ID: 902375370

View in Genome Browser
Species Human (GRCh38)
Location 1:16027800-16027822
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 700
Summary {0: 2, 1: 0, 2: 6, 3: 72, 4: 620}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902375370_902375381 10 Left 902375370 1:16027800-16027822 CCCACTGCCCTCCTTCCCCAGAG 0: 2
1: 0
2: 6
3: 72
4: 620
Right 902375381 1:16027833-16027855 CCCTCTACAAGACCAGTTTCCGG 0: 2
1: 0
2: 0
3: 5
4: 102
902375370_902375384 14 Left 902375370 1:16027800-16027822 CCCACTGCCCTCCTTCCCCAGAG 0: 2
1: 0
2: 6
3: 72
4: 620
Right 902375384 1:16027837-16027859 CTACAAGACCAGTTTCCGGGTGG 0: 2
1: 0
2: 0
3: 2
4: 48
902375370_902375383 11 Left 902375370 1:16027800-16027822 CCCACTGCCCTCCTTCCCCAGAG 0: 2
1: 0
2: 6
3: 72
4: 620
Right 902375383 1:16027834-16027856 CCTCTACAAGACCAGTTTCCGGG 0: 2
1: 0
2: 0
3: 5
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902375370 Original CRISPR CTCTGGGGAAGGAGGGCAGT GGG (reversed) Exonic
900095017 1:936671-936693 CTCTTGGGAAGGAGGGGTGGGGG + Intronic
900120684 1:1047482-1047504 ATCTGGGGAGGAAGGCCAGTGGG - Intronic
900357730 1:2272862-2272884 CTCGGGGGCAGGAGGGGCGTGGG - Intronic
900512327 1:3066617-3066639 CCCTAGGGAAGAAGGGCAGGAGG - Intergenic
900533687 1:3167012-3167034 TTCTGGGGATGGAGGGCAGTTGG - Intronic
900562445 1:3314050-3314072 CGGTGGGGAAGGACGGCATTCGG - Intronic
900596725 1:3483359-3483381 CTGTGTGGATGCAGGGCAGTGGG + Intergenic
900670031 1:3846359-3846381 ATTTGGGGCAGGAGGGCAGCTGG + Intronic
900670373 1:3849637-3849659 ATTTGGGGCAGGAGGGCAGCTGG + Intronic
900765354 1:4501262-4501284 CTTTGGGGAAGGATGGCAAGGGG + Intergenic
900964541 1:5948629-5948651 CTCTGGGAAAGGGGGGCTCTGGG - Intronic
901027494 1:6286315-6286337 TTCTGGGGAAGGCGGCCAGAAGG + Intronic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902391899 1:16111811-16111833 GACTCGGGAAGGGGGGCAGTGGG - Intergenic
902673005 1:17987979-17988001 CCCTGGGGAGGGAGAGCAGGCGG + Intergenic
902706397 1:18208233-18208255 CTCTGGGCAAGGAGATCAGGTGG - Intronic
902775360 1:18671124-18671146 CTGTGGGGCAGGAAGGCAGCAGG + Intronic
902918420 1:19652489-19652511 CACTGGGGAGGAAGGGCAGCTGG - Intronic
903129838 1:21271665-21271687 CACTGGGGGAGGAGCCCAGTGGG + Intronic
903366209 1:22806900-22806922 CTCTGGGGAAGTAGGGCTGGGGG - Intronic
903611048 1:24613043-24613065 GGCTGGGGAGAGAGGGCAGTGGG - Intergenic
903799074 1:25953232-25953254 GTCTGGGGAACGAGGGCTGATGG + Intergenic
904035703 1:27557379-27557401 CTCTGGGGAAGGAGGTGGGCGGG - Intronic
904142024 1:28361142-28361164 CTCTGGGGTAGGAAGATAGTGGG - Intergenic
904421967 1:30399887-30399909 TTCTGGGAAAGGATGGTAGTGGG - Intergenic
904497587 1:30895812-30895834 CTCTAGGGAAGCAGAGCAGGGGG + Intronic
904521489 1:31099502-31099524 CTGTGGGGAAGGCAGGGAGTAGG - Intergenic
904621297 1:31776884-31776906 ATCTGGGGAGGCAGGGCAGAGGG + Intergenic
905281726 1:36853583-36853605 CTCAGGAGAGGGAGGGCAGGCGG - Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905631612 1:39521979-39522001 CCCTGGTGAAGGAGGGCACGGGG - Intronic
905829127 1:41050134-41050156 CAGTGGGGAAGGGGTGCAGTGGG + Intronic
905878236 1:41447188-41447210 TTCTGGGGAAGGAGAGCAGAAGG - Intergenic
905974372 1:42164399-42164421 ATATGGGGAAGGCGGGGAGTTGG - Intronic
906101608 1:43267476-43267498 CTCTGAGGAAGGCGGGCTGCTGG + Intronic
906315437 1:44784156-44784178 CGGGAGGGAAGGAGGGCAGTGGG + Exonic
906666315 1:47624596-47624618 CTATGGGGAAGGAGAGCAAAGGG - Intergenic
906785306 1:48610433-48610455 CATTGAGGAAGTAGGGCAGTGGG + Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907135733 1:52138164-52138186 CTCTGAGGCTGGAGTGCAGTGGG + Intergenic
907495732 1:54843097-54843119 CCCTGGGGAAGGAGGGCACAGGG - Intergenic
909023445 1:70457684-70457706 CTCTGGTGAATGATGGCAGTAGG + Intergenic
909218827 1:72927929-72927951 ATCTGGGCAAGGAAGGAAGTAGG - Intergenic
909601687 1:77467763-77467785 CTCAGGGGAAGGAGGAGAGGAGG + Intronic
910159584 1:84259023-84259045 CTCTGGGGCAGGGGAGGAGTGGG + Intergenic
910205986 1:84749103-84749125 CTCTGGGGACAGTGAGCAGTTGG + Intergenic
911070103 1:93825635-93825657 CCCTGGGGAAGGAGGGTGGAAGG - Intronic
911171984 1:94780012-94780034 CCCTGGGGAAGGTGGGCATCAGG - Intergenic
913053057 1:115133705-115133727 CCCTGGGGAATTAGAGCAGTGGG + Intergenic
913971818 1:143422398-143422420 GGCAGGGGAAGGACGGCAGTGGG - Intergenic
914066197 1:144248011-144248033 GGCAGGGGAAGGACGGCAGTGGG - Intergenic
914112956 1:144718343-144718365 GGCAGGGGAAGGACGGCAGTGGG + Intergenic
914513765 1:148356065-148356087 CTTTGGGGAAGAAGGGCAGGGGG - Intergenic
914828875 1:151156336-151156358 TTCTGGGGTAGGAGGTCAGTGGG - Intergenic
915073662 1:153292407-153292429 CTCTGGGGAAGGTATGCATTTGG - Intergenic
915167143 1:153954269-153954291 CTCTGGGGGAGGAGATAAGTAGG + Exonic
915430210 1:155860296-155860318 CTCTGGGGAAAGAGGGGTGCGGG + Intronic
915472767 1:156135834-156135856 GTATGGGGAAGGAGGGACGTGGG - Intronic
915634745 1:157178257-157178279 TCCTGGGAAGGGAGGGCAGTTGG + Intergenic
915643107 1:157245252-157245274 CCCTGGGAAGGGAGGGCAATTGG + Intergenic
915650944 1:157310546-157310568 CCCTGGGAAGGGAGGGCAATTGG - Intergenic
915660480 1:157401014-157401036 CCCTGGGAAGGGAGGGCAGTTGG + Intergenic
915732749 1:158065834-158065856 CTGAGGGGAAAGAGGGCAGGCGG - Intronic
916076469 1:161202631-161202653 CTCTGGCGAGGGAGGGGAGAGGG + Intronic
916501194 1:165388632-165388654 CGATGGGGAAGGAGGGCAGGAGG + Intergenic
918098692 1:181355086-181355108 CCCTGGGGAAAGAGCCCAGTGGG + Intergenic
918514435 1:185346924-185346946 CTCTGGGCAGGGAGGGGAGGTGG - Intergenic
919052702 1:192531289-192531311 CTCTGAGGAAGGAGGGCGCCTGG + Intergenic
919831757 1:201546175-201546197 CTCTGGGGAAGGAGAGCCAGAGG - Intergenic
919888880 1:201955594-201955616 CAAGGGAGAAGGAGGGCAGTGGG - Intronic
919960065 1:202458040-202458062 CTCTGGGGAATGGGGAGAGTGGG + Intronic
919960097 1:202458323-202458345 CTCTGGGGAATGGGGAGAGTGGG + Intronic
920059233 1:203216224-203216246 ATCTGGTGAACGGGGGCAGTAGG + Exonic
920410070 1:205752247-205752269 CTATGGGGAAGGGGGAAAGTGGG - Intergenic
921602883 1:217125149-217125171 CACTGGGGAGGGAGGGCAGTGGG + Intronic
922349091 1:224721281-224721303 CTCAGAATAAGGAGGGCAGTGGG - Intronic
