ID: 902375530

View in Genome Browser
Species Human (GRCh38)
Location 1:16028448-16028470
Sequence GAGATGCACATGGCCCGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 113}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902375517_902375530 18 Left 902375517 1:16028407-16028429 CCCTGGCGTTGGCCTTGGCATTG 0: 1
1: 0
2: 14
3: 58
4: 368
Right 902375530 1:16028448-16028470 GAGATGCACATGGCCCGCCCCGG 0: 1
1: 0
2: 2
3: 10
4: 113
902375522_902375530 -6 Left 902375522 1:16028431-16028453 CCAGCCCTCCTGCCCCGGAGATG 0: 1
1: 0
2: 0
3: 33
4: 392
Right 902375530 1:16028448-16028470 GAGATGCACATGGCCCGCCCCGG 0: 1
1: 0
2: 2
3: 10
4: 113
902375520_902375530 6 Left 902375520 1:16028419-16028441 CCTTGGCATTGGCCAGCCCTCCT 0: 1
1: 0
2: 2
3: 23
4: 321
Right 902375530 1:16028448-16028470 GAGATGCACATGGCCCGCCCCGG 0: 1
1: 0
2: 2
3: 10
4: 113
902375518_902375530 17 Left 902375518 1:16028408-16028430 CCTGGCGTTGGCCTTGGCATTGG 0: 1
1: 0
2: 3
3: 40
4: 213
Right 902375530 1:16028448-16028470 GAGATGCACATGGCCCGCCCCGG 0: 1
1: 0
2: 2
3: 10
4: 113
902375516_902375530 19 Left 902375516 1:16028406-16028428 CCCCTGGCGTTGGCCTTGGCATT 0: 1
1: 0
2: 2
3: 20
4: 163
Right 902375530 1:16028448-16028470 GAGATGCACATGGCCCGCCCCGG 0: 1
1: 0
2: 2
3: 10
4: 113
902375513_902375530 29 Left 902375513 1:16028396-16028418 CCTTGTGTGGCCCCTGGCGTTGG 0: 1
1: 0
2: 1
3: 12
4: 152
Right 902375530 1:16028448-16028470 GAGATGCACATGGCCCGCCCCGG 0: 1
1: 0
2: 2
3: 10
4: 113
902375523_902375530 -10 Left 902375523 1:16028435-16028457 CCCTCCTGCCCCGGAGATGCACA 0: 1
1: 0
2: 1
3: 15
4: 163
Right 902375530 1:16028448-16028470 GAGATGCACATGGCCCGCCCCGG 0: 1
1: 0
2: 2
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902375530 Original CRISPR GAGATGCACATGGCCCGCCC CGG Intronic
902375530 1:16028448-16028470 GAGATGCACATGGCCCGCCCCGG + Intronic
904839868 1:33365465-33365487 GAGACGCAGATGGTCCGCCAGGG + Intronic
906062633 1:42958507-42958529 GAGAGGCGCGCGGCCCGCCCCGG + Intronic
915482674 1:156197795-156197817 GAGGTGCACATAACCCGCACAGG - Intronic
918079185 1:181192539-181192561 GAGATGCTCCAGGCCCACCCTGG - Intergenic
919983131 1:202654869-202654891 GAGATGCTAATGGCTGGCCCAGG + Intronic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922823865 1:228503567-228503589 CAGTGGCACATGGCCCACCCCGG - Intergenic
1065357626 10:24857704-24857726 CAGATGCACATGGCGCACACAGG + Intronic
1065963775 10:30754603-30754625 GAGATGCACATGTTCCTTCCTGG + Intergenic
1067089052 10:43257423-43257445 GAGGAGCACAGGTCCCGCCCAGG + Intronic
1072249257 10:93568580-93568602 GAGATGCACACAGCCCACCAGGG + Intronic
1072632154 10:97153902-97153924 GAGATCCAGCTGGCCCTCCCAGG - Intronic
