ID: 902383013

View in Genome Browser
Species Human (GRCh38)
Location 1:16061430-16061452
Sequence CACCTGAAGCAGCTGGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902383013_902383021 29 Left 902383013 1:16061430-16061452 CCCATGCCCAGCTGCTTCAGGTG 0: 1
1: 0
2: 2
3: 26
4: 222
Right 902383021 1:16061482-16061504 GAGAACCGCCCTGAGCTCCTGGG 0: 1
1: 0
2: 1
3: 15
4: 141
902383013_902383017 7 Left 902383013 1:16061430-16061452 CCCATGCCCAGCTGCTTCAGGTG 0: 1
1: 0
2: 2
3: 26
4: 222
Right 902383017 1:16061460-16061482 TGTCAGCTCACACCCTTATCTGG 0: 1
1: 0
2: 0
3: 5
4: 77
902383013_902383020 28 Left 902383013 1:16061430-16061452 CCCATGCCCAGCTGCTTCAGGTG 0: 1
1: 0
2: 2
3: 26
4: 222
Right 902383020 1:16061481-16061503 GGAGAACCGCCCTGAGCTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902383013 Original CRISPR CACCTGAAGCAGCTGGGCAT GGG (reversed) Intronic
900159794 1:1218114-1218136 CACCTGCACCTGCTGGGCCTTGG + Intronic
900987330 1:6080735-6080757 CACGTGCAGCATTTGGGCATGGG + Intronic
901438687 1:9264552-9264574 GACCTGGTGCTGCTGGGCATGGG + Exonic
902299193 1:15489343-15489365 CTCCCGAGGCAGCTGGGCAGAGG + Intronic
902377881 1:16038593-16038615 CACCTGAAGCAGATGGGGATGGG - Intergenic
902383013 1:16061430-16061452 CACCTGAAGCAGCTGGGCATGGG - Intronic
902713394 1:18255967-18255989 CCCCTGCAGCAGCTTGCCATTGG + Intronic
903471956 1:23593581-23593603 CACCTGAAACTGCTGGGCTTGGG - Intronic
903501930 1:23805222-23805244 ATCCTGAAGCAGGTGGGAATGGG - Intronic
904330449 1:29754962-29754984 CACATGAAGCATCTGGCCAAGGG - Intergenic
904416228 1:30362633-30362655 CACATGAAGCATCTGGCCAAGGG + Intergenic
906568755 1:46818779-46818801 CACCTGAAGCCACTGGGCCCTGG + Exonic
907037638 1:51230213-51230235 CACCTTTCGCAGCTGGGCTTAGG - Intergenic
908064878 1:60392066-60392088 CACTGGAAGCATCTGGGCATGGG - Intergenic
911472838 1:98339612-98339634 CACCTGCACCATCAGGGCATTGG + Intergenic
913968330 1:143394968-143394990 CACATGAAGCAACAGGGCAAGGG + Intergenic
914062708 1:144220564-144220586 CACATGAAGCAACAGGGCAAGGG + Intergenic
914116442 1:144745790-144745812 CACATGAAGCAACAGGGCAAGGG - Intergenic
915972885 1:160366735-160366757 CACCAGAGGCAGCAGGGCAGAGG - Intergenic
916061180 1:161099465-161099487 AACCAGAAGTAGCTGGGCATTGG + Exonic
921839923 1:219817430-219817452 AACCTGAAGGAGCTGGGAAGTGG + Intronic
922163286 1:223094186-223094208 CACCTGCAGCAGCTGGGCCCAGG + Intergenic
922615978 1:226961461-226961483 CACCTGCAGCACTTGGGCATCGG + Exonic
922720178 1:227896311-227896333 CAGCTGAAGCTGCTGGGAAGAGG - Intergenic
922897340 1:229110705-229110727 CACCTTACCCAGCTGGGCAAGGG + Intergenic