922440691 1:225653187-225653209 CCCGGGGGAAGGAGGGGAGGAGG - Intergenic
923447867 1:234089318-234089340 CACTGTGGAAGGACGGCATTAGG + Intronic
923756698 1:236797368-236797390 CCCTGGGGAAGGAGGATGGTGGG + Intronic
1062855331 10:777311-777333 CGCTGGGGAAGGAGGCCTGTGGG - Intergenic
1062855422 10:777556-777578 CGCCGGGGAAGGAGGCCTGTGGG - Intergenic
1062978529 10:1702661-1702683 CCCTGGGGAATGGGGGCAGAAGG - Intronic
1062979805 10:1712646-1712668 CCCCAGGGAAGGAGGGCACTGGG + Intronic
1066658215 10:37713842-37713864 GGCTGGGGAGGGAGGGAAGTGGG - Intergenic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1068913850 10:62407234-62407256 CTATGGGGAAGCAGGTCAGAGGG - Intronic
1068985860 10:63107072-63107094 TCCTGGGGAAGGAGGGTTGTGGG + Intergenic
1069560872 10:69428416-69428438 CTCAGTGGAGGGAGGGCAGTTGG - Intergenic
1069871567 10:71536215-71536237 CTCTGTGGAAGGAGGGCTCGAGG + Intronic
1069889447 10:71644008-71644030 TTCAGGGGAAGGAGAGGAGTTGG + Intronic
1069962997 10:72089288-72089310 CACTGGGGAAGCCGGGGAGTGGG + Intergenic
1070483727 10:76910235-76910257 CTTTGGGTAAGGGGGGCAGTGGG + Intronic
1070490730 10:76973949-76973971 CACTGGGGAAACAGGGCAGAGGG - Intronic
1070565694 10:77602392-77602414 GGCTGGGGAAGGAGGGGTGTGGG + Intronic
1070587472 10:77777445-77777467 GGCTGGGGAAGGAGGGCTGGTGG - Intergenic
1070666856 10:78351083-78351105 CTCTGGGGAACATGGGCTGTAGG - Intergenic
1070751532 10:78966879-78966901 CTCATGGGCAGGAGGGCAGATGG - Intergenic
1071307049 10:84308848-84308870 CTCTGAGGAGGGTGGGCAGAGGG - Intergenic
1071492962 10:86148817-86148839 CCCTGGGGGAGCAGGGCAGTGGG - Intronic
1071571574 10:86700195-86700217 CTGTGGGGCAGGAGAGCAGCAGG - Intronic
1072009463 10:91290830-91290852 CTCTGGGGAGGGCGGAGAGTGGG - Intergenic
1072189995 10:93071085-93071107 CTCTGGGGAAGGAGCAGAGGAGG + Intergenic
1072788874 10:98303269-98303291 CTCTGGGGAACAAGGGCACAGGG + Intergenic
1073150216 10:101306224-101306246 CTCTGGCCAATGAGGGGAGTTGG + Intergenic
1074146883 10:110724738-110724760 ATCTGGGGAATGAGAACAGTAGG + Intronic
1075265663 10:120998240-120998262 CGTTGGGGGAGGAGGGCAGTGGG - Intergenic
1075657980 10:124174428-124174450 CTTTGGGGCTGGAGGGCACTGGG - Intergenic
1076891858 10:133288615-133288637 CCCTGGGCAAGGAGGGGAGCTGG + Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077066563 11:643679-643701 CTCTTGGTCAGGAGGGCAGGGGG + Intergenic
1077160208 11:1109243-1109265 CTCTGGTGAGGGAGGGCAGCAGG - Intergenic
1077274570 11:1697933-1697955 CTCTAGAGAAGGAGGACAGGAGG - Intergenic
1077372905 11:2192025-2192047 GTCTGGGGAAGGAGGGAAGGAGG + Intergenic
1077905203 11:6527320-6527342 GGCTGGGGGAGGAGGGCAGGTGG + Intronic
1078088119 11:8246935-8246957 GTCTGGGGAAGGAGGTAAGGGGG - Intronic
1078438616 11:11345650-11345672 TGCTGGGGAAGCAGGGCAGCTGG + Intronic
1078459023 11:11499396-11499418 GTCAGGGGTGGGAGGGCAGTGGG - Intronic
1078689261 11:13562612-13562634 CAGTGGGGAAGTAGGGAAGTGGG - Intergenic
1079142341 11:17820238-17820260 TTTGGGGGAGGGAGGGCAGTGGG - Intronic
1080331319 11:31142903-31142925 CTGTGGGCAAGGAGGGTATTGGG + Intronic
1080643003 11:34168789-34168811 CCCTGGGTTAGGTGGGCAGTTGG + Intronic
1080776974 11:35395101-35395123 CCCTGAGTAGGGAGGGCAGTGGG + Intronic
1081610049 11:44556522-44556544 CTCTTGGGCTGGAGCGCAGTGGG + Intergenic
1081623355 11:44632237-44632259 CCCTGGGGAAGGAATGCAGCTGG + Intergenic
1083325727 11:61872078-61872100 TTCTGGGGCAGGAGAGCACTGGG - Intergenic
1083593875 11:63909948-63909970 CTCTGGGGAGGAGGGGCAGAGGG - Exonic
1083600460 11:63944317-63944339 CTCAGGGAAAGGAGGGGTGTTGG + Intronic
1084043112 11:66554121-66554143 CTCTGTGGAAGGTGAGCAATGGG + Exonic
1084214414 11:67639772-67639794 CTGTGCGGGAGGAGGGCAGGTGG + Intergenic
1084215993 11:67647115-67647137 CTCAGGGCAAGGATGGCGGTGGG + Intronic
1084238197 11:67801640-67801662 CACTTGGAAAGGAGGGCAGAGGG + Intergenic
1084509815 11:69596569-69596591 TTCTGGGGAAAGAAAGCAGTTGG - Intergenic
1084834213 11:71791194-71791216 CACTTGGAAAGGAGGGCAGAGGG - Intronic
1084957432 11:72698784-72698806 CTCTGCAGAAGAAGGGCTGTGGG - Intronic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1085386861 11:76162607-76162629 CCCTGGAGAAGGAGGGCAGGTGG - Intergenic
1085829726 11:79886511-79886533 CTCTGGGGAAGGGGGCCTGAGGG + Intergenic
1086806131 11:91245078-91245100 CTCTGGGGAAGCAGGTCATTAGG - Intergenic
1087053745 11:93911329-93911351 GCCTGGGGAAGGAAGGCAATGGG - Intergenic
1088532458 11:110825898-110825920 GTCTAGGGAATGAAGGCAGTGGG + Intergenic
1088827327 11:113506925-113506947 CCTTGGGGAATGAGGGCAGAAGG + Intergenic
1089519592 11:119055061-119055083 CTGAGGGGAAGGAAGGTAGTTGG + Intronic
1089775431 11:120832232-120832254 CACTGGGGCAGCAGGGCAGTAGG + Intronic
1090671003 11:128945307-128945329 CTCTGGGGCAGGTGGGCTGTGGG - Intergenic
1090965349 11:131593199-131593221 CACTGGGGAAGGAGAGGTGTAGG - Intronic
1091078254 11:132641326-132641348 CTCTGGGCAAGGAGAGGAGGTGG - Intronic
1091290031 11:134434330-134434352 CTCTGCAGGAGGAGGGAAGTAGG - Intergenic
1091404524 12:200902-200924 CTGTGGGGGAGGTGGGGAGTGGG - Intronic
1091444746 12:537868-537890 CTCTGGGGCAGGAGTGAAGGAGG + Intronic
1091584883 12:1810438-1810460 CTGCAGGGAAGGAGGGCATTTGG + Intronic
1091996675 12:4999253-4999275 CTCTGGGGAAGAAGCACAGGTGG + Intergenic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1094812449 12:34151689-34151711 ATGTTGGGAAGGAGGGCAGAGGG - Intergenic
1096552107 12:52379674-52379696 CTCTGGGGAAGGCAGGCTCTGGG + Intronic
1096777396 12:53972710-53972732 CTCTGGGGAAATCAGGCAGTGGG + Intergenic
1096807409 12:54149018-54149040 CACTGGGGAAGGAGAGGTGTGGG - Intergenic
1097107552 12:56634552-56634574 CTACGGGGAAGGAGAGGAGTTGG + Intronic
1097268281 12:57758435-57758457 CCCTGGAGAAGCAGGGAAGTGGG - Intronic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1098219371 12:68252448-68252470 CTCTGTGGAAGGAGGGAAGGAGG + Intronic
1099763801 12:86956116-86956138 ATGTGGGGAAGGAGGGCATCAGG - Intergenic
1100292110 12:93225744-93225766 CTCTGGGGAAGGAGAGAAATGGG - Intergenic
1100549966 12:95638251-95638273 ACCTGGGGAAGGAGAGCAGCAGG + Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101388895 12:104282215-104282237 CTCTGGTGAGTGATGGCAGTGGG + Intronic
