ID: 902381664

View in Genome Browser
Species Human (GRCh38)
Location 1:16055664-16055686
Sequence CTGGAGACACTGCTGGGGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 1, 2: 8, 3: 45, 4: 425}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902381664_902381672 -6 Left 902381664 1:16055664-16055686 CCCACCCCCAGCAGTGTCTCCAG 0: 1
1: 1
2: 8
3: 45
4: 425
Right 902381672 1:16055681-16055703 CTCCAGGACATCTTGGCTGCAGG 0: 1
1: 0
2: 2
3: 22
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902381664 Original CRISPR CTGGAGACACTGCTGGGGGT GGG (reversed) Exonic
900085275 1:890743-890765 ATGGAGAGACTGCAGGGGGCAGG + Intergenic
900338857 1:2178311-2178333 GTGGAGACAATGCTGAGGGGAGG - Intronic
900380427 1:2381460-2381482 CTGGGGACACTGCTGTGTGCTGG - Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900624336 1:3601195-3601217 CTGGAGAGAGTGCTGGTGGCCGG - Intronic
900997026 1:6128307-6128329 CTGCAGCCCCTGCTGGGGATGGG - Intronic
900998221 1:6134260-6134282 CTGCAGACACAGCAGGAGGTGGG + Intronic
901012874 1:6211057-6211079 CTGGAGCCACTGCTGCTGCTGGG + Exonic
901051435 1:6427627-6427649 CTGGCGAGTCTGCTGGGGGAGGG + Intronic
901143501 1:7050689-7050711 GTGGAGGCAATGGTGGGGGTAGG + Intronic
901534771 1:9875086-9875108 TGGGAGAACCTGCTGGGGGTGGG - Intronic
902376498 1:16032432-16032454 CTGGAGACACTGCTGGGAGTGGG - Exonic
902381664 1:16055664-16055686 CTGGAGACACTGCTGGGGGTGGG - Exonic
903219301 1:21860080-21860102 CTGGGGACAGGGCTGAGGGTGGG - Intronic
903278089 1:22234102-22234124 CTGGGGAAACTGGTGGGGGAGGG - Intergenic
904036820 1:27563545-27563567 CTGGTGACAGTGATGGGGGAGGG - Intronic
904396889 1:30228124-30228146 CAGGGGACACTGCTGGGGATTGG + Intergenic
905066904 1:35192279-35192301 CTGGTGATGCTGCTGGTGGTAGG + Exonic
905535232 1:38715941-38715963 CTGGAGAGACCACTGGGGCTTGG - Intergenic
905885128 1:41487658-41487680 CTCAAGACACTGATGGGGCTGGG + Intergenic
907047116 1:51306100-51306122 TTTCAGCCACTGCTGGGGGTGGG + Intronic
907870417 1:58437895-58437917 GTGGAGACAGTTCTGTGGGTGGG + Intronic
909834494 1:80236728-80236750 CTGGAGACTCTACTGGGGAAGGG - Intergenic
912491179 1:110063689-110063711 CAGGAGACACTGGGAGGGGTGGG - Intronic
912713037 1:111963087-111963109 TTGGAGACCCAGCTGGGGATGGG - Intronic
913509591 1:119549740-119549762 CTGGCAACACTGCTGAGGATAGG - Intergenic
913517074 1:119613869-119613891 CTGGCAACACTGCTGAGGATAGG - Intergenic
913533395 1:119749021-119749043 CTGGAGCCAAGGCTGGGGGTAGG + Intronic
913959146 1:143326278-143326300 GGGGTGACACTGCTGGTGGTAGG - Intergenic
914053463 1:144151658-144151680 GGGGTGACACTGCTGGTGGTAGG - Intergenic
914125734 1:144814883-144814905 GGGGTGACACTGCTGGTGGTAGG + Intergenic
915076171 1:153309613-153309635 CTGGAGAGACTGCTGAGGACAGG + Intronic
915312890 1:155013330-155013352 CTGGAGACAGTGCTGGGGCTTGG - Intronic
915490483 1:156247621-156247643 CTGGAGACCCTGCTGGGCAAAGG + Intronic
915920938 1:159974619-159974641 CTGAAGCCCCTGCTGGGGATCGG - Intergenic
915973496 1:160370413-160370435 CAGCAGAAACTGGTGGGGGTCGG - Intronic
916675329 1:167060438-167060460 CTGGAGACATTGCGGGGTGAGGG - Intronic
918018969 1:180665717-180665739 CTGGCCACACTGCTGGGGTTTGG + Intronic
919918066 1:202151280-202151302 ATGGATACACTGCTGGGAGCAGG - Intronic
920199671 1:204251839-204251861 CTGGAGGCACTGCAGAGGCTGGG + Intronic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
920607050 1:207399040-207399062 CTGGAGCCAGTGGTGGGGGTGGG + Intergenic
922307495 1:224357026-224357048 CGGGGGACACGGCTGAGGGTGGG + Intronic
922725371 1:227920613-227920635 CTGAAGACAGTGCTGGTGTTGGG + Exonic
922953549 1:229579571-229579593 CTTGAGACTCTGTTAGGGGTGGG - Intergenic
924608337 1:245553923-245553945 GTGGGGACACTGCTGGGAGAGGG + Intronic
924805645 1:247359383-247359405 TAGGAGACCCTGGTGGGGGTAGG + Intergenic
1063200118 10:3779718-3779740 CTGAAGACACTGATGAGGCTTGG - Intronic
1063592342 10:7407244-7407266 CTGGGGAGGCTGTTGGGGGTGGG - Intronic
1066269981 10:33812952-33812974 CTGGGGACACTGCTTGTGGCTGG - Intergenic
1067296392 10:44977432-44977454 CTGAGGACACTGCTGGGGCGGGG + Exonic
1067842489 10:49691987-49692009 CTGAAGACACTCCTGGAGGATGG - Intronic
1069906307 10:71734551-71734573 CCAGAGACACTGCCGGGAGTGGG + Intronic
1070369000 10:75764052-75764074 ATGGAGACCCGGCTGAGGGTGGG + Intronic
