ID: 902379082

View in Genome Browser
Species Human (GRCh38)
Location 1:16044219-16044241
Sequence CCCAGTCTGCTGCTGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 2, 2: 2, 3: 34, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902379071_902379082 25 Left 902379071 1:16044171-16044193 CCACCGAAGGGGAAGGGGCTCTG 0: 1
1: 1
2: 0
3: 13
4: 181
Right 902379082 1:16044219-16044241 CCCAGTCTGCTGCTGGACACAGG 0: 1
1: 2
2: 2
3: 34
4: 229
902379072_902379082 22 Left 902379072 1:16044174-16044196 CCGAAGGGGAAGGGGCTCTGAGC 0: 1
1: 0
2: 2
3: 21
4: 217
Right 902379082 1:16044219-16044241 CCCAGTCTGCTGCTGGACACAGG 0: 1
1: 2
2: 2
3: 34
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902379082 Original CRISPR CCCAGTCTGCTGCTGGACAC AGG Intronic
900690206 1:3976325-3976347 TCCTGTCTGCTCCTGGAGACTGG - Intergenic
901106243 1:6758708-6758730 CCGAGTCTGCTGCTGGACACAGG - Intergenic
901555400 1:10027990-10028012 CCCAGGCTGGTGCTGGCCTCAGG + Intergenic
901666960 1:10831556-10831578 GCCAGTCTCCAGCTGGACTCCGG - Intergenic
902374131 1:16022361-16022383 CACAGTCTGCTGCTGGACACAGG + Intronic
902379082 1:16044219-16044241 CCCAGTCTGCTGCTGGACACAGG + Intronic
902850035 1:19148044-19148066 CTTGGACTGCTGCTGGACACTGG + Exonic
902880566 1:19369489-19369511 CCCTGCCTGCTGTGGGACACCGG - Intronic
904277005 1:29391312-29391334 CCCTGTCTGCTGCTAGTCACTGG + Intergenic
904803914 1:33117920-33117942 CACAGGCTGCTGCTGTACAGGGG - Exonic
906190924 1:43899062-43899084 CCCAGCCTGGTCCTGGACAAGGG + Intronic
906539820 1:46576756-46576778 GCCAGACTTCTGCTGGACACTGG - Intronic
906712348 1:47940322-47940344 CACAGTCTGATGGTGGAGACAGG - Intronic
907309025 1:53528890-53528912 CCCAGTCTCCTGCAGCACATGGG + Intronic
907544362 1:55246634-55246656 CCCTCTCTGCTGCTGCACAGGGG - Intergenic
909206061 1:72759260-72759282 CCCAGTCTGCAACGGCACACTGG + Intergenic
909356395 1:74714858-74714880 GGCACTATGCTGCTGGACACTGG + Intronic
912436575 1:109666375-109666397 CCCACTCTGGTGCTGGGCTCAGG + Intronic
912834726 1:112986169-112986191 CCCTGACTGATGCTGCACACTGG + Intergenic
915233730 1:154465264-154465286 CCCAGGCTGCTGGGGGACACCGG - Exonic
916420380 1:164632469-164632491 GCCTTTCTCCTGCTGGACACAGG + Intronic
921632862 1:217455839-217455861 CCTTGTCTGCTGCTGGAGCCTGG - Intronic
1063455360 10:6178813-6178835 CCCAATCTGCTTCTGGAGAGTGG + Intronic
1066132691 10:32409594-32409616 CCCAGTCTGGAGCTGCACACTGG - Intergenic
1066589432 10:36977765-36977787 CCCAGTCTGCTGTTGAAGATGGG - Intergenic
1067691026 10:48502462-48502484 CCCAGTTTGCTGCTTCCCACTGG + Intronic
1068954879 10:62813596-62813618 CGCAGCCTTCTGCTGGGCACGGG + Exonic
1070368154 10:75756325-75756347 CCCAGTCTGCTGCCTGGAACTGG + Intronic
1070642689 10:78180792-78180814 CCCAGCCTCCTGCTGGTCTCTGG + Intergenic