1068927235 10:62553273-62553295 CACCCGAGGAACCTGGGCATAGG + Intronic
1069058350 10:63867675-63867697 CACATGAACCAGCAGGGCTTGGG + Intergenic
1069356942 10:67597729-67597751 CACCTGCAGCAACAGGGCAGTGG + Intronic
1069642019 10:69962297-69962319 CAAGTGAAGAAGCTGGACATGGG + Intronic
1071384400 10:85104933-85104955 GGCCTGAAGCAGATGGGCAGAGG - Intergenic
1075739790 10:124687894-124687916 CTCCTGAAGCTTCTGGGCAGTGG - Intronic
1076387375 10:130067068-130067090 AACCAGAAGCAGCTGGCCCTGGG - Intergenic
1077088533 11:766901-766923 TCCCTGCAGTAGCTGGGCATGGG + Intergenic
1077250546 11:1558816-1558838 CTCCAGAAGCAGCTTGGCAGCGG - Intronic
1077343336 11:2035691-2035713 CACCCTGAGCAGCTGGGCGTTGG - Intergenic
1078334277 11:10451245-10451267 CACCTGAGGCCGCTGGGGCTCGG - Intronic
1079589346 11:22163612-22163634 TCACTGAAACAGCTGGGCATGGG - Intergenic
1081588466 11:44404034-44404056 AAACTGAAGCAGCTGGTCAAAGG + Intergenic
1082814928 11:57501363-57501385 CACCAGGAACAGCTGGGCACAGG + Intronic
1083431817 11:62617164-62617186 CTCCCGAAGCCGCTGGGCTTTGG + Exonic
1084172416 11:67406896-67406918 CACCTGCAGCAGGTGGGCGTCGG + Exonic
1088715350 11:112544091-112544113 GAGGTGAAGCAGCTGGACATTGG - Intergenic
1089485131 11:118839443-118839465 CACATGAAGCAGGGGGGCAGAGG + Intergenic
1090275320 11:125414598-125414620 TTCCTGAAGCAGCTGAGGATTGG - Intronic
1091145865 11:133279637-133279659 CACCAGCAGCAGCCGGGCATGGG - Intronic
1202826322 11_KI270721v1_random:90880-90902 CACCCTGAGCAGCTGGGCGTTGG - Intergenic
1091595228 12:1873960-1873982 CAGCTGAGGCAGATGGGCAGGGG + Intronic
1092071835 12:5637557-5637579 CAGCTGATGCAGCTGGTCCTTGG - Intronic
1093637806 12:21492669-21492691 CTCCAGAAGCACCTGGCCATAGG - Intronic
1096048640 12:48586641-48586663 CCTCTGGGGCAGCTGGGCATGGG - Intergenic
1097091600 12:56509831-56509853 CAACTTTAGAAGCTGGGCATGGG - Intergenic
1097270289 12:57769843-57769865 CACCTGCAGGAGCTGCGCGTAGG + Exonic
1102148692 12:110673638-110673660 CAGCTGGAGCAGCTGGACACAGG - Intronic
1105442864 13:20429920-20429942 CTCCTGAAGTAGCTGGCCAACGG + Intronic
1107306897 13:39031725-39031747 CACCTGTATCACCTGGGCCTGGG - Intronic
1107976512 13:45693603-45693625 CAACTGAACCTGCTGGGGATAGG + Intergenic
1108933948 13:55864361-55864383 CACCTGGAGCAGCTGGGATAAGG - Intergenic
1109184311 13:59250842-59250864 CTCCTGCAGCAGCTGAACATTGG - Intergenic
1113022747 13:105906364-105906386 CACCTGAAGCAACTGGAGCTGGG + Intergenic
1113517657 13:110915388-110915410 CGTCTGGAGCAGCCGGGCATTGG + Intergenic
1113817297 13:113182160-113182182 CACCAGAAGCAGCAGGCCCTGGG + Intronic