1070589140 10:77789209-77789231 ATGGAGACTGTGCTGGGGGGCGG - Intergenic
1071771982 10:88739450-88739472 CTGAAGACACTGCTGAGGACAGG + Intronic
1072047193 10:91668869-91668891 CTGGAGACATTGCCGGGGGTTGG + Intergenic
1073357601 10:102869670-102869692 CTCGAGACACAGCTCGGGGGAGG - Intronic
1076184835 10:128438135-128438157 CTGGTGACAATGCAGGGGGAAGG + Intergenic
1076221746 10:128739461-128739483 CTGGAGACAATGATGGGAGATGG + Intergenic
1076290281 10:129340562-129340584 TTGGTCCCACTGCTGGGGGTCGG - Intergenic
1076614451 10:131746665-131746687 CTGGGGACAGAGCTGGGGGGAGG + Intergenic
1076693639 10:132236669-132236691 CTGGAGCCACTGGGGTGGGTGGG - Intronic
1076806067 10:132859443-132859465 CTGGATACAGTGCCTGGGGTGGG - Intronic
1077102608 11:828838-828860 CTGGAGACCCTGGTCGGGGAAGG - Exonic
1077227974 11:1446651-1446673 CTGGAGCCTCTGCTGGGTGGGGG + Intronic
1077454082 11:2667548-2667570 ATGGAGACACTTCTGGCAGTTGG + Intronic
1078082914 11:8217166-8217188 GGGGAGCCACTGCTGGAGGTGGG + Intergenic
1078145497 11:8719453-8719475 CTGGGGACTCTGCTTGGAGTTGG - Intronic
1079132501 11:17755667-17755689 ATGGAGAGGCTGCAGGGGGTGGG + Intronic
1082162532 11:48900705-48900727 CTGGCGACGCGGCGGGGGGTGGG - Intergenic
1082657750 11:55873124-55873146 CTGGCGACGCGGCGGGGGGTGGG - Intergenic
1082988484 11:59187392-59187414 TTGGAGCCACTGTTGGGGGGAGG + Intronic
1083637734 11:64129505-64129527 CAGGAGGCTGTGCTGGGGGTGGG - Intronic
1083943292 11:65910259-65910281 AAGGAGACAGTGCTGGGGGGAGG + Intergenic
1083998737 11:66284712-66284734 CTGGAGACGCTGCCGGGGGACGG + Exonic
1084096586 11:66915443-66915465 CTGGAGACACAGCAGGGAGAAGG - Intronic
1085051075 11:73380593-73380615 CTGGAGACCAGGCTGGGGGCTGG - Intronic
1085981743 11:81733869-81733891 ATGTAGCCACTGCTGGGGGTTGG + Intergenic
1086138815 11:83471528-83471550 CTGGAGAGACTACTGGAGGATGG + Intronic
1086697678 11:89864122-89864144 CTGGCGGCGCGGCTGGGGGTGGG - Intergenic
1088972819 11:114788388-114788410 TTGCAGACACTGCTGGAGGAAGG + Intergenic
1089384220 11:118057477-118057499 GATGACACACTGCTGGGGGTGGG + Intergenic
1089672776 11:120067987-120068009 ATGGAGGCACTGGTGGGGTTGGG - Intergenic
1090285528 11:125496067-125496089 CCCGACTCACTGCTGGGGGTGGG - Intronic
1090387930 11:126367267-126367289 CAGGAGACGCTGCTGGGGTGTGG - Intronic
1090408560 11:126492256-126492278 TTGGAGACACAGCTGGGGAAGGG + Intronic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090458467 11:126869393-126869415 CTGGAGACACTGCAGGAGAGTGG - Intronic
1090858473 11:130632120-130632142 GAGGATACACTGGTGGGGGTTGG - Intergenic
1092513932 12:9187935-9187957 CTGAAAACCCTGATGGGGGTGGG + Intronic
1093561787 12:20551668-20551690 CTGGGAACACTGCTGAGGGGCGG - Intronic
1096964339 12:55613268-55613290 CTAAAGACTCTACTGGGGGTGGG + Intergenic
1097180351 12:57168283-57168305 CTGGAGAACCTGCAGGGGGCTGG - Intronic
1098971712 12:76863973-76863995 CTGGAGAAGCTGCTGGGGAGAGG - Intronic
1099523181 12:83689187-83689209 TTGGTGACTTTGCTGGGGGTGGG - Intergenic
1099927976 12:89041104-89041126 CTAGAGCCTCTGCTGGTGGTGGG + Intergenic
1100602138 12:96121004-96121026 GTGGAGACTGGGCTGGGGGTAGG + Intergenic
1100860743 12:98803697-98803719 CTGGGAACAGGGCTGGGGGTGGG + Intronic
1101440738 12:104702707-104702729 TTGAAGAGACTGCTGGGGGCAGG - Intronic
1104072811 12:125361144-125361166 TGGGAGCCACTGCTGAGGGTGGG - Intronic
1104569907 12:129916083-129916105 GTGGAGCCCCTGCTGGGGATAGG + Intergenic
1105281446 13:18965020-18965042 ATGGAGACATTGCTGGGTGGAGG - Intergenic
1106118697 13:26839304-26839326 CTCGAGCCAGTGCTGGTGGTAGG - Intergenic
1106374257 13:29169543-29169565 CAGGAGACTCTTCTGGGGCTGGG + Intronic
1106423225 13:29601270-29601292 CAGGAGAAACTGGTGGGGGAGGG + Intergenic
1106564052 13:30870403-30870425 CTGGAGTCAGTGCTGTGGGGTGG + Intergenic
1109100838 13:58181710-58181732 ATGGAGCCACTGCTAGGGGATGG + Intergenic
1109175680 13:59152366-59152388 ATAGAGACACTGTTGGGAGTTGG + Intergenic
1110470696 13:75856434-75856456 CTTGGGGCACTCCTGGGGGTGGG - Intronic
1113586163 13:111467623-111467645 CAGGGGACATTGCTGGGGGAGGG + Intergenic
1113941165 13:114019235-114019257 CTGCTGACACTGCTGGGTGTGGG - Intronic
1114218097 14:20672800-20672822 CTGGGGAGATTGCTGGCGGTGGG - Intergenic
1114221247 14:20699411-20699433 CTGCTGACCCTGCTGGGGCTGGG + Exonic