1101465503 12:104944759-104944781 ATCTGGGAAAGAAGGGTAGTTGG - Intronic
1101874421 12:108589290-108589312 CCCTGGGGCTGGGGGGCAGTGGG - Intergenic
1101985570 12:109443925-109443947 CGCTAGGGGAGGAGGGCAGATGG - Intronic
1102494786 12:113312051-113312073 CTCTGTGGGAAGAGGGGAGTTGG + Intronic
1102769503 12:115462695-115462717 CTCTGGGAAACCAGGACAGTTGG + Intergenic
1103164402 12:118757615-118757637 CTCCCTGGAAGAAGGGCAGTGGG + Intergenic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1103506123 12:121443253-121443275 CTGTGGGGTGGGAGGTCAGTTGG - Intronic
1103966244 12:124641722-124641744 CTCTGGGCAAGGAGGGAGCTAGG - Intergenic
1104571513 12:129929999-129930021 CACTGGGGAATGAGTGCATTGGG - Intergenic
1104843885 12:131837197-131837219 CTCTGAGGAAGGAGCCCAGAGGG + Intronic
1104902677 12:132197763-132197785 CTCTGGGGAAGGGGGGCCGTGGG - Intronic
1104974612 12:132546727-132546749 CCCTGGGGAAGCTGGGCAGCTGG - Intronic
1105855781 13:24370891-24370913 CACTGGGGGAGGAGTGCACTTGG - Intergenic
1106133969 13:26960850-26960872 CTCTGGGGAAGATTGGCAGCAGG + Intergenic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1106480389 13:30133183-30133205 CTCTGGGGAAAGAGGGTGGCTGG - Intergenic
1107985811 13:45775388-45775410 CTCTCTGCAAGGAGGCCAGTGGG - Intergenic
1108103684 13:46985528-46985550 CTGTGGGAAACGTGGGCAGTAGG + Intergenic
1109177958 13:59178582-59178604 AACTGGGGAAGGAGGGAAATGGG - Intergenic
1110568517 13:76979898-76979920 CCCTGGGGACGGAGAGCATTAGG + Intergenic
1111993284 13:95137972-95137994 CTTTGGGGAAAGTGGGCGGTGGG + Intronic
1112302275 13:98240983-98241005 CTCAGGAGAAGGAAGGCAGAAGG + Intronic
1112402246 13:99086840-99086862 CACTGGGGAAGGTGGGGGGTCGG + Intergenic
1113325591 13:109278149-109278171 CTTTGGGGAAGGATTTCAGTAGG - Intergenic
1113778129 13:112960544-112960566 TTCTGGGGAAGGGGGGCTTTGGG + Intronic
1113947186 13:114050976-114050998 CGCTGGGGAAAGGGGGCAGCCGG + Intronic
1114740664 14:25093892-25093914 TTCTGAGGATGAAGGGCAGTGGG + Intergenic
1117080936 14:52151173-52151195 CTCTGGGGAAGGAGCAAAGTTGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117222946 14:53624701-53624723 TTCGGAGTAAGGAGGGCAGTAGG + Intergenic
1117458570 14:55922131-55922153 CTCTAAGGAATGGGGGCAGTGGG - Intergenic
1118360587 14:65053363-65053385 CTCTGGGGAGGGAAGGGAGAGGG + Intronic
1118839792 14:69501713-69501735 TCCTGGGGAGGGAGGGCAGATGG - Exonic
1118845373 14:69544058-69544080 CTCTGAGTAGGGAGGTCAGTAGG + Intergenic
1119894276 14:78206639-78206661 CTCCAGGGAAGGAGTGCAGGCGG - Intergenic
1120118404 14:80648186-80648208 CTCTGAGTCAGGAGAGCAGTTGG + Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1121273622 14:92653250-92653272 CTCTAGGGAAGGGGGGGAGCCGG - Intronic
1122006298 14:98706633-98706655 GCCTGGGGAAGGGGGACAGTGGG - Intergenic
1122221009 14:100239146-100239168 CCGTGGGGAAGGAAGGCAGAGGG - Exonic
1122318748 14:100840834-100840856 AGTTGGGGAAGGAGGACAGTCGG + Intergenic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1122551605 14:102553016-102553038 CTCTGGGCAAGGCTGGGAGTGGG - Intergenic
1122847831 14:104510415-104510437 CCCTGGGGCAGGAGGGGAGGGGG - Intronic
1123024518 14:105418506-105418528 CTCTGGGGAGAGAGGGCTATGGG - Intronic
1123476666 15:20595968-20595990 TCCTGGGGAAGGTGGGAAGTGGG + Intergenic
1123641345 15:22404396-22404418 TCCTGGGGAAGGTGGGAAGTGGG - Intergenic
1125242045 15:37586965-37586987 CTCTGGGGAGGGGTGGCAGAAGG - Intergenic
1125477707 15:40058624-40058646 CTCAGGGGAAGGAGAGGAGAGGG + Intergenic
1125828162 15:42693160-42693182 CCCTGGGGAATGAGGGGAGCTGG - Exonic
1126103630 15:45134324-45134346 CTCTGGGGAAGGAAGCCGGTGGG + Intronic
1126119913 15:45242344-45242366 CTATGGGTAAGTAGGGCACTTGG - Intergenic
1127337727 15:58006172-58006194 CTTTGGGGAAGGATGGGAGTGGG - Intronic
1128347039 15:66860870-66860892 GCCTGGGGAAGGAGGGCAAAGGG + Intergenic
1128559533 15:68655555-68655577 TTCTGGGGAAGGGGGCCAGAGGG - Intronic
1128969001 15:72089534-72089556 CTCTGGGAAAGGAAGGGAGGAGG + Intronic
1128978367 15:72169219-72169241 CACTGGGGAAGGTGGGCCCTTGG - Intronic
1129465278 15:75721364-75721386 CTGTGGGGAAGGTGGTCTGTGGG + Intergenic
1129654764 15:77516736-77516758 CCCAGGGGAAGAAGGGGAGTGGG + Intergenic
1129682815 15:77667506-77667528 CCCTGGTGCAGGAGGGAAGTGGG + Intronic
1129694189 15:77731274-77731296 CTCTGGGAAACTAGGGCAGTGGG - Intronic
1130165349 15:81451247-81451269 CTCTGTGGAAGGAGAGAAGCAGG + Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130563726 15:84978175-84978197 CTCTACGGAAGGAAGGGAGTGGG + Intergenic
1130985717 15:88843289-88843311 CTCTGGGGATGCAGAGCAGGGGG + Intronic
1131059312 15:89394899-89394921 CCCTGGGGAAGGAGGGGCGGTGG - Intergenic
1131306883 15:91252827-91252849 CTCAGGGGGAGGAGGGCTGGAGG - Intronic
1131910965 15:97200925-97200947 CACAGGGGAAGGAGGCCAGTGGG - Intergenic
1132066096 15:98732498-98732520 GTCTGGGGAAGGAGGGAAGCTGG + Intronic
1132199650 15:99942559-99942581 TTTTGGGGGAGGAGGGGAGTGGG + Intergenic
1132571866 16:647762-647784 GGCTGTGGGAGGAGGGCAGTCGG - Exonic
1132871555 16:2117754-2117776 CCCTGGGGAGGAAGGGGAGTGGG + Intronic
1133103098 16:3491030-3491052 CTCTGGGGAATGAGTGTTGTGGG + Intergenic
1133180205 16:4048673-4048695 CTCTTGGGAAAGAAGGGAGTGGG - Intronic
1133349843 16:5094087-5094109 CACTTGGAAAGGAGGGCAGAGGG + Intronic
1134073275 16:11273614-11273636 CTCTGGGCAAGGAGGTGAGGCGG + Intronic
1134440721 16:14298377-14298399 GCCTGGGGAAGGAGGACAGGAGG - Intergenic
1134520974 16:14919141-14919163 CCCTGGGGAGGAAGGGGAGTGGG - Intronic
1134550598 16:15136832-15136854 CCCTGGGGAGGAAGGGGAGTGGG + Intronic
1134708650 16:16317792-16317814 CCCTGGGGAGGAAGGGGAGTGGG - Intergenic
1134715863 16:16357825-16357847 CCCTGGGGAGGAAGGGGAGTGGG - Intergenic
1134745586 16:16585551-16585573 CTGTGGGGAAGGAGGGCTTGAGG + Intergenic
1134950954 16:18350853-18350875 CCCTGGGGAGGAAGGGGAGTGGG + Intergenic
1134958893 16:18394334-18394356 CCCTGGGGAGGAAGGGGAGTGGG + Intergenic
1135159429 16:20080593-20080615 GTGTGGGGATGGAGGGCATTTGG - Intergenic
1135469923 16:22721292-22721314 CCCTGGGGAAGGAGGCCAGGTGG + Intergenic
1136234703 16:28906225-28906247 GGCTGGGGCAGGAGGGCAGGAGG + Intronic