1071491753 10:86140990-86141012 ACCAGGCTGCTGATGGACAAGGG - Intronic
1072562849 10:96592387-96592409 CTCAGTCTTCAGCTGGGCACGGG + Intergenic
1075087193 10:119421617-119421639 CCCAGGCTGCTGTTGGTAACTGG + Intronic
1077300552 11:1844588-1844610 CCCGGTTTGCTCCTGGACACTGG - Intergenic
1077350327 11:2090280-2090302 CTCAGGCAGCTGCTGGCCACAGG - Intergenic
1078156060 11:8801091-8801113 CCCATTCTGCTCTTTGACACTGG + Intronic
1080044761 11:27797310-27797332 CCATGTCAGCTGCTGGATACAGG - Intergenic
1081851661 11:46278526-46278548 CCCAGTCTGGTCCTGGAACCTGG - Intronic
1082303500 11:50541286-50541308 TCCATTCTGCTACTGGACAATGG - Intergenic
1084425801 11:69084023-69084045 CCCAGGCTGCTGCTGGTGGCGGG + Intronic
1084448459 11:69218057-69218079 CCCAGGCTGCAGCTGGGCTCTGG - Intergenic
1084557163 11:69882006-69882028 GCCAGGCTGCTGCTGGGGACGGG + Intergenic
1084954511 11:72684288-72684310 CCAAGTCTTCCGCTGGACCCAGG + Intergenic
1085740673 11:79075881-79075903 ACCAGTCTAGTGCTGGGCACTGG + Intronic
1087375221 11:97331454-97331476 CTCAGTCTGAAGCTGGACATGGG - Intergenic
1089485240 11:118840507-118840529 CCCTGTCTGCTGCTAAGCACAGG - Intergenic
1089730580 11:120516444-120516466 TCCAGCCTTCTGCTGCACACGGG - Intronic
1090392548 11:126398502-126398524 CCCAGGTTGCTGTTGCACACTGG + Intronic
1091397093 12:160607-160629 CCCAGTCTTCTGCTGGAGTGAGG + Intronic
1091911200 12:4232008-4232030 CACTGTCTCTTGCTGGACACAGG - Intergenic
1092155166 12:6277682-6277704 CCCAGTCTGGTCTTGGACTCGGG + Intergenic
1092917717 12:13203344-13203366 CCCAGACTGCAGCTGGTCAAGGG - Intronic
1093226844 12:16494943-16494965 CCCTGTTTGTTGCTGTACACTGG - Intronic
1096820276 12:54228402-54228424 CCCATGCTGCTTCTGGAAACAGG - Intergenic
1098914590 12:76244052-76244074 TCCAGGCTGCAGCTGGGCACAGG - Intergenic
1101833818 12:108281046-108281068 TCCATTCTGCTGCTCAACACAGG + Intergenic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1105608592 13:21947847-21947869 CCAAGTCTGCTGTTACACACAGG - Intergenic
1105661536 13:22501140-22501162 CCCAGTCAGCTGCAGGACCTCGG - Intergenic
1110013724 13:70372193-70372215 CCCAGTCTTCTGCTGTGCTCTGG - Intergenic
1112380947 13:98889452-98889474 CCCAGCATTGTGCTGGACACTGG - Intronic
1113182006 13:107639639-107639661 CCCAGGCTTCTTCAGGACACAGG + Intronic
1113636270 13:111920969-111920991 CCCTGCCTACTGTTGGACACAGG + Intergenic
1113680882 13:112244266-112244288 CGAAGTCTCCTGCTGGCCACCGG + Intergenic
1113890041 13:113730935-113730957 CCCACTCTAGTGCTGGGCACAGG - Intronic
1116330810 14:43595700-43595722 GCCAGGCTGCTCCTGGAGACTGG + Intergenic
1121122475 14:91384765-91384787 CCCAGTGTGCTGCTGGACTCCGG + Intronic
1121172731 14:91868326-91868348 CCCCGTCTGCTTCTGGAGCCTGG + Intergenic
1121614438 14:95303645-95303667 CCCAGGCTGCTGCTGAATACTGG - Intronic
1122122277 14:99560966-99560988 CCCAGGCTTCTAGTGGACACAGG - Intronic