1114696336 14:24630776-24630798 CTGGAGAAACTGGTGTGGATAGG + Intergenic
1115602228 14:34966498-34966520 CTGGAGTCATTCTTGGGGGTTGG + Intergenic
1118010927 14:61609738-61609760 CTGGAGACACAGCAGAGGGAAGG - Intronic
1118087166 14:62431222-62431244 CTGGAGACAGTTCTGGTGGAAGG + Intergenic
1118302658 14:64629033-64629055 CTGGAGACAGGGGTGGGGGAGGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119620747 14:76130279-76130301 CTTGAGAAACTGCTGGAGGGAGG - Intergenic
1120275362 14:82366899-82366921 ATTGAGACAGAGCTGGGGGTAGG - Intergenic
1121309001 14:92924675-92924697 CTGGAGAGCCTGCTGGGTGTGGG - Intronic
1121485379 14:94310537-94310559 CTTGAGGGCCTGCTGGGGGTGGG - Intronic
1122005110 14:98697015-98697037 CTGGGGCCACAGGTGGGGGTGGG + Intergenic
1122717624 14:103705196-103705218 CTGGGGACACTGGTGGGGAAGGG - Intronic
1122786473 14:104166507-104166529 CTGCAGCCGCTGCCGGGGGTCGG - Intronic
1122853452 14:104548714-104548736 CTGGGGAGAATGCTGGGGCTGGG - Intronic
1202929274 14_KI270725v1_random:23905-23927 GGGGCGACACTGCTGGTGGTAGG + Intergenic
1123423024 15:20147312-20147334 GGGGCGACACTGCTGGTGGTAGG - Intergenic
1123532250 15:21153852-21153874 GGGGTGACACTGCTGGTGGTAGG - Intergenic
1123758002 15:23412036-23412058 CTGGAGACCCGGCTGAGGGAGGG - Intergenic
1124021828 15:25932528-25932550 GAGGTGACACTGCTGGGGGTGGG - Intergenic
1125085197 15:35721730-35721752 CTGCAAACACTGTTGGGGGATGG + Intergenic
1125187825 15:36952224-36952246 CTGAAAACACTGGTTGGGGTGGG + Intronic
1125757992 15:42078110-42078132 CTGGACACACTGCTGATGGGTGG + Intronic
1128222389 15:65978557-65978579 CTGGAGACACTGCTGAGGCTCGG - Intronic
1128291721 15:66483237-66483259 CTGGAGTCACAGTGGGGGGTAGG - Intronic
1128680841 15:69650240-69650262 CTGGAGGATCTGCTGGAGGTTGG - Intergenic
1128796218 15:70468653-70468675 CTGGGGAAAATCCTGGGGGTGGG + Intergenic
1128885585 15:71283891-71283913 ATGGAGACTCTGGTGGGGGAGGG + Intronic
1129385869 15:75195893-75195915 CTGGAGTCAGGGCTGCGGGTAGG + Intronic
1129571022 15:76683734-76683756 CAGAAGACACTGTAGGGGGTGGG + Intronic
1131047691 15:89326579-89326601 CTAGATACACTGCTGGGGGTGGG + Intronic
1131454251 15:92570918-92570940 CTGGTGGCTGTGCTGGGGGTGGG - Intergenic
1132205875 15:99985889-99985911 GGGGAGCCACAGCTGGGGGTGGG - Intronic
1132495943 16:263477-263499 GAGGAGACAGCGCTGGGGGTGGG + Intronic
1132761106 16:1509050-1509072 GTGGAGCCACTGATGGGGCTGGG + Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133338480 16:5021690-5021712 CTTGAGTCACTACTGTGGGTGGG + Intergenic
1133842420 16:9421683-9421705 CAAGAGACACTGCTGTGGGAGGG - Intergenic
1133907811 16:10037942-10037964 CTGGAAGGACTGCTGGGTGTGGG - Intronic
1134322237 16:13174515-13174537 CTGGAGACAGAACTGGGGGCAGG + Intronic
1134516586 16:14892442-14892464 GTGGAGACACTGCTTGGTGGTGG + Intronic
1134704256 16:16291098-16291120 GTGGAGACACTGCTTGGTGGTGG + Intronic
1134963287 16:18421016-18421038 GTGGAGACACTGCTTGGTGGTGG - Intronic
1134967582 16:18503615-18503637 GTGGAGACACTGCTTGGTGGTGG - Intronic
1135608169 16:23840730-23840752 TTGGGGACACTGCTATGGGTTGG + Intronic
1136777679 16:32880448-32880470 CTGGAGGCGGGGCTGGGGGTAGG + Intergenic
1136892945 16:33981066-33981088 CTGGAGGCGGGGCTGGGGGTAGG - Intergenic
1137634776 16:49976285-49976307 CTGGAGACAGGGACGGGGGTTGG + Intergenic
1137836446 16:51597028-51597050 CTGGGGACAATGTTGGAGGTGGG + Intergenic
1139483254 16:67242388-67242410 CAGGACAGACAGCTGGGGGTGGG - Intronic
1140480842 16:75262128-75262150 CTGGAGAGGCTGCTGCGGGGTGG - Intronic
1140695837 16:77532933-77532955 CTGTAGACTCTTCTGGGGATGGG - Intergenic
1141124722 16:81392907-81392929 TTGTAGAGACTGCTGGGGGTCGG - Intergenic
1141618855 16:85225915-85225937 CTGAAGGCTCTGCTGGGGCTGGG + Intergenic
1141756645 16:85995813-85995835 CATGAGCCACTGCTGGGGGCTGG - Intergenic
1142014871 16:87740099-87740121 CTGGAGAAGGTGCAGGGGGTTGG - Intronic
1142132686 16:88438104-88438126 CGGGGGACACTCCTGGTGGTTGG - Exonic
1142382264 16:89739610-89739632 CTGGGGACACCCCTGGGGGTCGG + Intronic
1142708604 17:1710973-1710995 CCGAAAACAATGCTGGGGGTCGG - Intergenic
1142919128 17:3169293-3169315 ATGTAGCCACTGCTGGGGGATGG - Intergenic
1143033953 17:3983822-3983844 CTGAAGTCACTGCAGGAGGTCGG + Intergenic
1143141110 17:4742308-4742330 CTGGGGACACAGCGGGTGGTGGG - Intronic