1136547998 16:30966082-30966104 CACAGGGGCAGGAGGGCAGAGGG + Exonic
1137522127 16:49203420-49203442 CTCTGGGGAGGAGGGACAGTTGG - Intergenic
1137571408 16:49568606-49568628 CTGTGGGGCAGGAGAGCAGGCGG - Intronic
1138221401 16:55254759-55254781 CTATGGGGGAGGAGGGAAATGGG - Intergenic
1138449808 16:57086953-57086975 CTCTGGGGAGGGAGGGTCATGGG - Intergenic
1138487767 16:57357847-57357869 CTCAGGGGAAGGAGACCAGTGGG + Intergenic
1138777460 16:59741068-59741090 CTATGAGGAATGAGGGCAGCTGG + Intronic
1140252468 16:73306143-73306165 CTCTAGGGCAGGAGAACAGTAGG - Intergenic
1140473472 16:75227293-75227315 CTCTGGGAGAGGAGGTGAGTGGG + Intergenic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1142014947 16:87740427-87740449 CTCTGGAGCAGGAGGGGAGGCGG - Intronic
1142024451 16:87804971-87804993 CTCTGGGGAAGGAAGGATGACGG - Intergenic
1142131447 16:88433299-88433321 CACTGTGGAAGGAGGGAAGGTGG + Exonic
1142132019 16:88435507-88435529 CTCTGTGGAAGGAGGGCCTGAGG + Exonic
1142177615 16:88652181-88652203 CTCTGAGAAAGGAGCTCAGTGGG - Exonic
1142235382 16:88920065-88920087 ATCTGGGGAAGGAGGGAGGCAGG - Intronic
1142484438 17:237429-237451 CTCTGGGGAAGGATGGACGGTGG + Intronic
1142686154 17:1578050-1578072 CTCGTGGGAAGCAGGTCAGTGGG - Intronic
1142733236 17:1877329-1877351 TGCTGGGGAGTGAGGGCAGTGGG + Intronic
1142967910 17:3592443-3592465 CCCTTGGCAAGGAGGGCAGGTGG - Intronic
1144086403 17:11812885-11812907 CTTTGGGGTAGGAGGGAAGTTGG - Intronic
1144443257 17:15303261-15303283 GCCTGGAGAAGGGGGGCAGTGGG + Intergenic
1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG + Intronic
1144872068 17:18377828-18377850 GGCTGGTGAAGGAGGGCAGGAGG - Exonic
1145065757 17:19760171-19760193 CCCTTGGGAAGGAGGGCCGCAGG - Intergenic
1145775055 17:27521837-27521859 CTATGGGAAAGGCAGGCAGTTGG + Intronic
1147167683 17:38602138-38602160 TTCTGGGGGAGGTGGGCAGAGGG - Intronic
1147425893 17:40345707-40345729 CTCTGGGGAGGGAGGTTAGCAGG + Intronic
1147556767 17:41484618-41484640 CTTTGGGCAGGGGGGGCAGTTGG - Intergenic
1147980480 17:44271006-44271028 CTCTGGGGAAGCAAGGCACGAGG + Intergenic
1148738611 17:49879507-49879529 ATGTGGGGAATCAGGGCAGTGGG + Intergenic
1148863770 17:50618201-50618223 CTCTGGGGGAGGAGGGAAAGGGG - Exonic
1149881048 17:60290788-60290810 CTCTAGGGAGGGAGGGGAGAGGG + Intronic
1150009145 17:61488400-61488422 CTCTGGGGCAGGAGGGCTCAGGG + Intergenic
1150494481 17:65596829-65596851 CTATGGGGAAAGAGGGCTCTGGG + Intronic
1151349334 17:73522400-73522422 GTCTGCTGAAGGGGGGCAGTTGG + Intronic
1151475569 17:74342837-74342859 CTCTGGGGCTGGAGGGCCCTGGG - Intronic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1151718609 17:75843759-75843781 CTCTGGGGAAGGGAGGGAGGTGG - Intronic
1151977467 17:77490691-77490713 ATCTGGGGGAGCGGGGCAGTGGG - Intronic
1152033228 17:77856531-77856553 CTCTGGGGAGGAGGGGCAGCTGG - Intergenic
1152175006 17:78781878-78781900 CTCTGAGGAATGAGGGTCGTTGG - Intronic
1152239814 17:79155376-79155398 CTCTCGGGCAGGAAGCCAGTGGG + Intronic
1152240633 17:79159109-79159131 CTCTGTGGCAGGTGGGTAGTGGG + Intronic
1152288441 17:79425418-79425440 CTCTGGGGAGTGCAGGCAGTTGG - Intronic
1152444269 17:80331773-80331795 TTCTGGGTAAAGATGGCAGTGGG - Intronic
1152686483 17:81696208-81696230 CTCTGGGGGAGGCAGGCAGAGGG - Intronic
1152727091 17:81952805-81952827 AGCCGGGGCAGGAGGGCAGTGGG + Exonic
1152911883 17:83009935-83009957 CTGTGGGGGAGGGGGGCTGTGGG + Intronic
1153979217 18:10295042-10295064 CTCTGGGAAAGGATGGCTCTGGG + Intergenic
1154190388 18:12226209-12226231 CTTTGGGGTCTGAGGGCAGTGGG - Intergenic
1154437854 18:14360691-14360713 CTCTGGGGGCGGAGAGCAGAGGG - Intergenic
1156534384 18:37848696-37848718 CTCTGGGTAATGAGGGTAATAGG + Intergenic
1157347941 18:46857122-46857144 CTCTTGGTAAGGAGAACAGTGGG - Intronic
1157425790 18:47583235-47583257 CTCTGGGGGAGATGGGCTGTGGG - Intergenic
1157752587 18:50193272-50193294 CTCTGGGGGAGGAGGGGAGGAGG - Intronic
1157993606 18:52527860-52527882 CTCTGGGGAGGGAGAGCAACTGG + Intronic
1159018838 18:63126313-63126335 CCCCGCGGAAGGAGGGCAGGAGG + Exonic
1159321701 18:66859343-66859365 GTCTAGGGAAAGAGGGAAGTGGG + Intergenic
1159825387 18:73202341-73202363 CTCTGGGGAGCAAGGGGAGTAGG - Intronic
1160244396 18:77145497-77145519 CTCTGAGGAAGCAGGACAGATGG - Intergenic
1160336424 18:78044365-78044387 CTTTGGGGAATAAGGGTAGTAGG - Intergenic
1160671781 19:368468-368490 CTCTGGGGAGGGAGGGAGGGAGG + Intronic
1160707917 19:538363-538385 CTCTGGGGCATGAGGGCGATGGG - Intronic
1160744264 19:703523-703545 CTCTGGTGAAAGAGTGGAGTAGG + Intergenic
1160790023 19:918924-918946 CTCTGGAGCAGGAGGGGAGGAGG + Intronic
1160917317 19:1503446-1503468 GACAGGGGAGGGAGGGCAGTGGG + Intergenic
1161198485 19:3000723-3000745 CCTTGGGGAAGGAGAGCAGCAGG + Exonic
1161358349 19:3832084-3832106 CCATGGGGGAGGAGGGCTGTGGG + Intronic
1161426982 19:4209017-4209039 GGCTGGGGTGGGAGGGCAGTGGG + Intronic
1162406174 19:10475214-10475236 ACCTGGGGAAGGAGTGGAGTCGG + Intergenic
1162450273 19:10750104-10750126 CACTGGGGAAGGTGGGAGGTTGG + Intronic
1163106243 19:15124666-15124688 CACTGGGGAAGGAGGTAGGTGGG + Intronic
1163128032 19:15254968-15254990 CTTTGGGGAAGGAGGAAAGGCGG - Intronic
1163148295 19:15397076-15397098 CTCTGGGGAGGTTGTGCAGTTGG - Intronic
1164441096 19:28281617-28281639 GTGTGGGGAAGGAAGGCGGTAGG - Intergenic
1165121289 19:33560513-33560535 CTGTGGGGAAGGACAGGAGTGGG - Intergenic
1165407732 19:35641375-35641397 GTCTGGAGAAGGAGAGCAGTGGG + Intergenic
1165702459 19:37948954-37948976 CACTGTGGCAGGAGGGCAGCGGG + Intronic
1166039816 19:40195022-40195044 ATCTGGGGAAGGGGAACAGTGGG + Intronic
1166756510 19:45195598-45195620 CTCTGAGGAAGGAAGGAAGGAGG - Intronic
1166816087 19:45547069-45547091 CTATGGGGAAGGAGGGAGGGAGG + Intronic
1167111759 19:47466489-47466511 CACTGGGGAAGGAGGGTTGGGGG + Intronic
1167373872 19:49101078-49101100 CCCGGGGGCAGGAGGGCAGGAGG - Intronic
1167587410 19:50382829-50382851 AGCTGGGGAGGGAGGGCAGCCGG - Exonic
1167607199 19:50487728-50487750 CTCCCGGGAGGGAGGCCAGTGGG + Exonic
1167685330 19:50952552-50952574 CTCTGGGGTGGGAGGGTTGTGGG - Intronic
1168008343 19:53509212-53509234 CACAGAGGAAGGAGGGCAGATGG - Intergenic
1168107780 19:54174691-54174713 ATCTGAGGGAGGAGGGAAGTGGG - Intronic