1114192404 14:20449913-20449935 CACCGTATGCAGCTGGGCAGTGG + Intronic
1114556651 14:23566074-23566096 CTCATGAAGCAGTTGGGCACAGG + Exonic
1115522141 14:34243630-34243652 AACCTGAAGGAGCTGGACGTGGG - Intronic
1117977299 14:61310985-61311007 GAGCTGAAGCAGCAGTGCATGGG + Intronic
1119069892 14:71572006-71572028 CACCAGCAGCAGCTGGACCTTGG - Intronic
1121775138 14:96585324-96585346 CTCCTGCAGCCGCTGGGCCTGGG - Intergenic
1122899192 14:104775167-104775189 TACCTGAAGCTGCTGGGCAAGGG - Exonic
1124254112 15:28127229-28127251 CTGCAGACGCAGCTGGGCATAGG + Intronic
1125921314 15:43527439-43527461 CACTTGGAGCAGCTGGGGATTGG + Exonic
1126106168 15:45148304-45148326 CACCTCAGCCAGCTGGGCCTTGG - Exonic
1128657953 15:69476300-69476322 CACTTGAAGAAGCTGGGCTTGGG - Intergenic
1129877585 15:78986223-78986245 GATCTGGAGCAGCTGGGGATGGG + Intronic
1130079362 15:80718622-80718644 TACAAGAAGCGGCTGGGCATGGG - Intronic
1130145156 15:81268492-81268514 CAGAGGAAGCAGCAGGGCATGGG - Intronic
1131206495 15:90452853-90452875 CACCTGGGGCAGCTGGGCTTCGG - Exonic
1131358817 15:91771015-91771037 CACCAGAAGCAGCTGATCATGGG + Intergenic
1132003309 15:98202097-98202119 CAACTGAAGCACCTGGGGGTGGG - Intergenic
1132890024 16:2199272-2199294 CAGATGAGGCAGCTGAGCATCGG - Intergenic
1133359231 16:5160700-5160722 CACCTTGAGCAGCTGAGCAGGGG - Intergenic
1141014264 16:80433627-80433649 CTCCTGAAGCAGCCTGTCATTGG - Intergenic
1142109584 16:88324053-88324075 CAGCTGGAGCAGCTGGGCTGGGG + Intergenic
1142742153 17:1937499-1937521 CACCTGGAGGAGCTGGACCTCGG - Exonic
1143502669 17:7348202-7348224 CACCGGGAGCAGCTGGGCCCTGG - Exonic
1144484622 17:15654404-15654426 GACCTGAGGCAGCTAGGAATAGG - Intronic
1147600171 17:41740300-41740322 CACGGGAAGCAGCTGGGAGTGGG + Intergenic
1147743240 17:42680390-42680412 CAGCTGGAGCAGGTGGGCAGAGG + Exonic
1148022481 17:44562585-44562607 CACCTGTGGCACCTGGGCCTGGG + Intergenic
1148042527 17:44720093-44720115 TTCCTGAAGCAGCTGGTCTTGGG - Intronic
1148386846 17:47240188-47240210 CACCAGAAAAACCTGGGCATTGG - Intergenic
1149085410 17:52710096-52710118 CCCCTGAGCCAGCTGGGAATTGG - Intergenic
1151585210 17:75004526-75004548 CCCCTGAAACAGCTGGCCCTGGG - Exonic
1151761089 17:76103622-76103644 AAGCTGAAGCAGGTGGGCGTGGG - Exonic
1153022924 18:647503-647525 GCCCTGAAGCAGCTGTCCATCGG - Intronic
1153791110 18:8580631-8580653 CAACACAAGCAACTGGGCATGGG - Intergenic
1153871015 18:9320211-9320233 CAGTTGCAGCAGCTGGGGATAGG - Intergenic
1155716702 18:28952729-28952751 GAGCTGAAGAAGCTGGACATAGG + Intergenic
1156453342 18:37279088-37279110 CAGCTTAGGCAGCTGGGCAGTGG - Intronic