1143336548 17:6175802-6175824 ATGGAGACAGTGCTGGGTGTTGG - Intergenic
1143397721 17:6615767-6615789 TTGAGGACACTGCTGGTGGTGGG + Intronic
1144579332 17:16449482-16449504 CTGGAGAGCTTGCTGTGGGTTGG - Intronic
1144703012 17:17350942-17350964 CTGGGGACCCTGCTGAGGATGGG + Intergenic
1145262831 17:21365056-21365078 CCCCAGACAATGCTGGGGGTGGG + Intergenic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1146095863 17:29929951-29929973 CTGGAGGTGGTGCTGGGGGTAGG + Exonic
1147324914 17:39665549-39665571 CTGGAGAAATTTCTGGGGGTGGG + Intronic
1147343570 17:39771174-39771196 CTGAAGTCACTGCTGGTGGTGGG - Intronic
1148200378 17:45746332-45746354 CCGGAGGCTCTGCTGGGAGTGGG + Intergenic
1148485913 17:47990966-47990988 GTGGGGACACTGCTGAGAGTGGG + Intergenic
1148795581 17:50195185-50195207 CTGGAGCCAGTGCATGGGGTGGG + Intronic
1148863654 17:50617711-50617733 CTGGAGACAGGGCTGAGGATGGG + Intronic
1149774026 17:59343345-59343367 CTGTAGACACTACTGGGGGTGGG + Intronic
1151539934 17:74759661-74759683 CTGCAGCCTCTGCTGGAGGTAGG - Intronic
1151675007 17:75592733-75592755 CTGAAGGCACTGCAGGGGCTCGG + Intergenic
1151700042 17:75737934-75737956 CTGGGGACCCTGGTGGGGGTTGG - Intronic
1151936024 17:77261769-77261791 CTGGAGCCACTCATAGGGGTGGG - Intergenic
1152085112 17:78213363-78213385 CTGGAGTCACTTCTGGAGCTGGG - Intergenic
1152103181 17:78314472-78314494 CTGGAGGAGGTGCTGGGGGTGGG + Intergenic
1152262415 17:79274221-79274243 CTGGAGACTGGGATGGGGGTTGG + Intronic
1152371783 17:79892864-79892886 TTGGACAAAGTGCTGGGGGTTGG - Intergenic
1152430581 17:80246400-80246422 CTGGGGACAGGGGTGGGGGTAGG - Intronic
1152645998 17:81468848-81468870 CTGGCGAGGTTGCTGGGGGTTGG + Intergenic
1152690131 17:81714190-81714212 TTGGGGTCAGTGCTGGGGGTGGG + Intronic
1152751302 17:82063649-82063671 CTGGAGACACTGCTGGTTCTGGG - Intronic
1152884274 17:82840191-82840213 CTGGAGACAGCGCTGGGAGTCGG - Exonic
1153266281 18:3273193-3273215 CTGGAGAGATTTCTGGGTGTGGG + Intronic
1154260472 18:12827505-12827527 CTGGAGTCCCAGCTGGGGTTGGG - Intronic
1154344648 18:13531890-13531912 CTGGTGGCCCTGCTGGGGGGCGG + Intronic
1157221507 18:45831561-45831583 CTAGAGACTCTGCTGGGTGCTGG - Intronic
1157285532 18:46374807-46374829 CTGGAGACACTTCCTGGGGATGG + Intronic
1157427381 18:47595433-47595455 CTGGAGGCCCTGCTGGCCGTGGG - Intergenic
1157463100 18:47919285-47919307 CTGGAGAGTGTGTTGGGGGTGGG - Intronic
1158144143 18:54291315-54291337 CTGGCAACACTGCTGAGTGTGGG + Intronic
1158572940 18:58612113-58612135 CTGCAGACACTGCAGGGGAATGG + Intronic
1160427586 18:78788511-78788533 CTGGAGACACTGGCTGGGGGAGG + Intergenic
1161218519 19:3106848-3106870 ATGGATACACTGATGGGGGAGGG - Intronic
1161293574 19:3508089-3508111 CTGCAGGCAGTGGTGGGGGTAGG + Intronic
1161555791 19:4941897-4941919 CTGGGAACACTGCTGAGGGGCGG - Exonic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1162175516 19:8827175-8827197 CTGGATACAGTGCTGGAGGATGG + Intronic
1162945786 19:14042650-14042672 TTGGACAGACTTCTGGGGGTGGG - Intronic
1163125766 19:15243392-15243414 CTGGTGACACGGCTGGGGGCCGG + Exonic
1163161087 19:15464446-15464468 CTGGAGGCAGAGCTGAGGGTGGG - Intronic
1163255377 19:16153018-16153040 GCGGAGACACTGCGGGGGCTGGG - Intronic
1163632946 19:18426384-18426406 CACGAGAGTCTGCTGGGGGTTGG - Intronic
1163702617 19:18793756-18793778 CTGGTCACAGTGCTGGGGCTTGG + Intergenic
1163850427 19:19659926-19659948 GTGGAGCCATTGTTGGGGGTTGG + Exonic
1165327997 19:35125323-35125345 CTGGAGCCACTGCAGGAGCTGGG - Exonic
1165393174 19:35549852-35549874 AAGGAGACACCGCTGGGGGGTGG + Intergenic
1167716887 19:51147776-51147798 CTCTAGACAGTGTTGGGGGTGGG - Intronic
1167906527 19:52665185-52665207 CTAGAGCCACTGCCTGGGGTGGG + Intronic
1168327037 19:55543829-55543851 CTGGAGTCAATGAAGGGGGTGGG - Intronic
1168412958 19:56151282-56151304 CTGGAGGCGCTGCTGTGGATTGG + Intronic
1202692862 1_KI270712v1_random:104081-104103 GGGGTGACACTGCTGGTGGTAGG - Intergenic
925040781 2:731839-731861 CGGGTGACCCTGCTGGGGTTTGG + Intergenic
926086423 2:10023101-10023123 CTGGAGCCACGGCTGAGGGCAGG - Intergenic
926197717 2:10773820-10773842 CTGGGGCCCCTGCTGGGGGACGG + Intronic
926226366 2:10969885-10969907 CTGGAAAGACTGCTGGGTCTAGG - Intergenic
927027211 2:19081030-19081052 CTGCTCACACTGCAGGGGGTGGG - Intergenic