1075764364 10:124880720-124880742 GAAATGAACATGGCAGGCCCGGG + Intergenic
1076917780 10:133433092-133433114 GAGATGCATGGGCCCCGCCCTGG + Intergenic
1076937774 10:133577167-133577189 GAGATGCATGGGCCCCGCCCTGG + Intergenic
1083669746 11:64293007-64293029 GTGCTGCGCATGGCGCGCCCAGG - Exonic
1083741749 11:64714862-64714884 GAGATGCAAATTCCCCTCCCCGG - Intronic
1084432841 11:69121303-69121325 GAGCTGCAGAAGGCCCTCCCAGG + Intergenic
1089200289 11:116720620-116720642 GGGAGCCAGATGGCCCGCCCAGG - Intergenic
1092112148 12:5971366-5971388 GAGAAGCCCAGGGCCCTCCCAGG - Intronic
1093962880 12:25294477-25294499 GAAATGCACCTGGCTCTCCCAGG - Intergenic
1095909195 12:47408614-47408636 GAGAAGAAAATGGCCTGCCCTGG - Intergenic
1096307652 12:50492233-50492255 GAGGAACACCTGGCCCGCCCAGG - Intergenic
1096637703 12:52971614-52971636 GAGATGCACAGGCCCCTGCCAGG + Intergenic
1103410752 12:120710234-120710256 GAGGTGCACATGAGCAGCCCTGG - Intergenic
1103485278 12:121278810-121278832 CAGATGCCCATGGCCTGCTCTGG + Intronic
1103942945 12:124510762-124510784 GAGGTGCCCATGGGCCGCCGCGG + Intronic
1104824127 12:131696182-131696204 GACATGCACATGGCCGGGCACGG + Intergenic
1105337517 13:19487363-19487385 GACATGCTCCTGGCCTGCCCAGG - Intronic
1105529975 13:21210491-21210513 AAGATGCTCATGCCCCTCCCAGG - Intergenic
1107279322 13:38715443-38715465 GAGATGCACATGGCCCTTCCTGG + Intronic
1108044632 13:46372057-46372079 GAGGTACACATGGTCCGCCCAGG - Exonic
1111450403 13:88407834-88407856 GAGATGCACCTGGCCATCCACGG + Intergenic
1113843678 13:113374222-113374244 GAGATGCCCATGGAGTGCCCAGG - Intergenic
1119612709 14:76077207-76077229 GATATGCACAGGGCTCTCCCAGG + Intronic
1119731854 14:76956340-76956362 GAAATGCCCAGGGCCGGCCCAGG - Intergenic
1123009458 14:105340769-105340791 GAGATGCCCCTGGCCAGCCCTGG - Intronic
1123130942 14:105984800-105984822 GAGATGTGCATGGCCTGCCTGGG + Intergenic
1123581170 15:21716021-21716043 GAGATGTGCATGGCCTGCCTGGG + Intergenic
1123617819 15:22158644-22158666 GAGATGTGCATGGCCTGCCTGGG + Intergenic
1129413574 15:75362593-75362615 GGGAAGCACGTGGCCCTCCCTGG - Intronic
1132556933 16:576634-576656 GGGCTGCACATGGGCCTCCCTGG - Intronic
1132572971 16:652007-652029 GAGGTGCCCGTGGCCCGCACCGG + Exonic
1139078666 16:63486707-63486729 GAGGTTCACAAGGCCTGCCCAGG + Intergenic
1139329825 16:66178621-66178643 CAGATGCCCTTGGCCAGCCCTGG - Intergenic
1140969087 16:79995566-79995588 GAGAGCCACATGGCTCGGCCTGG - Intergenic
1141827702 16:86492823-86492845 GGGATGCTCATGGCCCTTCCTGG - Intergenic
1143057021 17:4170124-4170146 GCGATGCACAGGACCTGCCCAGG - Intronic
1148135776 17:45290717-45290739 GTGATGGAAATGGCCTGCCCAGG - Exonic