1156633933 18:39004504-39004526 AACCTGAAGAAGCTGGTAATGGG + Intergenic
1158782551 18:60668414-60668436 CTGCTGAAGCAGCTGGGATTTGG - Intergenic
1159504380 18:69315873-69315895 CCCCTGTTGCAGCTGGGCATAGG - Intergenic
1160918117 19:1507239-1507261 CACCTGTAGGAGCAGGTCATGGG + Exonic
1161358085 19:3830587-3830609 CCCCTGACCCAGCTGGGGATGGG - Intronic
1161579110 19:5071038-5071060 CGCCTGGAGCGGCTGGCCATCGG + Exonic
1162744844 19:12792447-12792469 CACCCGGCGCAGCTGGGCTTGGG + Exonic
1163100527 19:15093319-15093341 CAACTGATGTAGCTGGGCAAGGG - Intergenic
1163291761 19:16383869-16383891 CACCTGGGGCACCTGGGCATGGG + Intronic
1163695148 19:18760192-18760214 AACCTGACGCACCTGGGCATCGG + Exonic
1165038872 19:33054791-33054813 CACCTGATGCTACTGGGCGTTGG - Intronic
1166738523 19:45100321-45100343 CACCTGCTGCAGTAGGGCATGGG + Intronic
1167048033 19:47062766-47062788 CACCTGTAGAATCTGGGCAGTGG + Intergenic
1167430505 19:49451546-49451568 AACCCGAAGCTGCTGGGAATGGG - Exonic
1168393952 19:56032678-56032700 CACCTGCGGCAGCTGGACCTGGG + Exonic
1202702117 1_KI270712v1_random:172436-172458 CACATGAAGCAACAGGGCAAGGG + Intergenic
925205719 2:2003822-2003844 TGCCTGAAGCAGCCGGGCCTGGG - Intronic
925343733 2:3154864-3154886 CACCTAAGGCAGCCGGGAATGGG - Intergenic
926718454 2:15942062-15942084 GACGTGGAGCAGCTCGGCATCGG - Exonic
926974747 2:18503189-18503211 CACATGAAGAAGCTGGGTCTTGG - Intergenic
927217737 2:20677974-20677996 CAGCAGCAGCAGCTGGGCTTGGG + Intergenic
927711088 2:25326769-25326791 CTCCTGCAGGAGCTGGGCACTGG - Intronic
930041531 2:47128897-47128919 CACCTGAAGCAGCACAGCACTGG + Intronic
932121341 2:69103234-69103256 CTCCGGAAGCAGCGGGGCACTGG + Intronic
932432276 2:71683181-71683203 CTCCTGCAGCAGGTGGGCATAGG + Intronic
934173030 2:89555882-89555904 CACATGAAGCAACAGGGCAAGGG + Intergenic
934283344 2:91630239-91630261 CACATGAAGCAACAGGGCAAGGG + Intergenic
934681104 2:96284485-96284507 GACCTGAAGCTGCTGGGCAAAGG - Exonic
934767976 2:96891163-96891185 CTCCTGCTGCAGCTGTGCATGGG - Intronic
937120300 2:119436219-119436241 CTCCTGCAGCTTCTGGGCATGGG - Intronic
937281364 2:120719628-120719650 TACATGAAGAAGCTGGGCCTTGG - Intergenic
940074517 2:149726248-149726270 CAACTGAAGGAGCTGAGCAAAGG + Intergenic
943223939 2:185144757-185144779 GCCCTGAGGCAGCTTGGCATCGG + Intergenic
943906300 2:193503635-193503657 CCCATGAAGCAGCAGGGCCTAGG + Intergenic
945319321 2:208403723-208403745 CAACTGAGGCAGCTGAGCTTGGG + Intronic
945459475 2:210088688-210088710 TTCCTGAAGCAGGTGGGCATTGG + Intronic
948362674 2:237433956-237433978 CACCTGCAGCAGCTGGGAGATGG - Intergenic