927397122 2:22665352-22665374 CTCGAGAGACAGTTGGGGGTAGG - Intergenic
928170248 2:28998748-28998770 CTGGTGTGTCTGCTGGGGGTGGG + Intronic
928715662 2:34056750-34056772 ATGCAGCCACTGCTGGGGGATGG + Intergenic
929596717 2:43180639-43180661 GTGGAGACAAGGGTGGGGGTGGG - Intergenic
931708667 2:64969053-64969075 CTGGAGATACGGGTGGGCGTGGG + Intergenic
931942812 2:67271716-67271738 TTGGAGATAATGCTGGGGGATGG + Intergenic
932265640 2:70365092-70365114 ATGGAGTCACAGCTGGGGGGTGG + Intergenic
932776805 2:74533098-74533120 CAGGAGTCAGTGCTGGTGGTTGG - Exonic
933781436 2:85804580-85804602 ATGGATACACTGATAGGGGTTGG + Intergenic
933953539 2:87349886-87349908 GGGGTGACACTGCTGGTGGTAGG + Intergenic
934237744 2:90246134-90246156 GGGGTGACACTGCTGGTGGTAGG + Intergenic
934275457 2:91570597-91570619 GGGGTGACACTGCTGGTGGTAGG - Intergenic
934460174 2:94209466-94209488 GGGGCGACACTGCTGGTGGTAGG + Intergenic
935712914 2:105914952-105914974 TAGTAGACACTGCTGGGGCTGGG - Intergenic
936327617 2:111519301-111519323 CTAGAGAAACTGCTGGTGGAGGG - Intergenic
938582547 2:132660077-132660099 CTGGAGACAGTGCTAGAGGCGGG - Intronic
940295820 2:152122957-152122979 CTGGAGAGGCTGATGAGGGTGGG + Intronic
940429893 2:153576607-153576629 ATGCAGCCCCTGCTGGGGGTTGG + Intergenic
946026784 2:216676696-216676718 CTGGAGTCGGGGCTGGGGGTGGG + Exonic
946096855 2:217281865-217281887 CTGGAGAGTCTGCAGGGGGCTGG + Intergenic
946179765 2:217942361-217942383 CTGGAGACCCAACTTGGGGTTGG - Intronic
946199651 2:218064404-218064426 CTGGAGACCCAACTTGGGGTTGG - Intronic
946239176 2:218343541-218343563 CTGGACACTGTGCTGGGGCTAGG + Exonic
946620275 2:221554560-221554582 TTGGAGACACTGGGGGGAGTGGG + Intronic
948906643 2:240982830-240982852 CTGGAGACACTGGGGGTGGGAGG - Intronic
948922430 2:241071973-241071995 CTGGAGACTGCGCTGGCGGTGGG - Intronic
948924154 2:241083144-241083166 CAGGAGAGCCTGCTGGGGATGGG + Intronic
1169265851 20:4167007-4167029 CAGGGGACATTGCTGGGGGCGGG + Intronic
1170033677 20:11968234-11968256 CTGGAGACCCTGGTTGGGGAGGG + Intergenic
1170243590 20:14196041-14196063 CCCTAGACACTGCTGGGGGTCGG + Intronic
1170415370 20:16133615-16133637 CTGGGGGAACTGCTGGGGGGAGG + Intergenic
1170465120 20:16615768-16615790 CAGGAAACACTGAAGGGGGTTGG - Intergenic
1170759762 20:19239363-19239385 CTGGAGAGGCTGCTGGCAGTGGG - Intronic
1171146401 20:22787540-22787562 CTGGTGTCACTGCTGGAGGCAGG - Intergenic
1171359430 20:24576727-24576749 CCTGAGGCACTGCTGAGGGTGGG - Intronic
1171774213 20:29350432-29350454 ATGGAGAGACTGCAGGGGGCAGG - Intergenic
1171816233 20:29788050-29788072 ATGGAGAGACTGCAGGGGGCAGG - Intergenic
1171950893 20:31420729-31420751 CTGTAGTCACTGCTGTGGTTTGG - Intergenic
1172277194 20:33686197-33686219 CTGGAGGCCCTGCTCGGGGCCGG - Exonic
1172910997 20:38408709-38408731 CTGGAGAAACAGCTGGGCTTTGG - Intergenic
1172941459 20:38657318-38657340 ATGGAGACACTTCTCAGGGTTGG + Intergenic
1173833775 20:46111589-46111611 CTGGAGACAGTGCAGGGGGTGGG + Intergenic
1174387444 20:50195527-50195549 CTCGAGACACTGCTGGGTGCCGG + Intergenic
1175247311 20:57589864-57589886 CTGGAGGCATTCCTGGGGGAGGG - Intergenic
1176064489 20:63187607-63187629 CTGGAGAGACTGCAGAGGCTGGG - Intergenic
1176447531 21:6832396-6832418 CTGTCGACGCTGCTGGTGGTGGG + Intergenic
1176591295 21:8652505-8652527 GGGGCGACACTGCTGGTGGTAGG + Intergenic
1176825700 21:13697422-13697444 CTGTCGACGCTGCTGGTGGTGGG + Intergenic
1180053455 21:45344544-45344566 CTGGACACACAGCTGGGGGGAGG + Intergenic
1180087422 21:45514259-45514281 CTGGGGACCCTGCTTGGGGGGGG - Exonic
1180274144 22:10629616-10629638 GGGGCGACACTGCTGGTGGTAGG + Intergenic
1180879710 22:19195256-19195278 CTGCAGACTCTGCTCAGGGTGGG + Intronic
1181043389 22:20203466-20203488 CTGGAGGCAGTGCTGGGAGGTGG + Intergenic
1181175030 22:21030398-21030420 CAGGGGCCTCTGCTGGGGGTCGG + Intronic
1181356084 22:22297286-22297308 GGGGCGACACTGCTGGTGGTAGG - Intergenic
1181766303 22:25094591-25094613 CTGGAGAGGCTGCTGGAGGAAGG - Intronic
1181911421 22:26241329-26241351 CTGGAGGCAGAGCTGAGGGTAGG - Intronic
1181941742 22:26483401-26483423 CTGGTGATACTGCTGTGGGAAGG + Intronic
1182256371 22:29041757-29041779 CTGGAGACACTGTCGGTGGTGGG - Intronic
1183499180 22:38168226-38168248 CTGGAGACACTGGAGGTGCTTGG + Intronic