1168250821 19:55140999-55141021 CTCTGGGGAAGGAAGACTGGGGG - Intronic
1168277402 19:55285277-55285299 GTCTGAGGGAGGAGGGCGGTCGG + Intronic
1168430569 19:56276193-56276215 TTCTGGGGAAGGGTGGCACTTGG + Intronic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
925056334 2:860444-860466 CGCTGGGGAAGGCCGGCATTAGG - Intergenic
925135101 2:1521501-1521523 GTCTGGGGAAAGAGGGCCCTGGG - Intronic
926330810 2:11823651-11823673 ATCTGGGGATGGCTGGCAGTGGG + Intronic
927515956 2:23671808-23671830 GGCTGGGGATGGAGGGCAGCGGG + Intronic
927739474 2:25554924-25554946 CTCTGAGGAAGGAGGAAAATGGG + Intronic
928270350 2:29849765-29849787 CTCTGAGGAAGAAGAGGAGTGGG + Intronic
928454031 2:31403283-31403305 CTCTGAATAAGGAGGCCAGTGGG - Intronic
928702415 2:33912441-33912463 CACTGGGGAAGCAGGTCAGTTGG - Intergenic
929067749 2:37996951-37996973 CTCTGGGTCAGGAGGCCAGTTGG + Intronic
929075317 2:38075466-38075488 CTCTGGGGACTGAGTGCCGTTGG + Intronic
931847853 2:66222801-66222823 CTCCAGGTAAGGATGGCAGTGGG + Intergenic
933460979 2:82585079-82585101 CTGTCAGGAAGGAGGGCAATGGG - Intergenic
933846881 2:86333988-86334010 CCCTGGGGACGGAGGTCAGCAGG - Intronic
933980336 2:87544242-87544264 TTTTGGGAAAGGAGGGGAGTGGG - Intergenic
934176508 2:89583330-89583352 GGCAGGGGAAGGACGGCAGTGGG - Intergenic
936267311 2:111020395-111020417 CTCTGGGGATGGAGAGCTGGTGG + Intronic
936285656 2:111179161-111179183 GTCTGGGGAGGGAGGACAGCCGG + Intergenic
936313490 2:111406549-111406571 TTTTGGGAAAGGAGGGGAGTGGG + Intergenic
936667542 2:114613979-114614001 CCCAGGGGAGGGAGGGCATTAGG + Intronic
936893781 2:117403817-117403839 CTCTAGGGCAGGAGAGTAGTTGG + Intergenic
937163038 2:119784227-119784249 TTCTGGGGAAGGAGGGGTGGGGG - Intronic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937364208 2:121249086-121249108 CTCTGGGGAGGGAGGCCAGCAGG + Exonic
938140791 2:128793400-128793422 TTCTGGGGATGGGGGGGAGTGGG + Intergenic
938828570 2:135031648-135031670 ATGTGGGGAAGAAGGGAAGTGGG + Intronic
939378960 2:141409489-141409511 CTCTGTGGAAGGAGAGGAGAAGG - Intronic
940009964 2:149042019-149042041 TTCCGGGGAAGGTAGGCAGTGGG - Intronic
941360087 2:164540672-164540694 CTCTGGGGAGGGAAAGCAGGAGG - Intronic
941721957 2:168821777-168821799 CCCTGAGGCAGGATGGCAGTTGG + Intronic
941773090 2:169363901-169363923 CCCTGGGGAAGGGAGGCAGCGGG - Intergenic
942246536 2:174013337-174013359 CTCTGGGGAAGGGGAGGAGAGGG - Intergenic
943890810 2:193284619-193284641 CTTTGGGGAAGGATGGAAGTGGG - Intergenic
944980484 2:205113515-205113537 TTCTGGGGAAGGAGGCCCATTGG + Exonic
945146080 2:206739467-206739489 CCCTGGGGAATGTGGGAAGTGGG + Intronic
945679582 2:212897887-212897909 CTCTGGGGAAGGATAGGAGGAGG + Intergenic
946016325 2:216606858-216606880 CTGTGAGGAAGGAAGGCAGGTGG - Intergenic
946061933 2:216950107-216950129 CTCTAGGGAATGAGGGCTGATGG + Intergenic
946096249 2:217276874-217276896 CTCTTTGGAAGGAAGGCACTAGG + Intergenic
946180711 2:217947282-217947304 CTTGGGGGAGGGAGGGCAGGAGG + Intronic
946276083 2:218632905-218632927 CTATGGGGAAGGGAGGCAGAGGG + Intronic
947809015 2:232988184-232988206 CACTGGGGGAGGAGGGGAGGTGG + Intronic
947908960 2:233789408-233789430 GTGTAGGGAAGGAGGACAGTGGG + Intronic
948152458 2:235755078-235755100 CCCTGGGGAAGGGAGGCACTGGG + Intronic
948179171 2:235966255-235966277 CTCTGGGGATGGAGGAGAGGGGG + Intronic
948341543 2:237256650-237256672 GTCTGGGAAAGGAGGGCAGTTGG - Intergenic
948647639 2:239417457-239417479 CACTGTGGAAGGTGGGCACTGGG - Intergenic
948802359 2:240438630-240438652 CTCGTGGGAAGGAGAGCAGTTGG + Intronic
948883456 2:240871680-240871702 CCCTGGGGACAGAGGTCAGTGGG - Intronic
949054751 2:241921768-241921790 CTCTGGGACAGGAGGCCAGGGGG + Intergenic
949054845 2:241922089-241922111 CTCTGGGACAGGAGGCCAGGGGG + Intergenic
1168807497 20:681107-681129 CTCCTGGGCAGGAAGGCAGTAGG - Intergenic
1169045947 20:2534679-2534701 CCCCGGGGCATGAGGGCAGTGGG - Intergenic
1169674938 20:8142915-8142937 CTCAGGGGCAGGAGGGCAGCTGG - Intronic
1170488983 20:16851910-16851932 CTCGGGGGAAGGATGGCAGGAGG - Intergenic
1170551662 20:17482089-17482111 AGCTGGGGAGGGAGGGCGGTGGG - Exonic
1170562959 20:17572921-17572943 CTCTAGGGAGGGAAGGGAGTGGG - Intronic
1170967701 20:21090519-21090541 CTCTGGAGAAGGTGGGAATTAGG - Intergenic
1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG + Intergenic
1171423854 20:25037320-25037342 CTCAGGGGAAGGAGGACACAGGG - Intronic
1172387930 20:34547093-34547115 CTCTGTGGAGTGAGGGCAGCAGG + Intronic
1172444396 20:34985502-34985524 AGCTGGGGCAGGAGGGCCGTGGG - Intronic
1172485247 20:35293992-35294014 CTCTGGGGAAGGGGGTGAGCAGG + Intergenic
1172709328 20:36908479-36908501 CTCTGGGAAACCAAGGCAGTTGG - Intronic
1173000158 20:39099663-39099685 CTCAGGCCAAGAAGGGCAGTGGG - Intergenic
1173327794 20:42049582-42049604 CCCTGGGGAATGAGGGAATTTGG - Intergenic
1173833707 20:46111101-46111123 TTGAGGGGAAGGAGGGCAGGAGG + Intergenic
1173974323 20:47175623-47175645 ATCTGGGGAAGGTGGGAAGGAGG + Intronic
1174139427 20:48402740-48402762 CTCTGGGGAGTAGGGGCAGTGGG - Intergenic
1174184837 20:48699060-48699082 CTCTAGAGGAGGAGGACAGTGGG + Intronic
1174322544 20:49753304-49753326 CTCTGGGGAGGGGGGACTGTTGG - Intergenic
1174354351 20:49988270-49988292 TTCTGTGGAGGGAGGGCAGCTGG + Exonic
1175655220 20:60763978-60764000 GTCTGGGGAAGGAGGGGGCTGGG - Intergenic
1175671789 20:60909605-60909627 CCAAGGGGAAGGAGGGCATTAGG - Intergenic
1175734564 20:61376350-61376372 CCCAGGGGAAGGAGGGCAAGAGG + Intronic
1176214353 20:63941252-63941274 CTGTGGGGAGGGAGGGCTCTGGG - Intronic
1176412934 21:6458518-6458540 CACAGGGGAAGGAGGACAATGGG - Intergenic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1177867100 21:26525485-26525507 CTCTGGGGAAGGAAGGCGGCAGG - Intronic
1177905919 21:26970846-26970868 AGCTGGGGAAGGAGGGAAGAAGG - Intergenic
1178020006 21:28396788-28396810 AGCTGGGGACCGAGGGCAGTGGG - Intergenic
1178598557 21:33976476-33976498 CTCAGAGGAAGGAGGGCAGCAGG - Intergenic
1179049930 21:37880459-37880481 CTCAAGTGAAGGAGGGAAGTGGG + Intronic
1179482351 21:41686133-41686155 GTGTGGGGCAGGTGGGCAGTGGG + Intergenic
1179823981 21:43953600-43953622 TCCTGTGGAAGAAGGGCAGTGGG + Intronic