1122924372 14:104892867-104892889 CCCAGGCAGCTGCTGGCCAGAGG - Intronic
1124156123 15:27226463-27226485 CCCATGCTGATGCAGGACACTGG + Intronic
1125776798 15:42223248-42223270 CCCAGTGTGGTGGTGCACACCGG + Intronic
1127696926 15:61459284-61459306 CCCAGGCTGCTGATGGCCAGGGG + Intergenic
1128160835 15:65422110-65422132 CCCAGTCCACTGCTGGCCACAGG + Intronic
1128397979 15:67248553-67248575 CCCATTCTGTTGCTAGACAATGG + Intronic
1128879529 15:71230571-71230593 TCCATTTTGCTGCTGGAGACAGG + Intronic
1129170341 15:73803754-73803776 TGCAGTCTGCTGCTGGGGACAGG - Intergenic
1130204693 15:81865314-81865336 CCCTTTCTGCAGCTGGACCCTGG - Intergenic
1130243613 15:82221623-82221645 CCCACTCTGCTGCAGGTCACTGG + Intronic
1130456856 15:84119658-84119680 CCCACTCTGCTGCAGGTCACTGG - Intergenic
1132022030 15:98371093-98371115 AGCAGACTGCTGCTGGCCACAGG - Intergenic
1132376730 15:101333113-101333135 CCGACTCTGCTGCTGGCCACTGG + Intronic
1132405062 15:101536913-101536935 CCCCATCTGCTGCTGCCCACAGG + Intergenic
1132548277 16:543607-543629 TCCTGTCTGCTGCTGCAAACAGG + Intronic
1132887466 16:2188965-2188987 CCCAGGCTGCTGCTGAACCCTGG + Intronic
1136485031 16:30566239-30566261 CCAGCTCTGGTGCTGGACACAGG - Intergenic
1136717265 16:32290517-32290539 CCCAGTGTGGTGCTGGCCACTGG + Intergenic
1136835640 16:33496771-33496793 CCCAGTGTGGTGCTGGCCACTGG + Intergenic
1138780393 16:59778255-59778277 CCCTGTCAGCTCCTGGAGACAGG + Intergenic
1140481828 16:75266238-75266260 CCCGGTCTGCGCCCGGACACAGG - Intronic
1141193897 16:81845069-81845091 CCAAGTGTGCTGGTGCACACTGG - Intronic
1141608310 16:85168107-85168129 GCCAGTCTGCTGATGGGGACGGG - Intergenic
1141674136 16:85508699-85508721 CTCAGTATGCTGGTGGAGACTGG + Intergenic
1141680834 16:85542802-85542824 CCCAGCCTGGTGCTGGACTTGGG - Intergenic
1141847183 16:86618826-86618848 CCCAGTCTGCAACTGTATACAGG - Intergenic
1203009164 16_KI270728v1_random:227261-227283 CCCAGTGTGGTGCTGGCCACTGG - Intergenic
1203145819 16_KI270728v1_random:1797086-1797108 CCCAGTGTGGTGCTGGCCACTGG + Intergenic
1142607499 17:1090254-1090276 CCAAGGCTGGGGCTGGACACGGG + Intronic
1144037077 17:11376724-11376746 GTCAGTCTTCTGCTGGACCCAGG - Intronic
1144767056 17:17738551-17738573 CCCAGTTTCCTGCTGGTCCCTGG - Intronic
1144945494 17:18967595-18967617 TCCAGACTCCTGCTGGACCCTGG - Intronic
1145973259 17:28969424-28969446 GCCAGGCTTGTGCTGGACACTGG - Intronic
1146661605 17:34668502-34668524 CCCTGGCCTCTGCTGGACACAGG - Intergenic
1150535085 17:66029976-66029998 TCCAGTCAGCTGCTGGACACGGG + Exonic
1150633718 17:66898275-66898297 CCCCATTTGCTGCAGGACACAGG - Intergenic
1151489644 17:74425153-74425175 CCTATTCTGCTGGTGGCCACTGG - Intronic
1152247270 17:79191589-79191611 CCCTGTCTGCAGCTTGGCACTGG - Intronic
1152757049 17:82091431-82091453 CCCCGTCTGCTGCGGGCCAGCGG - Exonic