1183780336 22:39995145-39995167 CTGGAGGCGCTGCTGGGCGGCGG + Exonic
1184046847 22:41977138-41977160 CTGGAGGCGCTCCTGGGGGAGGG + Intronic
1184268000 22:43360289-43360311 CTGGAGGCAACGCTGTGGGTGGG + Intergenic
1184277302 22:43417068-43417090 CGGCAGAGACTGCTGGGGGGTGG + Intronic
1184415112 22:44347699-44347721 CTGGCCACACTGCGGGGGGTGGG - Intergenic
1184585053 22:45442260-45442282 CTGGGGGCCATGCTGGGGGTTGG - Intergenic
1184743448 22:46442492-46442514 CAGGAGCCACAGCTGGGGGCAGG - Intronic
1184799995 22:46753299-46753321 CTGGGGACACTGCAAGGGGTGGG - Intergenic
1184856801 22:47150773-47150795 CAGGGGACGATGCTGGGGGTGGG - Intronic
1185023863 22:48396536-48396558 CAGCAGACAGTGCTGGGAGTGGG + Intergenic
1185146025 22:49137174-49137196 CTGGGGAGACTGCTGAGGGCTGG - Intergenic
1185298672 22:50067610-50067632 ATGGAGTCACTGATGGGGGATGG - Intronic
1185421603 22:50738129-50738151 CTGGCCTGACTGCTGGGGGTGGG + Intergenic
949339926 3:3018525-3018547 ATGGAGACATGGCTGTGGGTGGG + Intronic
949762530 3:7487332-7487354 CTGAAGAGAATGCTGAGGGTGGG + Intronic
950234687 3:11308482-11308504 CTGCAGACTCTGCTGGGGAACGG - Intronic
950485974 3:13274193-13274215 CTGGGGACACTTCCGGGGGCAGG - Intergenic
950525322 3:13519608-13519630 TTGGAGAGACTGCTGGGGCTGGG + Intergenic
951971723 3:28453107-28453129 CTGGAGACACTGCTGATATTGGG - Intronic
952428068 3:33195398-33195420 GGGGAGAAACTGCTGGGGGATGG + Intronic
953206776 3:40838257-40838279 CTGGACACACAGGTGGGGTTTGG + Intergenic
953337317 3:42104250-42104272 CTGGGGGCACTTCTGGGGGCAGG + Intronic
953407474 3:42666592-42666614 CTGGTGCCAGTGATGGGGGTTGG - Intergenic
953413890 3:42704609-42704631 CTGCAGACCCTGCTGTGTGTGGG - Intronic
953472176 3:43176948-43176970 TTGGAGGCACTGCATGGGGTGGG + Intergenic
954161962 3:48729280-48729302 GTAGAGACACTTCGGGGGGTGGG + Intronic
954317672 3:49810129-49810151 CTGAAGCCACTGCTGGAGGCAGG - Exonic
954722680 3:52578941-52578963 CTGGAGAAACTGCCAGGGGAAGG + Intronic
955734818 3:62027294-62027316 CTGGAGACACGGCATTGGGTGGG - Intronic
956751840 3:72349667-72349689 CTGGAGACTCTGCTGGGTGGGGG - Intergenic
959191112 3:103112774-103112796 CAAGACACACTGCTTGGGGTTGG - Intergenic
961244141 3:125436782-125436804 CCTGGGACACTGCTGGGGGAGGG + Intergenic
961515175 3:127427778-127427800 CTGGAGCCAGTGATTGGGGTTGG - Intergenic
962638926 3:137362362-137362384 CATGTGACACTGCTGGGGGATGG + Intergenic
963063374 3:141242566-141242588 CTGGAGACAGTGCTGGGGGGTGG + Intronic
963806660 3:149729337-149729359 CTGGTGACTCAGCTGGGGGCAGG + Intronic
963969727 3:151416331-151416353 CTGGGGAGGCTGCTGGGGCTGGG - Exonic
966464299 3:180212814-180212836 CTGGAGACACAGCCTGGGGATGG - Intergenic
968455665 4:698046-698068 CTGGAGACACTGCATGGACTTGG - Intergenic
968600071 4:1504490-1504512 CTGGGGCCATTGCAGGGGGTGGG + Intergenic
969338131 4:6523600-6523622 CTGCACACACTGCTGGGGGCAGG + Intronic
969437653 4:7198036-7198058 CTGGAGGCACTGTGGGGGATGGG + Intronic
970601473 4:17643806-17643828 GTGGAGACCCTGCTGAGGGCTGG + Intronic
971814376 4:31467209-31467231 CTGGATCCATTGCTGGAGGTGGG + Intergenic
975348204 4:73318393-73318415 CTGGTGACACAGCTGGGCATTGG - Intergenic
976022502 4:80646134-80646156 CTGGAGGCACTGTTGTGGCTTGG - Intronic
976987988 4:91326847-91326869 ATGGAGGCACTGCTGGGTTTTGG - Intronic
979783087 4:124680818-124680840 CAGGAGAAATAGCTGGGGGTAGG + Intronic
981307468 4:143262220-143262242 AAGGAGACACTGGTGGGGGTGGG - Intergenic
981739264 4:147985221-147985243 CTGGAGATACTCCTGGGTGTGGG + Intronic
982221126 4:153126066-153126088 GTGGAGACCCTCCTGGGTGTGGG + Intergenic
985613431 5:903883-903905 CTGGGAGCAGTGCTGGGGGTGGG + Intronic
985631338 5:1015639-1015661 CAGGAGCCACTGCTGGGGTGAGG + Intronic
985726158 5:1516767-1516789 GGGGAGACACTGCTGGGGTGGGG - Intronic
985922235 5:2986421-2986443 CTGCAGACACTGCTGGGCTGGGG - Intergenic
985958259 5:3280704-3280726 CTGGAGCCACTCCTGGGTGCAGG - Intergenic
986024598 5:3838736-3838758 CTGGAGCCTCTGCTGGGGGAGGG + Intergenic
987434922 5:17883244-17883266 CTGTGGTCACTGTTGGGGGTAGG + Intergenic
988272058 5:29029990-29030012 CTGGAATCACTGCTAGTGGTTGG + Intergenic
988429245 5:31100309-31100331 CTGGGAAGGCTGCTGGGGGTTGG + Intergenic
991295017 5:65071376-65071398 CTGGAAACAGTGGTTGGGGTTGG - Intergenic
994356192 5:98796339-98796361 CTCGACACACTGTTGGGGGGGGG - Exonic
