCCGCAGAGGGCAGGGGCGG - Intergenic
1062451234 9:136616639-136616661 GGCCCTGGAGGGGGATGGGGAGG - Intergenic
1062519513 9:136951862-136951884 GGCCCTGCAGGGGGAATGCCCGG + Intronic
1186629564 X:11334551-11334573 GGCCCCACTGAGAGAAGGGTTGG + Intronic
1187186805 X:16994652-16994674 GGGGCCTCAGAGGGAAGGGTGGG + Intronic
1187723178 X:22173210-22173232 GGCACTGGAGAGCTAAGGGTGGG + Intronic
1190064917 X:47233241-47233263 GCCTCGGCAGAGGGAACGGTGGG + Intronic
1190094360 X:47467015-47467037 GCCGATGGAGAGGGAAGGGTTGG + Intronic
1190825895 X:54017715-54017737 GGTCCTGAAGAAGGATGGGTTGG - Exonic
1193067550 X:77275612-77275634 GGCCCTGCCTGGTGAAGGGTAGG - Intergenic
1193466395 X:81852850-81852872 GGCACTGTAGTGTGAAGGGTAGG + Intergenic
1193642532 X:84028855-84028877 GCCACTGCAGTGGGCAGGGTTGG - Intergenic
1195234689 X:102885076-102885098 GGCAAGGCAGTGGGAAGGGTAGG - Intergenic
1195521532 X:105835761-105835783 GCCACTGCAGTGGGAAAGGTAGG - Intronic
1196893327 X:120310618-120310640 GCCGCTGCAGAGGGCAGGGCTGG + Intronic
1197341045 X:125266645-125266667 GGCAGTGCAGAGGGAAATGTGGG + Intergenic
1197765233 X:130055835-130055857 GGGCCTGCAAAGGCAAGGATGGG - Exonic
1200034362 X:153318551-153318573 GGGCCTACAGAGGTGAGGGTGGG + Intergenic
1200056625 X:153464834-153464856 TGCCATGCCTAGGGAAGGGTGGG + Intronic
1200080185 X:153572414-153572436 GGTCCTCCAGAGAGAAGGGCCGG + Intronic
1200420871 Y:2965712-2965734 GGCCCTGCTAAGGAAAGGCTTGG + Intronic
1200445477 Y:3256137-3256159 GGCACTGCAAAGGGAAATGTGGG - Intergenic
1201367889 Y:13228428-13228450 GATTCTGCAGAGGAAAGGGTTGG - Intergenic