1160415400 18:78706401-78706423 CCCAGGCTGGTGCTGGAGAGGGG + Intergenic
1160415415 18:78706444-78706466 CCCAGGCTGGTGCTGGAGAGGGG + Intergenic
1160415430 18:78706487-78706509 CCCAGGCTGGTGCTGGAGAGGGG + Intergenic
1160415445 18:78706530-78706552 CCCAGGCTGGTGCTGGAGAGGGG + Intergenic
1160415459 18:78706573-78706595 CCCAGGCTGGTGCTGGAGAAGGG + Intergenic
1162833508 19:13301519-13301541 CCCAGGGTGCTGCTGCTCACTGG + Intronic
1163194002 19:15701872-15701894 CCCAGTCTCCAGCAGGACAAAGG + Intergenic
1163400115 19:17087072-17087094 GCCAGGCTGATGCTGGGCACAGG - Intronic
1165102575 19:33447563-33447585 GCCAGGCTGCTGGTGGGCACAGG - Intronic
1166884021 19:45947939-45947961 CCCTGTCTGATGCTGGGCAAGGG + Intronic
1168336226 19:55599256-55599278 CCCAGTCTGCTCCAGGCCCCAGG + Intronic
925022442 2:582396-582418 CCCTCGCTGCTGCTGGACGCTGG - Intergenic
925022451 2:582452-582474 CCCTCACTGCTGCTGGACGCTGG - Intergenic
925022460 2:582508-582530 CCCTCACTGCTGCTGGACGCTGG - Intergenic
925346746 2:3176960-3176982 CCCAGGCTGCTCCTGGCCACGGG + Intergenic
926717868 2:15939321-15939343 CCAATGCTGCTGCTGGACAGAGG + Intergenic
928643092 2:33320808-33320830 ACCAGTCTGGTGCAGGAGACTGG + Intronic
931321492 2:61177730-61177752 CCCCCTCAGCTGCTGGACGCAGG + Exonic
931606011 2:64052694-64052716 CAGAGTCTGCTGCTGCACAAGGG + Intergenic
933182702 2:79245240-79245262 GCCAGGCTGCTCCTGAACACTGG - Intronic
934546984 2:95226003-95226025 CCCAGGCTGGTGTTGCACACTGG + Intronic
934750289 2:96789486-96789508 ACCTGGCTGCTGCTGGACAGAGG + Intronic
935734405 2:106095633-106095655 GCCGGGCTCCTGCTGGACACAGG + Intronic
936015284 2:108954241-108954263 CACAATCTGCTGCTGGTCTCCGG - Intronic
936056791 2:109267838-109267860 GCCAGGCTCCTGCTGGACAGAGG + Intronic
936056947 2:109268502-109268524 GCCAGGCTCCTGCTGGACAGAGG - Intronic
936883676 2:117283413-117283435 CCCAGTCTGATTCCAGACACCGG + Intergenic
937258906 2:120573025-120573047 CCCAGCCTGCTGCTTCCCACGGG - Intergenic
937288423 2:120767440-120767462 CCCAGTCTGCCGCTGGTGAGAGG + Intronic
940634446 2:156280964-156280986 CCCTGTCTCCTTTTGGACACTGG - Intergenic
941953036 2:171176285-171176307 CACAGTGTGCTGCTCAACACTGG - Intronic
942331624 2:174830712-174830734 TCCTGTCTGCTGCTGGCCAGTGG - Intronic
945037638 2:205717578-205717600 CCCAGGCTGCTGCAGGGCACAGG + Intronic
946166299 2:217866188-217866210 CCTAGTCTGCTGCTGCAGCCAGG - Intronic
947717800 2:232350622-232350644 CCCAGCCTGTGGCTGGACCCAGG + Intergenic
948809465 2:240467311-240467333 CCCAGCCAGCTGCAGGGCACGGG + Exonic
949072547 2:242034483-242034505 CCCAGCCTGCTGCTGGCTGCCGG - Intergenic
1171087508 20:22251412-22251434 CTCTGTCTCCTGCAGGACACAGG - Intergenic
1172037989 20:32023613-32023635 CCCAGTCTCGTGCTAGGCACAGG - Intronic
1172132570 20:32665273-32665295 CGCATTCTGCAGCTGGAGACTGG - Intergenic