1149461392 17:56833157-56833179 GAGAGGCACAGGCACCGCCCCGG - Exonic
1152471257 17:80491140-80491162 GGGATGCCCATAGCCTGCCCAGG - Intergenic
1152806444 17:82359103-82359125 GGGCTGCACATGGCCCTCCTTGG + Intergenic
1160106908 18:75986947-75986969 GAGATATGCAGGGCCCGCCCTGG - Intergenic
1163290354 19:16375832-16375854 GAGAAGGCCATGGCCAGCCCAGG + Intronic
1164251191 19:23477205-23477227 AAGGAGCACCTGGCCCGCCCAGG - Intergenic
1164770177 19:30802201-30802223 AAGATGCCCGTGGCCCTCCCTGG - Intergenic
1164892530 19:31837005-31837027 GAGATTCACATGGACCTCACTGG + Intergenic
1165129201 19:33621804-33621826 GCGATGCACTCGGCCCTCCCGGG - Intergenic
1167884902 19:52492673-52492695 GTGATGCACAGGTCCCGCCCCGG + Intronic
1167890464 19:52535856-52535878 GGGATGCACAGGTCCCGCCCCGG + Intronic
1167894473 19:52570131-52570153 GAGACGCACAGGTCCCGCCCCGG + Intronic
1167903390 19:52638486-52638508 GAGACTCACAGGTCCCGCCCTGG - Intronic
1167909563 19:52690620-52690642 GAGACACACAGGTCCCGCCCCGG - Intergenic
1167914073 19:52725889-52725911 GAGATGCACAGGTCCGGTCCCGG - Intronic
1167921591 19:52786888-52786910 GAGAAGCACAGGTCCCGCCCCGG - Intronic
1167930261 19:52857753-52857775 GAGATGCACAGGTCCCGCTCCGG - Intergenic
1167940568 19:52942729-52942751 GAGACGCACAGGTCCCGCCCCGG - Intronic
932408530 2:71530452-71530474 GAGATGCCCTTGGCTGGCCCTGG + Intronic
934177168 2:89585783-89585805 GCGGTGCCCCTGGCCCGCCCGGG - Intergenic
934287470 2:91660096-91660118 GCGGTGCCCCTGGCCCGCCCGGG - Intergenic
935548924 2:104430905-104430927 GAGATGTACATCCCCCGGCCTGG - Intergenic
937066403 2:119021042-119021064 GAGATGGGCATGGCCACCCCCGG - Intergenic
948272578 2:236686076-236686098 GAGATGCATCTGGCCAGCCCTGG + Intergenic
948319201 2:237056144-237056166 GAGGTGCACATGGCCAGCCAAGG + Intergenic
948482956 2:238261923-238261945 GAGAGGCAGAGGGCCCACCCAGG - Intronic
949048331 2:241882447-241882469 GAGATCCACATGTCCCAGCCAGG - Intergenic
1170931240 20:20771162-20771184 CAGATACCCATGGCCTGCCCTGG + Intergenic
1173511202 20:43630058-43630080 GTGATGCAGATGTCACGCCCTGG - Intronic
1175399529 20:58692728-58692750 GAGACGTGCAGGGCCCGCCCGGG - Exonic
1175576560 20:60064951-60064973 GAGATGCATAGGGCCAGGCCTGG - Intronic
1182520289 22:30881135-30881157 GAGATGCAGAGGGGCCGGCCTGG - Intronic
1183533095 22:38374842-38374864 GACATGCTCCTGGCCTGCCCAGG - Intronic
1184693003 22:46125827-46125849 GGAGGGCACATGGCCCGCCCAGG - Intergenic
950497709 3:13343891-13343913 GAGATGCACATAGCTCACACTGG - Intronic
951040937 3:17988244-17988266 GAGATGCATATGGACCACTCAGG - Intronic
954692009 3:52400659-52400681 GAGATGCCCAGCGCCCTCCCAGG + Intergenic
955492992 3:59501808-59501830 GAGATGCACAGGACGCCCCCGGG - Intergenic