1179996695 21:44977510-44977532 CTCTGGGGGCGGAGAGCAGAGGG + Intergenic
1180131204 21:45828419-45828441 TACTGGGGTGGGAGGGCAGTGGG - Intronic
1181049360 22:20231341-20231363 GGCTGGGGCAGGAGGGCTGTGGG + Intergenic
1181159082 22:20946296-20946318 CTCTGGACAAGTAGGGCTGTAGG + Intronic
1182298339 22:29323826-29323848 ATCTGGGGAAAAAGGGAAGTTGG + Intergenic
1182352079 22:29704804-29704826 CTCAGGGTTGGGAGGGCAGTGGG + Intergenic
1182486170 22:30640477-30640499 CTCTGATGAAAGAGGGCAGCAGG + Intronic
1182617448 22:31597267-31597289 CTCTGGAGAAAAAGGGCAGAGGG + Intronic
1183343399 22:37294267-37294289 GGCTGGGGGAGGTGGGCAGTGGG + Intronic
1184212489 22:43044083-43044105 CTCTCGGGGAGGAGGGTTGTTGG - Intronic
1184352814 22:43955632-43955654 CTCTGGGCCAGCAGGGCAGACGG + Intronic
1184612349 22:45612862-45612884 CTCTGGGGAAGGAGGAAAACAGG + Intergenic
1184834346 22:47012320-47012342 CTCAGGGGCAGGAGGGCTGGGGG - Intronic
1184865147 22:47198107-47198129 CCCTCGGGAAGGAGGCCAGCAGG - Intergenic
1184968821 22:48000648-48000670 CTCAGGGGAAGGATGGGAGGTGG - Intergenic
1185088340 22:48752669-48752691 CTCCTGGGAGGGAGGGCAGGAGG + Intronic
1185109238 22:48891648-48891670 CTCTGAGGAAGAAGAGCAGTGGG + Intergenic
1185134288 22:49060316-49060338 CTCTGGGGCAGGAGGGCTGGAGG - Intergenic
1185248978 22:49789687-49789709 CTGTGGAGAAGGTGGGCTGTAGG - Intronic
1185285363 22:49997529-49997551 CACTGGGGAAGGAAGGGAGGCGG - Intronic
949374293 3:3370040-3370062 CTCGGGGAAAGGATGGAAGTGGG - Intergenic
950097961 3:10340905-10340927 CTCTGGGGAAGAAAGGCCTTGGG + Intronic
950478905 3:13232574-13232596 GTCTGGGGAGAGAGGGCAGGGGG + Intergenic
950526869 3:13529364-13529386 CTCAATGGAAGGAGGGCAGGAGG - Intergenic
951855347 3:27190361-27190383 ATCTGGGGAAGGAAGGAAGTAGG + Intronic
952762939 3:36931459-36931481 CTCTGGGGAACCAAGGCAGGTGG + Intronic
952829599 3:37553726-37553748 CTCTGGGGAAGGTGATCATTTGG + Intronic
952882194 3:37991810-37991832 CCCTGAGGAAAGAGGGCAGGAGG + Intronic
952959616 3:38581114-38581136 CTCTGGGGGTGGCGGGGAGTAGG + Exonic
953392013 3:42539427-42539449 CTCAGGGGAAGGACAGCAGCTGG + Intergenic
954185115 3:48911045-48911067 CACTGGGGAAGGAGCGTAGATGG + Intergenic
954400145 3:50315236-50315258 CTGTGGGGAAAGCGGGGAGTGGG - Intergenic
954407157 3:50351607-50351629 TCCTGGGGAGGAAGGGCAGTGGG + Intronic
956733085 3:72214631-72214653 AGCTGGGTAAGGAGGGAAGTGGG - Intergenic
957034908 3:75284991-75285013 GCCTGTGCAAGGAGGGCAGTGGG - Intergenic
957054144 3:75431437-75431459 CCCTTGGAAAGGAGGGCAGAGGG + Intergenic
957580692 3:82068748-82068770 ATCTTGGGAAGGAGAGCAATTGG - Intergenic
959512023 3:107224798-107224820 CACTTGGGAAGGAGGGGAGTCGG - Intergenic
960738894 3:120811090-120811112 CCCTGGAGAAGGAAGGCATTTGG + Intergenic
961300694 3:125920276-125920298 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
961304684 3:125949864-125949886 ACCTGTGCAAGGAGGGCAGTGGG + Intergenic
961305161 3:125953786-125953808 CTCTGCTGAAGGAGGGCGGGGGG + Intergenic
961636189 3:128334727-128334749 TTCTGGGGAAGGAGGGAGGGAGG - Intronic
961773820 3:129269625-129269647 CTGTGAGGAAGGAAGGCACTGGG - Intronic
961954299 3:130785436-130785458 CTCTGAGGAGGTAGGGCAGGTGG - Intergenic
962279552 3:134039645-134039667 CACTGGGGCAGGAGGGCATGGGG + Intronic
962521386 3:136200560-136200582 TTCTGGGGAAGGATGACAGGAGG + Intergenic
962908803 3:139829129-139829151 CTCAGGAGAAGGAGAGCAGCAGG + Intergenic
963138415 3:141928689-141928711 CTCTCGGGCAGGAGGGAACTGGG + Intergenic
963286585 3:143439695-143439717 CTCTGGAGAATGAGGGGAGTTGG - Intronic
963286678 3:143440388-143440410 CTCTGGAGAATGAGGAGAGTCGG + Intronic
963770886 3:149384972-149384994 ATCTGTGGAAGGAGGCCAGCAGG - Intergenic
965122300 3:164576604-164576626 CTCTAGGCAAGGAGGGCCATTGG - Intergenic
966293384 3:178387268-178387290 CTCTGGGGGAGGATGTGAGTAGG - Intergenic
966678391 3:182614005-182614027 ATCTGGGTTGGGAGGGCAGTGGG - Intergenic
966716918 3:183021970-183021992 TTGTGGGGAAGGTGGACAGTAGG - Intronic
966805373 3:183803631-183803653 AGCTGGGGTAGGAGGGGAGTGGG + Intronic
966805393 3:183803719-183803741 AGCTGGGGTAGGAGGGGAGTGGG + Intronic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
966925883 3:184644341-184644363 TTCTGGAGAAGGAGGGGACTGGG - Intronic
966945981 3:184777403-184777425 ATCTGTGAAATGAGGGCAGTGGG - Intergenic
967802416 3:193677710-193677732 CACTGGGGGAGAAGGGCTGTGGG - Intronic
967844886 3:194035538-194035560 TTGTGTGGGAGGAGGGCAGTGGG - Intergenic
968441551 4:626916-626938 CTCTGAGGAAGAAGGGGAGGGGG + Intronic
968624046 4:1618568-1618590 CTCTGGGGAAGGAAGACGGGAGG + Intronic
968647806 4:1749010-1749032 CGGTGGGGAGGGAGAGCAGTGGG - Intergenic
968647932 4:1749291-1749313 CCTTGGGGAGGGGGGGCAGTGGG - Intergenic
968685251 4:1953588-1953610 CGCTTGGGAAGGTGGGCTGTTGG + Intronic
968911642 4:3479532-3479554 CCCTGGGGAAGGAGGGAATGTGG - Intronic
969682241 4:8649781-8649803 CTGTGGGGCAGGCGGGCAGCGGG - Intergenic
969757062 4:9156936-9156958 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
970268446 4:14316049-14316071 CTGAGGGGAAGGAAGACAGTAGG + Intergenic
971994992 4:33954542-33954564 CTCTGCGGAGGGGAGGCAGTTGG + Intergenic
972805689 4:42527919-42527941 CTCTGGGGAAGGATGGGAGAAGG - Intronic
973704991 4:53572286-53572308 TTCTGGGGAATGAGGGAGGTAGG + Intronic
973801465 4:54482826-54482848 GCCTGGGGAAGGAGGACAGGAGG - Intergenic
974436220 4:61860623-61860645 CTCTGGGGAAGGACCGCAGATGG - Intronic
975142395 4:70931769-70931791 CTCTGAGGCTGGAGTGCAGTGGG + Intronic
975447147 4:74479164-74479186 CTCTTGGGAAGAAAGGCACTTGG + Intergenic
976217889 4:82731819-82731841 CTCTGGGGACGGAAGGGAATGGG - Intronic
976389101 4:84491665-84491687 CCCTGGGGTTGGGGGGCAGTTGG - Intergenic
976785909 4:88820758-88820780 GTCTAGGGAAGGAGGGCAACAGG + Intronic
976928219 4:90529253-90529275 CACTGGGGCTGGAGTGCAGTGGG + Intronic
977226194 4:94394644-94394666 TTGTGGGGAAGGATGGGAGTGGG + Intergenic
977477477 4:97530826-97530848 CTTTGGGGAGGGAGAGCAGGGGG + Intronic
977586753 4:98783093-98783115 CTTTGGGGAAAGAGTGCTGTAGG + Intergenic
978050536 4:104194082-104194104 CTGGGGGGAAGGAGAGCATTAGG - Intergenic
978113905 4:104996103-104996125 CTTTGGGGAGGGAGAGCATTAGG - Intergenic