1175720356 20:61281955-61281977 CCCAGTGTGCTGCTGTTCTCTGG - Intronic
1175912657 20:62412197-62412219 CCCTGTCTGCAGGTGGACAAGGG + Intronic
1178292829 21:31384135-31384157 CCCAGTCCCCTGCTTGAGACTGG - Intronic
1178601750 21:34000509-34000531 CACAATCTGCTGCTGGCCCCTGG - Intergenic
1179090991 21:38265693-38265715 TCCAGGCTGCTGCTGGACAGAGG + Intronic
1179422584 21:41248465-41248487 CCAGGTCTGCAGCGGGACACGGG - Intronic
1179492876 21:41752641-41752663 CCCCGGCGGCTGCTGGACGCTGG + Intronic
1179547784 21:42124251-42124273 CTCAGCCTGGTACTGGACACAGG + Intronic
1180121024 21:45748250-45748272 CCCAGTCTCCTGCTCCACCCAGG + Intronic
1180914189 22:19473923-19473945 CCCAGTCTCCTGCCTCACACAGG + Intronic
1181006281 22:20015236-20015258 CCCAGTCCTCTGCTGGGCGCTGG + Intronic
1182799596 22:33020752-33020774 AGCACTCTGGTGCTGGACACAGG + Intronic
1183057490 22:35315808-35315830 CCCAGTCTGCCGGAGGACAGAGG - Intronic
1183255445 22:36758836-36758858 CCTAGGCTGGTGCTGGACCCAGG + Intronic
1184012345 22:41758615-41758637 CCAAGCCTGATGCTGGGCACTGG + Intronic
1185221743 22:49632473-49632495 CCCCGGCTGCTGCTGGCCGCTGG - Intronic
1185377741 22:50489868-50489890 CCCAAGCTGCTGCTGGACCTAGG + Exonic
949490053 3:4580578-4580600 ACCAGTGAGCTGCAGGACACAGG - Intronic
952907630 3:38152803-38152825 CCCACTTTGCTGTTGAACACTGG + Intergenic
954710084 3:52501325-52501347 CACAGGATGCTCCTGGACACAGG - Intronic
955837377 3:63071250-63071272 CCCAGTCTTTTGCTAGGCACTGG - Intergenic
958992352 3:100861345-100861367 CCCAGTCCTCTGCTGGACTCTGG + Intronic
960358345 3:116679995-116680017 CCCAAGCTGATGCTGCACACTGG - Intronic
960954540 3:123022634-123022656 TCCAATTTGCTGCTGGGCACAGG - Intronic
962365147 3:134773981-134774003 CCCTGTTGCCTGCTGGACACTGG - Intronic
963333728 3:143947250-143947272 CCGAGTCTGGTGTTGGACACGGG + Intergenic
965020410 3:163221744-163221766 CCCAGGCTGCTGCTGTGCAATGG + Intergenic
967070911 3:185961603-185961625 CCTAGTCTGCTTCTGGAGCCTGG + Intergenic
967103942 3:186240340-186240362 CACAGCCTGGTGCTGGAAACAGG - Intronic
967306101 3:188061000-188061022 CCCAGCCTGCTGCTGGATCCTGG - Intergenic
967451244 3:189625842-189625864 CCCACATTGCTTCTGGACACTGG + Intergenic
967820228 3:193833245-193833267 CCCAGTTGGATGCTGGACAGAGG - Intergenic
968092365 3:195907391-195907413 CCCAGTCTGGTTCGGGACAGGGG + Intronic
968880441 4:3296019-3296041 CCCAGTCAGCTTCTGGAGGCTGG + Intronic
968971007 4:3793840-3793862 CACTGTCTGCTGCTGGCCAGGGG + Intergenic
969087990 4:4670711-4670733 GCCAGTCTGTTACTGGAAACAGG - Intergenic
969707050 4:8817714-8817736 TCCAGTCCTGTGCTGGACACGGG - Intergenic
971451577 4:26806048-26806070 CCCACTCTGCTGCCTGGCACTGG + Intergenic
971618702 4:28827911-28827933 TTCAGTCTGCTGCTGCACTCTGG + Intergenic
972340793 4:38150818-38150840 TCCAGCCTGCTGCTGGTCGCTGG - Intergenic
972573758 4:40333423-40333445 CCCACTCTGCTGCTGGGCAGAGG + Intergenic