995729573 5:115223549-115223571 CTGGAGACACTGTTGGCGAAAGG + Intronic
996115040 5:119608975-119608997 CTGGGGACTCCACTGGGGGTGGG - Intronic
997507166 5:134426652-134426674 CTTGAGCCATTTCTGGGGGTGGG - Intergenic
997979205 5:138458656-138458678 CTGCACACTCAGCTGGGGGTAGG + Intergenic
998014704 5:138722949-138722971 CTGCAAGGACTGCTGGGGGTGGG - Intronic
998446733 5:142204645-142204667 CTGGAGACACAGTGTGGGGTTGG - Intergenic
999694872 5:154179817-154179839 CTGGAGAGATGGGTGGGGGTGGG + Intronic
999731263 5:154478094-154478116 CTGGAGCCACTACTGGGCGCCGG + Exonic
1000010650 5:157228541-157228563 CTGGAGAAAAGGCTTGGGGTAGG + Intronic
1000226104 5:159263395-159263417 TTGGAGACGCTGTTGGGGCTCGG + Intronic
1000606763 5:163335214-163335236 GTGGAGACACGGGAGGGGGTGGG - Intergenic
1001191157 5:169632560-169632582 ATGGAGACATTGATGGGGCTGGG + Intergenic
1001267317 5:170283320-170283342 CTGGAGAAAGTGGTAGGGGTGGG - Intronic
1001579484 5:172789170-172789192 ATGGTGGCACTGGTGGGGGTTGG + Intergenic
1001603057 5:172941529-172941551 CCTGAGACAGTGCTGGGGGTAGG - Intronic
1001679284 5:173544331-173544353 TGGGAGGCACTGCTGGGGGATGG + Intergenic
1002050581 5:176568462-176568484 CTGGACACAGTGCAGGGGGCGGG - Intronic
1002425345 5:179171636-179171658 CAGGAGGCAGTGATGGGGGTAGG - Intronic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1004667833 6:17764738-17764760 CTGGTAATACTGCTGGTGGTAGG + Exonic
1005046771 6:21650684-21650706 ATGGAGACACAGCAGGGGGTGGG + Intergenic
1005380506 6:25229478-25229500 TTGGAGACACTGGTGGGAGTGGG + Intergenic
1006088794 6:31615758-31615780 GTGGAGACAGGGCTGGGGGTAGG + Intronic
1006180670 6:32151765-32151787 CTGGAGACAGTGGAGGGGGTGGG + Intronic
1006402318 6:33825015-33825037 CTGCAGGCACTGCTGGGTTTGGG + Intergenic
1006640008 6:35485005-35485027 CAGGAAGCACTGCTGGGGGCTGG - Intronic
1006808468 6:36804666-36804688 TTGGAGCCTATGCTGGGGGTGGG - Intronic
1007170256 6:39857796-39857818 TTGGAGAGACTGCTGGGTGCTGG + Intronic
1007598347 6:43065816-43065838 CTGGAGACAGGGCAGGGGCTGGG + Intronic
1007630405 6:43270117-43270139 ACGGAGACTCTGCTTGGGGTGGG - Intronic
1007798843 6:44374929-44374951 CTGATAAAACTGCTGGGGGTAGG - Intronic
1010211182 6:73363736-73363758 CTGGAGAGACTGCTGGGTCCCGG - Exonic
1013887267 6:114984516-114984538 CAGTAGTCACTGCTGGGGTTGGG + Intergenic
1015701162 6:136037546-136037568 CTGGAGGGCCTGATGGGGGTTGG - Intronic
1015800150 6:137052343-137052365 CTGGGGATAGGGCTGGGGGTGGG - Intergenic
1016358057 6:143239156-143239178 CTGGCAACACTGCTTGGAGTGGG + Intronic
1017143831 6:151216199-151216221 CTGGAAGACCTGCTGGGGGTGGG - Intergenic
1017995381 6:159527637-159527659 CTGGAGCCACAGCCTGGGGTAGG - Intergenic
1018265762 6:162023159-162023181 CCCGAGACACTGCTGTGGGGTGG - Intronic
1018368943 6:163149753-163149775 CTGGAGTCCCTGCTGCGGATCGG + Intronic
1018813409 6:167314150-167314172 CTGGAGACAATGCCGTGTGTGGG - Intronic
1018907946 6:168086097-168086119 CTGGCGTCCCTGCTGGGGATGGG - Intergenic
1018961804 6:168454817-168454839 CTGAAGACGCTGCTGGGGACAGG + Intronic
1019428781 7:989054-989076 CTGGAGGCGCTCCTGGGGGCTGG - Exonic
1019436599 7:1025429-1025451 GGGGGGACACTGCTGGCGGTGGG + Intronic
1019470829 7:1219706-1219728 CTGGAGACACCCCTGGTGGCTGG + Intergenic
1019709465 7:2511681-2511703 CTGAAGACAAGGCTGGGGCTGGG - Intergenic
1020081964 7:5291064-5291086 CAGGAGTCAGTGCAGGGGGTGGG + Intronic
1022507372 7:30915437-30915459 GTGGAGACACTGCAGAGGGAAGG + Intronic
1022793593 7:33714297-33714319 CTGGTGCCGCTGCTGGGTGTGGG - Intergenic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023168164 7:37363530-37363552 CTGGAGCCACTGATGTGGGATGG - Intronic
1023588142 7:41752176-41752198 CAGGGCACACAGCTGGGGGTGGG - Intergenic
1023716126 7:43046249-43046271 ATGCAGCCACTGCTGGGGGATGG - Intergenic
1023859976 7:44212749-44212771 CTGGGGCCACTGTTGGGGGTGGG + Exonic
1025046314 7:55695260-55695282 CTGCAGCTCCTGCTGGGGGTGGG + Intergenic
1027267235 7:76501132-76501154 CTGGAGATACTGTTGGGGGAGGG + Intronic
1027319047 7:77001000-77001022 CGGGAGATACTGTTGGGGGAGGG + Intergenic
1027468105 7:78540253-78540275 CTGTAGCCACTGTTGGGGATGGG + Intronic
1027878548 7:83802309-83802331 CTGGGGACAGGGTTGGGGGTAGG + Intergenic
1028999557 7:97139031-97139053 CTCGAGGCACTGCTGGGAGCAGG - Intronic