978258458 4:106721068-106721090 CTCTGGGGAGGGATAGCATTAGG - Intergenic
979069944 4:116189530-116189552 CTCTGGGAAATAAGGCCAGTAGG + Intergenic
980342054 4:131563482-131563504 CTATGGGGAAGGAGAGCATTAGG - Intergenic
980750324 4:137078735-137078757 CTCTGGGAAGAGAGGGGAGTAGG - Intergenic
982209078 4:153020485-153020507 GAGTGGGGAAGGAGGGGAGTGGG - Intergenic
983245955 4:165286887-165286909 CACTGGGGAAGGAAAGTAGTTGG + Intronic
984445842 4:179834415-179834437 CTCAGGGGAAGGACTGCAGGAGG - Intergenic
986157456 5:5190870-5190892 CTCTTTGGAGGTAGGGCAGTGGG - Intronic
986571590 5:9171197-9171219 CTCTGGGGAAGGGGTTGAGTTGG + Intronic
987182769 5:15385052-15385074 CTCTGGGGGAGAAGGGGAGAGGG - Intergenic
987183017 5:15386248-15386270 CTCTGGGGAAGGAGGAGGGATGG - Intergenic
987255739 5:16149145-16149167 CACTGGGTAAGGAGGACACTGGG - Intronic
987674836 5:21061985-21062007 CTCTGGTGAAGGGTGGCAGAAGG + Intergenic
988530572 5:32023722-32023744 CTCTGGGTACAGATGGCAGTGGG + Intronic
988594329 5:32577621-32577643 CTCTGGCTAAGCAGGGCTGTTGG + Intronic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
989679211 5:44009282-44009304 CTCAGGGGAAGTAGGGGAGAGGG - Intergenic
991415833 5:66392047-66392069 CTTTGGGGAAGGGTGGGAGTGGG + Intergenic
991470017 5:66957878-66957900 CCCTGGGCAAGGAGGGAAGTAGG - Intronic
991508361 5:67350064-67350086 CTGTGGGGAAGGAGTCCAGCTGG - Intergenic
992460313 5:76954008-76954030 CCCTGGGGGAGGAGGGCATGGGG - Exonic
993880339 5:93353349-93353371 CTCTTGGGCAGCAGGGCAGGGGG + Intergenic
994536899 5:101042634-101042656 TCCAGGGGAAGGAGGGCAGCAGG + Intergenic
995835797 5:116398298-116398320 ATCTGGGAAGGCAGGGCAGTGGG - Intronic
995865267 5:116683596-116683618 CTCTGGGAAAGCAAGGCAGGGGG + Intergenic
997260893 5:132464863-132464885 ATGCGGGGAAGGAGGGCAGTCGG + Exonic
997884136 5:137615526-137615548 CTCTGGGGAGGGGGGGCGGGGGG - Intergenic
999301821 5:150495924-150495946 CTCATTGGAAGGAGAGCAGTAGG + Intronic
1000404011 5:160866732-160866754 TTGTGGGGAAGGATGGGAGTGGG + Intergenic
1000728768 5:164804559-164804581 TACTTGGGAAGGAGTGCAGTGGG - Intergenic
1000988690 5:167889305-167889327 CACTGTGGACGGAGGGCTGTGGG + Intronic
1001270868 5:170310739-170310761 CTGGGGGTAACGAGGGCAGTGGG + Intergenic
1001566312 5:172701635-172701657 TTCTGGGGAGGGTGGGCAGAAGG + Intergenic
1001860210 5:175047763-175047785 CTCTGGGGCAGGAGGGTGGCAGG + Intergenic
1001923863 5:175622086-175622108 CTCTGGGGAAGGAAGGGGGTTGG - Intergenic
1002188830 5:177468545-177468567 CTCTGGGGAAGGCGGTGAATAGG + Intronic
1002270220 5:178066938-178066960 CTTTGTGGAAGGAGGGAAGGAGG + Intergenic
1002426622 5:179180613-179180635 TTCTGGGTAATGAGGGCAGGGGG - Intronic
1002563904 5:180099624-180099646 CTCTGGGGCAGCAGGGAAGGAGG - Intergenic
1002721188 5:181262082-181262104 CCCTGGGGAGGGAGGGCTGGGGG + Intergenic
1002791960 6:443680-443702 CTCTGGGGAAGGAGTGCCTGGGG - Intergenic
1003247287 6:4393516-4393538 CTAAGGGGAGGGAGGGCATTAGG + Intergenic
1003453218 6:6256671-6256693 CTCTGGGTCGGGAGGACAGTGGG - Intronic
1003627279 6:7753513-7753535 CTGTGCAGAAGGAGGGCTGTGGG - Intronic
1003948249 6:11094291-11094313 CTTGGGGGCAGAAGGGCAGTCGG - Exonic
1004116384 6:12771832-12771854 CTCTGGGGAGGGATAGAAGTTGG + Intronic
1005940767 6:30557563-30557585 CGCTGGGGAGGGATGGAAGTGGG + Intronic
1006112908 6:31759566-31759588 GCCAGGGGAAGGAGGGGAGTGGG + Intronic
1006225957 6:32536259-32536281 CTTTAGGGAAGAAGGGCTGTGGG - Intergenic
1006510842 6:34520276-34520298 CTCTGGGTAAGGCGAGGAGTGGG + Intronic
1006516538 6:34548763-34548785 CGCTGGGGCAGGAGGGCTTTGGG - Intronic
1006554972 6:34858391-34858413 CTCTGGGGAGGGAGGGTATTAGG - Exonic
1006779622 6:36623491-36623513 CTCTGCAGGAGGAGGGGAGTTGG + Intergenic
1007476332 6:42122264-42122286 CTCTGGGGCAAGAAGTCAGTAGG + Intronic
1007479747 6:42142270-42142292 CTCCGGGGACGGAGGGCGCTGGG - Intronic
1007702971 6:43775079-43775101 CTCTGGGGAGGGAAGGCCCTGGG + Intronic
1008527259 6:52419578-52419600 CTCTACGGAAGGAGGGAAGTAGG + Intergenic
1008536416 6:52509463-52509485 CGCTGGGACAGGAAGGCAGTGGG + Intronic
1009815475 6:68727903-68727925 CTCTGGTGAAGGAGTTCAATTGG - Intronic
1010175621 6:73024869-73024891 CTGGTGGGAAGGTGGGCAGTGGG - Intronic
1010595143 6:77754113-77754135 TTCTGGGGAGGGATGGCATTAGG + Intronic
1011519923 6:88194258-88194280 CTCTGGATAAGGAGGTCGGTGGG + Intergenic
1012052634 6:94362622-94362644 CTCTGGGGATGCAGGGCACAGGG + Intergenic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1015402523 6:132802224-132802246 CTTTGGGGAACCAGGGCAGATGG - Intergenic
1015941222 6:138454115-138454137 CTCTGGGGAAGTAGGGAGATGGG - Intronic
1016982387 6:149864590-149864612 TTCGGGGGAATGGGGGCAGTGGG + Intergenic
1018271193 6:162079659-162079681 AGGTGGGGAAGGAGGGAAGTGGG - Intronic
1018964476 6:168473841-168473863 GTGTGAGGAAGGAGGGCAGGGGG + Intronic
1019343862 7:520360-520382 CTTTGGGGAAGGAGGGGGGCGGG + Intergenic
1019398594 7:837123-837145 CCCTGGGGCAGCAGGACAGTGGG + Intronic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1019999922 7:4749790-4749812 CTCTGGGGACGGAGCCCAGCTGG + Intronic
1020112593 7:5455961-5455983 CACTGGGGAAGGAGCACAGAGGG - Intronic
1023171891 7:37398013-37398035 ATATGGGGAAGGAGAGCATTAGG + Intronic
1023372590 7:39527030-39527052 ATCTGGGGAGGGAGAGCATTAGG + Intergenic
1023585553 7:41726130-41726152 CTTTGGGAAGGGAGGGCATTTGG - Intergenic
1023849197 7:44140826-44140848 CTCTAGGGAAGGTGGGAGGTGGG + Intronic
1024300650 7:47885088-47885110 CTCTGGGAAAGGAGGGCTGAGGG - Intronic
1024396846 7:48879325-48879347 CTCTGGGGTAGGAGTGTAGGAGG - Intergenic
1025035562 7:55590882-55590904 CCCTGGGGAAGGAGAGAAGCAGG - Intergenic
1026566874 7:71496554-71496576 CTTCGGGGAAGGAGGGCAGGTGG - Intronic
1026834373 7:73628311-73628333 GGCTGGGGAAGGAGGGATGTTGG - Intergenic
1026924100 7:74177499-74177521 CCTGGGGGAAGGAGGGCAATAGG - Intronic
1027344605 7:77244792-77244814 TCCAGGGGAAGGAGGTCAGTGGG - Intronic
1027614379 7:80403118-80403140 AGCTGGGCAAGGGGGGCAGTTGG + Intronic
1029539910 7:101176585-101176607 CTATGGGGAAGAGGGGCAGAAGG - Intronic
1030550949 7:110958967-110958989 ACCTGGGGAAGTAGGGCAGTAGG - Intronic
1031965459 7:128025008-128025030 CTAAGGGGAAGGAGTGAAGTAGG - Intronic