974525734 4:63047821-63047843 TCCAGGCTGGTGCTAGACACTGG + Intergenic
975787632 4:77908864-77908886 TCCTGTAGGCTGCTGGACACAGG + Intronic
978526911 4:109676961-109676983 CCCAGGATGCTGCTGCACACTGG - Intronic
979132818 4:117069526-117069548 CCCACAGTGCTGCTGGACACAGG - Intergenic
979174868 4:117651255-117651277 CCAAGTCAGCTCCTGGACAATGG + Intergenic
984950530 4:185004512-185004534 TCCCGTCAGCTGCAGGACACGGG + Intergenic
985148074 4:186915219-186915241 CCCACTGTCCTGCTGAACACTGG + Intergenic
985711436 5:1431815-1431837 CCCAGGAGGCTGCTGGACATGGG + Intronic
985763212 5:1762491-1762513 CCCTGTCGGAGGCTGGACACAGG + Intergenic
985863427 5:2492772-2492794 ACCACGCTGCTGCTGGACACAGG + Intergenic
986316080 5:6587331-6587353 CCCATGGTGCTGCTGGACAATGG - Intergenic
987111181 5:14688492-14688514 CCAGACCTGCTGCTGGACACAGG - Intronic
992894206 5:81232915-81232937 CCCGGTCAGCTGCTGGAGCCAGG + Intergenic
994671226 5:102764011-102764033 ACCAGTCTGGTGGTGGATACTGG + Intronic
994825919 5:104712729-104712751 CCATGTCTGCTCCTGGGCACTGG + Intergenic
995585333 5:113642673-113642695 CCCAGGCTGGAGTTGGACACTGG - Intergenic
999287849 5:150404878-150404900 ACCAGGCTGCAGCTGGACCCGGG - Intronic
1000530685 5:162415991-162416013 CCCAGGCTTCTGCTGGAGAGTGG - Intergenic
1001407431 5:171485808-171485830 CACAGTCTGCTCCAGGACCCAGG - Intergenic
1001595821 5:172898124-172898146 CCCACTCTCCTGCTCAACACTGG + Intronic
1002252837 5:177940035-177940057 CCCTGTTTGCTTCAGGACACCGG - Intergenic
1002535812 5:179874778-179874800 GCCAGGCTGCAGCTGGACCCGGG - Intronic
1002712873 5:181205415-181205437 CCCAGTCAGCCGCGGGAAACGGG + Intergenic
1003529459 6:6925733-6925755 CCCAGTTTGGTGTTGGGCACTGG - Intergenic
1003534810 6:6967444-6967466 GCAGGCCTGCTGCTGGACACAGG + Intergenic
1005229561 6:23684560-23684582 CCCAGGCTGGTGTTGCACACTGG + Intergenic
1005870214 6:29969906-29969928 ACCAGTAGGCTCCTGGACACTGG - Intergenic
1006002309 6:30974746-30974768 CACAGTCTGCTGCTGGCCAGTGG - Intergenic
1007161264 6:39793209-39793231 CCCAAGCTACGGCTGGACACAGG - Intronic
1007766480 6:44163320-44163342 CCCTGTCAGCTGCTCCACACAGG + Intronic
1008159664 6:48061803-48061825 GCCAGTGTGCTGGTGGACAAGGG - Intronic
1011935379 6:92770296-92770318 CCCAGACTGGGGCTGCACACTGG - Intergenic
1012064252 6:94529381-94529403 CCCAGTATGTTTCTGGACAGGGG - Intergenic
1012990828 6:105924012-105924034 CCTATTGTGCTGCTGAACACTGG + Intergenic
1013592280 6:111629290-111629312 CCCAGGAAGCTGCTGGCCACTGG + Intergenic
1016759755 6:147723961-147723983 CCCAGCCTTCTGCTGGGCCCTGG - Intronic
1018934737 6:168266279-168266301 TCCAATCTGCTGCTGGAGAATGG + Intergenic
1019508723 7:1406467-1406489 TCCAGGCTGCTGCAGCACACGGG - Intergenic
1020720660 7:11740546-11740568 CCCCCTCAGCAGCTGGACACAGG + Intronic