962600697 3:136988899-136988921 GGAATGCACATGGCCCTGCCAGG + Intronic
963780183 3:149479203-149479225 GAGCTCCACAGGGCCCACCCTGG + Intronic
968005844 3:195242223-195242245 GAGAAGCACATGACATGCCCGGG - Intronic
968957615 4:3727185-3727207 GAGGAGCACATGGCCGGCCGAGG - Intergenic
971953357 4:33383082-33383104 CACATGCACATTGCCAGCCCTGG + Intergenic
976364468 4:84217658-84217680 TAGATGCACATGGACCTGCCGGG - Intergenic
977358667 4:95978312-95978334 GAGGAACACCTGGCCCGCCCAGG + Intergenic
985050019 4:185980649-185980671 AAGAAACACCTGGCCCGCCCAGG + Intergenic
985718436 5:1475877-1475899 GGGCTGCACAGGCCCCGCCCAGG + Intronic
986169403 5:5303523-5303545 GTGTTGCACATGGCCCTCACTGG + Intronic
998210384 5:140192732-140192754 CAGATGCAAATGGCACTCCCTGG - Intronic
1002065765 5:176650933-176650955 GAGAGGCACTTGGACTGCCCCGG + Intronic
1002303541 5:178270692-178270714 AAGATGCTCATGGCTCGCCTTGG - Intronic
1002489812 5:179567294-179567316 GGGATGCACATGGCCTGGGCAGG - Intronic
1006442302 6:34060153-34060175 GAGATGGACAAGGCCAGCTCAGG - Intronic
1010685278 6:78847183-78847205 GAAAAGCACATGGCCAACCCTGG + Intergenic
1012547460 6:100435884-100435906 GAGATAAACAGGGCCCACCCTGG + Intronic
1017712121 6:157180122-157180144 GAGATACAGTTGGCCCGCCTAGG + Intronic
1019308875 7:349277-349299 GGGATACACATGAGCCGCCCGGG + Intergenic
1019416890 7:931974-931996 GAGCTGCACTGGGCCCCCCCTGG - Intronic
1026014577 7:66663031-66663053 AAGAAACACCTGGCCCGCCCAGG + Intronic
1031390014 7:121202440-121202462 AAGATGCCCATGGCTCTCCCAGG - Intronic
1032263332 7:130353470-130353492 GAGATGCCCATTGCACCCCCAGG - Intronic
1036205185 8:6800412-6800434 GAGCTGAACATGGGCAGCCCTGG + Intergenic
1036435817 8:8732185-8732207 GAGAGGCACATGGCCAGCCCGGG - Intergenic
1036577381 8:10040666-10040688 GAGATGTGCATGGCAAGCCCAGG - Intergenic
1040781760 8:51117631-51117653 GAGATGCACAGGGCAAGCTCTGG - Intergenic
1046158216 8:110322175-110322197 AAGAAACACCTGGCCCGCCCTGG - Intergenic
1048987185 8:139740947-139740969 GAGATGCAGAGGCCCAGCCCTGG + Intronic
1050000460 9:1072012-1072034 GAGATGCAGGTGGCCAGCCACGG + Intergenic
1057054379 9:91949724-91949746 GAGATGCGAATGGCCCTGCCTGG + Intronic
1057221436 9:93259775-93259797 GAGATGCAGATGCCTCGCGCTGG - Intronic
1062029372 9:134355257-134355279 GAGATGCCCATGCCGGGCCCAGG - Intronic
1062164711 9:135101810-135101832 GACAGGCACATGCCACGCCCCGG - Intronic
1062394981 9:136349185-136349207 GACAGGCACAGGGCCAGCCCAGG - Intronic
1203435221 Un_GL000195v1:131370-131392 GAGATGCTCAAGGCCCACCTCGG - Intergenic
1192767636 X:74158664-74158686 GAGAAACACCTGGCCCACCCAGG - Intergenic
1202594344 Y:26521179-26521201 GACATGCTCCTGGCCTGCCCAGG + Intergenic