1032242910 7:130179327-130179349 CTCTGGGGAAGGGGAGGAGGGGG - Intronic
1033082206 7:138308990-138309012 ATCTGGGGAAGGGGGTCAGTAGG - Intergenic
1033529181 7:142245773-142245795 CCCTGGGGCAGGTGGGCAGGAGG + Intergenic
1035444689 7:158932282-158932304 CTTGGGGGATGGAGTGCAGTGGG + Intronic
1035700645 8:1637167-1637189 CTCTGGGAAAGGAGGATAGGAGG - Intronic
1035860629 8:3024293-3024315 TTTTGGGGGGGGAGGGCAGTGGG + Intronic
1036213041 8:6858033-6858055 AGATGGGGAAGGAGGGGAGTAGG - Intergenic
1036380292 8:8232251-8232273 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
1036544816 8:9757482-9757504 GTCAGGGGAAGGAGGGAAGTGGG - Intronic
1037164707 8:15812628-15812650 TACTGGGGATGGAGGACAGTGGG + Intergenic
1037960368 8:23093017-23093039 CTCTGGGGAAGGTGGACAGTGGG - Intronic
1038382147 8:27106057-27106079 CTCTGGGGAAGGTGAGCTGCTGG + Intergenic
1038611836 8:29065880-29065902 CTCTGAGGACACAGGGCAGTCGG - Intergenic
1038650949 8:29402613-29402635 CTCTGGGGAGGGAGGAAAGGGGG + Intergenic
1040489150 8:47903615-47903637 CTCAAGTGAAGGAGGGCCGTGGG - Intronic
1041036561 8:53797436-53797458 CTCTGGGGAGGGGAGCCAGTTGG - Intronic
1042491272 8:69401253-69401275 ATCTGGGGAATGAGGGAGGTGGG + Intergenic
1043385508 8:79744063-79744085 CTCTGGGGAAAGATGGGTGTGGG - Intergenic
1043822895 8:84890347-84890369 CTCTGGGGAATGAGGAGAGATGG + Intronic
1044451387 8:92339460-92339482 ATGTGGGGAAGGATGGGAGTGGG + Intergenic
1044535521 8:93352937-93352959 CTCTGGGGATGGACGGCAAAGGG - Intergenic
1044847808 8:96399101-96399123 TTCTGGGGAAGGAGGAAACTGGG - Intergenic
1045712206 8:104998056-104998078 CTTTGGGGAAGGATGCCAGAAGG + Intronic
1047921842 8:129643331-129643353 CCATTGGGAAGGAGGGGAGTAGG - Intergenic
1048461180 8:134623133-134623155 ATCAGTGGAAGGAGGTCAGTGGG - Intronic
1049104196 8:140601195-140601217 CCCTGGGGCAGGAGCGCATTGGG - Intronic
1049600383 8:143504787-143504809 CTCTGCGAAGGGACGGCAGTGGG - Intronic
1049635928 8:143689420-143689442 CACTGTGGCAGGAGGGCAGTGGG + Intronic
1051437690 9:17050579-17050601 CTCTGGAGAAGGAGGAAAATAGG - Intergenic
1052181579 9:25534894-25534916 ATCTGGGAAAGAAGGACAGTAGG + Intergenic
1052963586 9:34320726-34320748 CCCTTGGGAAGGAGGGGAGAGGG + Intronic
1053145695 9:35710757-35710779 CTCGGAGGAGAGAGGGCAGTAGG - Intronic
1053421926 9:37985115-37985137 CTCTGCGGAAGCAGGGCTGTGGG + Intronic
1056213836 9:84390092-84390114 TTCAGGGGAAGGAGGGTGGTTGG + Intergenic
1056258413 9:84823981-84824003 GTATGGGGAAGCAGGACAGTGGG + Intronic
1056580601 9:87886270-87886292 TCTTGGGGAAGGTGGGCAGTGGG - Exonic
1056601934 9:88053389-88053411 CTCTGCGCAAGGAGGGGAGGAGG - Intergenic
1057131992 9:92660622-92660644 CTCAGAGGAAGGAGTTCAGTGGG + Intronic
1057277289 9:93682756-93682778 GCCTGCGGAAGGAGGGCTGTGGG + Intergenic
1058675943 9:107400139-107400161 ATCTGGGAAAGGATGGCAGTGGG + Intergenic
1059039735 9:110799775-110799797 CTCTGTGAAAGGATGACAGTAGG + Intronic
1059336531 9:113572566-113572588 CCCTGAAGGAGGAGGGCAGTGGG + Intronic
1059366216 9:113788367-113788389 CCCTGGGGAAGGAGGGAGTTGGG - Intergenic
1059743913 9:117181955-117181977 GGGTGGGGAAGGAGGGCACTGGG - Intronic
1060876810 9:127089832-127089854 CTCTGTGGCAGGAGGACAGGGGG + Intronic
1060959046 9:127666075-127666097 CTCTTGTAAAGGAGGGCAGCAGG - Intronic
1060978443 9:127778927-127778949 CTCTGGGAACGGAGCCCAGTGGG + Intergenic
1061404267 9:130384933-130384955 CTCTGAGGAGGGGGAGCAGTGGG + Intronic
1061416080 9:130447586-130447608 TTCCGGGGAAGGAGGGCTGGAGG + Intronic
1061636332 9:131911946-131911968 CTGTGGGGCAGCAGGGAAGTTGG - Intronic
1061747953 9:132753733-132753755 CTCTAGGGAAGGAGACAAGTGGG + Intronic
1061947069 9:133914525-133914547 CTCTGGTGACCAAGGGCAGTGGG + Intronic
1061990846 9:134157735-134157757 CTGTGTCGAAGGTGGGCAGTGGG + Intronic
1062303109 9:135886945-135886967 GTGTGGAGGAGGAGGGCAGTCGG + Intronic
1185546282 X:948130-948152 CTCTGGGGAAGGAGGGTCTGTGG - Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186897638 X:14020359-14020381 CTTTGGGGAAGAAGCGCAGAAGG + Exonic
1186941348 X:14511058-14511080 CTCTGGGGAGGGATAGCATTGGG - Intergenic
1188741651 X:33790751-33790773 CCCTGGGACAGGAGGGGAGTTGG - Intergenic
1189780208 X:44506763-44506785 CGCTGGGGAAGGAGGGAAAGGGG + Intergenic
1190393464 X:49955730-49955752 CTCTGGGGAAATAGAGCAGTAGG - Intronic
1191953519 X:66619729-66619751 CTCTGGGCAAGTTGGGAAGTTGG - Intronic
1192224528 X:69219231-69219253 CTGTGGGAAAGGAGGCCAGGAGG - Intergenic
1192547860 X:72028528-72028550 ATCTGGGGAAGGAGGCCAGGCGG - Intergenic
1192560911 X:72127404-72127426 CTCTGGGGCAGGAGGGGCTTGGG - Intronic
1193659378 X:84238345-84238367 CTCAGGGGAAGGATGGGAGGGGG + Intergenic
1194253634 X:91609012-91609034 CTCAGGGGAAGGGTGGCAGAAGG + Intergenic
1195516572 X:105783404-105783426 GCCTGGGGAAGGAGGGAAGTAGG - Intergenic
1195626490 X:107009557-107009579 CGCTGAGGAAGGAGAGGAGTGGG + Intergenic
1195655309 X:107326864-107326886 CGCTGAGGAAGGAGAGGAGTGGG + Intergenic
1195921617 X:109989544-109989566 CACAGGGGAAGGAGGGCATCTGG + Intergenic
1195967876 X:110445484-110445506 CTGTGGGGGAGGAAGGAAGTGGG + Intronic
1197119371 X:122871919-122871941 CTCAGGGGTCGGGGGGCAGTGGG + Intergenic
1197319710 X:125012195-125012217 CCATGGGGAAGGAGAGCATTAGG + Intergenic
1197761353 X:130030604-130030626 CACTGGGGGAAGGGGGCAGTTGG + Intronic
1198401951 X:136277315-136277337 CCCTAGGGAAGGAGTTCAGTGGG - Intergenic
1198546981 X:137702685-137702707 CTCTGGGGAAGGAAAGCAAAGGG - Intergenic
1198734990 X:139775696-139775718 CCCTAGGTAAGGAGGGCAGAGGG - Intronic
1200179030 X:154139236-154139258 CTCGAGGGAGGGAGGGCAGGAGG - Intergenic
1200226168 X:154419075-154419097 GGCTGGGGAGGGAGGGCAGGTGG + Intronic
1200572417 Y:4848592-4848614 CTCAGGGGAAGGGTGGCAGAAGG + Intergenic
1200691464 Y:6308708-6308730 ATCTGGGAAGGAAGGGCAGTGGG - Intergenic
1200760783 Y:7036881-7036903 CTTTGGAAAAGGAGAGCAGTAGG + Intronic
1200831853 Y:7693192-7693214 ATCTGGGAAGGCAGGGCAGTGGG - Intergenic
1201043808 Y:9866008-9866030 ATCTGGGAAGGAAGGGCAGTGGG + Intergenic
1201904907 Y:19077856-19077878 CACTGGGCAAGGAGAGCAGTGGG + Intergenic
1201937979 Y:19427888-19427910 TTCAGAGGAAGGAGGGCACTTGG - Intergenic
1201938287 Y:19431428-19431450 TTCCAGGGGAGGAGGGCAGTGGG - Intergenic