1020899848 7:13990741-13990763 TCCCGTCCGCTGTTGGACACTGG - Intronic
1024210629 7:47200370-47200392 CCCAGGCTGGTGCTGCACACTGG + Intergenic
1024517595 7:50272486-50272508 CCCAGGCTGCTGTAGGACGCAGG + Intergenic
1024518790 7:50284596-50284618 CCCACTATGCTGCTGGCCACAGG + Intergenic
1024627025 7:51216518-51216540 CCCACACAGCTGCTGGACAGAGG - Intronic
1024797281 7:53035550-53035572 CCCAGACTGCAGGAGGACACTGG - Intergenic
1026905747 7:74061854-74061876 CCCAGTCCCTTCCTGGACACAGG - Intronic
1029637864 7:101797139-101797161 CCCTGTCTGTTGCAGGAAACAGG + Intergenic
1032505299 7:132429925-132429947 CCCACTCTGCTCCTGGGGACTGG - Intronic
1034405694 7:150901156-150901178 CCTAGCCTGCTTCTGGACTCTGG + Intergenic
1034435450 7:151060892-151060914 CCCAGTGTGTTGCTGGGGACTGG - Intronic
1035478139 7:159158302-159158324 CCCAGGCTGCATCTGGAAACAGG - Intergenic
1035579727 8:731995-732017 CCCAGGCACCTGCTGGACACAGG + Intronic
1037421493 8:18708082-18708104 CCCAGTCTGATCCTGGAGACAGG + Intronic
1038168989 8:25111460-25111482 CCCAGTAGGCAGCTGGGCACGGG - Intergenic
1038424893 8:27458676-27458698 CTCAGGCTGCAGCTGGACAGAGG + Exonic
1039275014 8:35925738-35925760 TCCAGTCTGATGATGGACCCAGG - Intergenic
1039647742 8:39305803-39305825 CCCAGGCTGATGCTGTACACTGG + Intergenic
1039901734 8:41757657-41757679 CACAGACTGCTGGTGGACAAAGG + Intronic
1042906271 8:73775590-73775612 TACAGCCTGCTTCTGGACACAGG + Intronic
1043624884 8:82244184-82244206 CCCAGCCTGGTGTTGCACACTGG - Intergenic
1046471595 8:114682385-114682407 CCCAGCCTGGTGTTGCACACTGG + Intergenic
1049345562 8:142136761-142136783 CCCCCTCTGCTGCTGGAGCCCGG - Intergenic
1053382414 9:37659807-37659829 TCCAGTCTGCTGCTGGCTTCTGG + Intronic
1055991838 9:82114658-82114680 CCATGTCTTCTGCTGGTCACTGG - Intergenic
1057903497 9:98967142-98967164 CACAGGCTGCTGAGGGACACAGG + Intronic
1059326767 9:113508465-113508487 CCCAGGAGGCTGCTGGACACGGG - Intronic
1060530622 9:124345345-124345367 CCCACTCTGCTGCCGGCCATGGG - Intronic
1061441799 9:130609730-130609752 CCCAGTGTCCAGCTGAACACAGG - Intronic
1061939778 9:133877695-133877717 CCCAGTCTGCTAATGGGGACAGG + Intronic
1062454535 9:136629390-136629412 CCCACTCCCCAGCTGGACACAGG - Intergenic
1186837681 X:13453694-13453716 CCCACTCTGCTTCTGGGCCCAGG + Intergenic
1187612222 X:20955208-20955230 CCCAGTCTGGTGTTGCACACTGG + Intergenic
1188023380 X:25183529-25183551 CCCAGTCTGCTGCTGCAGGCCGG + Intergenic
1192544772 X:72004453-72004475 CCCAGTCTCCTGCTGGTTTCCGG + Intergenic
1193832377 X:86304938-86304960 CTCAGTCTGTTGCTGCTCACTGG - Intronic
1196055951 X:111355288-111355310 CCCAGTCTTGTGCTAGACTCTGG - Intronic
1197231811 X:124013643-124013665 CACTGGCTGCTGCTAGACACTGG - Intronic
1197518878 X:127472948-127472970 CCCAGTCTGCTTCCAGACAGTGG - Intergenic
1199514462 X:148660518-148660540 CCCAGTCTCCTAGTGTACACAGG - Intronic