1029705293 7:102272818-102272840 CTGGAGCCTCTGTTGGGGGCGGG + Intronic
1032542503 7:132715036-132715058 CAGGAGAAAGGGCTGGGGGTGGG - Intronic
1033302919 7:140202171-140202193 CGGGAAACAATGCTGGGGGGTGG - Intergenic
1037716756 8:21407575-21407597 AGGGAGACAGTGCTGGGAGTGGG - Intergenic
1037766764 8:21776888-21776910 CTTGAGAAACTCCTTGGGGTGGG + Intronic
1037993818 8:23338927-23338949 CTGCAGGCTCTGCTGGGTGTGGG + Intronic
1038019304 8:23539467-23539489 TTTGAGACACTGCTGTGGGTGGG + Intronic
1038417018 8:27404524-27404546 CTGGAGTCCCTGCTGCGGGTGGG - Intronic
1039442966 8:37608082-37608104 CTTGTGACACTGTGGGGGGTGGG + Intergenic
1039616115 8:38956290-38956312 TAGGGGACACTGCTGGGTGTGGG - Intronic
1040530885 8:48265521-48265543 CTGGAGCCACTGCAGGGTGCCGG + Intergenic
1043075821 8:75698229-75698251 CTGGAGACTTGGCTGGGGCTGGG + Intergenic
1043807116 8:84685400-84685422 GTGGAGACGATGGTGGGGGTTGG - Intronic
1044364832 8:91332636-91332658 CTCAAGAGACTGCTGGCGGTGGG - Intronic
1045703670 8:104896157-104896179 CTGGAGCCCCTGCTATGGGTTGG + Intronic
1049532062 8:143159824-143159846 CTGGAGAAGGGGCTGGGGGTGGG - Intronic
1049624375 8:143613494-143613516 CTGGCTCCAGTGCTGGGGGTTGG - Intronic
1049641911 8:143719652-143719674 CAGGAGGAGCTGCTGGGGGTGGG + Intronic
1049676371 8:143891085-143891107 CTGGCTGCACAGCTGGGGGTCGG - Intergenic
1053001604 9:34579824-34579846 CTGGAGGTGCTGCTGGGGGAGGG + Intronic
1053690671 9:40585152-40585174 GGGGCGACACTGCTGGTGGTAGG + Intergenic
1054274134 9:63052339-63052361 GGGGCGACACTGCTGGTGGTAGG - Intergenic
1054301929 9:63386123-63386145 GGGGCGACACTGCTGGTGGTAGG + Intergenic
1054400706 9:64712629-64712651 GGGGCGACACTGCTGGTGGTAGG + Intergenic
1054434314 9:65196946-65196968 GGGGCGACACTGCTGGTGGTAGG + Intergenic
1054496076 9:65824735-65824757 GGGGCGACACTGCTGGTGGTAGG - Intergenic
1055342195 9:75295931-75295953 GTGGGGCCACTGCTGGGGGATGG + Intergenic
1055834734 9:80425551-80425573 CTTGAAATGCTGCTGGGGGTGGG + Intergenic
1056376213 9:86014665-86014687 CTGAAGTCACTGCTGTGGGAGGG + Intronic
1057016225 9:91655403-91655425 CTGGAGGCGCTGCTCCGGGTAGG + Intronic
1057605021 9:96492860-96492882 CTGGACACACTGCTGCCGGCTGG + Intronic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058973149 9:110101352-110101374 CTGGCTACACTGATGGGAGTAGG - Intronic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1059341821 9:113601559-113601581 GTGGAGGCATGGCTGGGGGTGGG + Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1061431716 9:130535566-130535588 CTGGAGAGGATGCTGGGGGTGGG - Intergenic
1061930852 9:133832378-133832400 CTGCAGACTCTGCTGGGGGTTGG + Intronic
1061964430 9:134005052-134005074 CTGGGGACACAGCTGGGCATGGG - Intergenic
1062131006 9:134893089-134893111 ATGGAAACACTGCTGGGGAATGG + Intergenic
1203521660 Un_GL000213v1:52135-52157 CTGTCGACGCTGCTGGTGGTGGG - Intergenic
1203367907 Un_KI270442v1:274335-274357 ATGGAGAGACTGCAGTGGGTAGG - Intergenic
1203621324 Un_KI270749v1:131268-131290 GGGGCGACACTGCTGGTGGTAGG + Intergenic
1188308403 X:28586729-28586751 GGGGAGACAGTGATGGGGGTGGG + Intergenic
1188509485 X:30920060-30920082 CTGGAGAAAATCATGGGGGTGGG + Intronic
1188917991 X:35935425-35935447 ATGCTGCCACTGCTGGGGGTTGG + Intronic
1189248938 X:39585075-39585097 CGGGAGACACTGCTGAGGTGAGG - Intergenic
1189761060 X:44322060-44322082 CTGGTGATACAGCTGGGGGTGGG - Intronic
1190808487 X:53861723-53861745 TTGCAGCCACTGCTGGGGGATGG + Intergenic
1192236248 X:69297952-69297974 CTGGAGACATATCTGGGGCTGGG - Intergenic
1193080868 X:77404767-77404789 AGGGAGACACTGCTGGGGCCAGG - Intergenic
1193217045 X:78875690-78875712 CTGGTGACACCTCTGGGTGTTGG + Intergenic
1194553797 X:95332927-95332949 CTGGAGCCACTGTTGGGGGCTGG - Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1199528980 X:148825820-148825842 CAGGAGGCAGTGGTGGGGGTGGG + Intronic
1199687811 X:150280155-150280177 CTGAAAACAGTGGTGGGGGTTGG - Intergenic
1200102164 X:153693594-153693616 CTGGAGGCGGGGCTGGGGGTAGG - Intronic
1200268567 X:154660153-154660175 CTGGAGACACAGCTACGGGAAGG - Intergenic
1201782608 Y:17740157-17740179 CTGGAGACCTGGCTGGGGGCTGG - Intergenic
1201818945 Y:18165831-18165853 CTGGAGACCTGGCTGGGGGCTGG + Intergenic
1202584335 Y:26408437-26408459 GGGGCGACACTGCTGGTGGTAGG - Intergenic