948413799 2:237785624-237785646 CACCTGAAGCAGCTGAGTCAGGG + Intronic
949021763 2:241744772-241744794 GACCTGAAGCAGCTGTTCATCGG + Exonic
1169248058 20:4039207-4039229 CACATGCAGCAGCTGGGCCAGGG + Intergenic
1170302903 20:14905901-14905923 CACCTCAATTAGCTGGGCATGGG + Intronic
1170627178 20:18038787-18038809 CTCCTGAAGTCGCTGGCCATTGG - Intronic
1171482839 20:25467000-25467022 CTCCACAAGCAGCTGGGCCTCGG + Intronic
1171484547 20:25477520-25477542 TCCCTGAAGCTGCTGGGCCTTGG + Intronic
1172699754 20:36845822-36845844 CAACTGAAGGAGCTGGGGGTGGG + Intronic
1173552539 20:43942944-43942966 CACCAGAAGGAGCTGAGCAGAGG + Intronic
1174170321 20:48613744-48613766 TACCTGTATCAGCTGGGCACTGG + Intergenic
1174205476 20:48835152-48835174 CACCTGCAACACCTGGGCAGTGG - Intergenic
1175715328 20:61251791-61251813 CACCTGGAGCAGATGAGCAGAGG - Intergenic
1176853059 21:13936426-13936448 CACATGGGGCAGCTGGGCAGAGG + Intergenic
1177907643 21:26991640-26991662 CACTTGAACCAGGTGGGCAGAGG - Intergenic
1178349783 21:31864486-31864508 GAGATGAAGCAGCTGGACATGGG + Intergenic
1178772656 21:35520024-35520046 CACGTGAAGCAGCTGGTGAATGG - Intronic
1179229451 21:39488454-39488476 GACCTGGAGCACCTCGGCATTGG - Intronic
1181455061 22:23054486-23054508 TGCCTGAAGCAGCTGGGCTGGGG + Intergenic
1181522629 22:23458380-23458402 CTCCTGCAGCTGCTGGGCAGGGG - Intergenic
1182695911 22:32199219-32199241 GACATGAAGCAGCCGGGCAAAGG + Intronic
949169629 3:983124-983146 TACCTGAAGAAGGTGTGCATTGG - Intergenic
951619889 3:24589296-24589318 CACCTGAATCAGCATGACATGGG + Intergenic
951694797 3:25434868-25434890 CATCTGATGCAGATGGGGATGGG - Intronic
952970458 3:38647664-38647686 CACCAGAGACAGCTGGGGATGGG - Intronic
953405889 3:42659530-42659552 AACCTGAAGAAGCTGGGCGGCGG + Exonic
953791117 3:45949108-45949130 CACCTGGTGCAGCTGAGCACAGG + Intronic
954624941 3:52017257-52017279 CAACTGAAGCAGCTTGCCTTTGG + Intergenic
955268408 3:57470788-57470810 CACTTGAACCAGCGGGGCAGAGG - Intronic
956684548 3:71812668-71812690 CACCTGAATGATCTGCGCATGGG + Intergenic
960554398 3:119011406-119011428 CCCCTGAAGCACATGTGCATGGG + Intronic
960916591 3:122701529-122701551 CACCAGCAGCAGCGGGGCCTGGG + Exonic
961781130 3:129320539-129320561 CACCTGCAGCAGCAGCGGATGGG + Intergenic
962264028 3:133933164-133933186 CCTCTGGAACAGCTGGGCATGGG - Exonic
963233275 3:142931314-142931336 CACCTGGAGCAGCGGGCAATAGG - Intergenic
963835469 3:150054356-150054378 CACCTGAAGGAGATGGGGTTGGG + Intergenic
964336306 3:155658259-155658281 TTCCTGAAGCAGCTGGGCAGTGG + Intronic
964790935 3:160452816-160452838 CTCCCGAAGCCGCTGGGCTTTGG - Intronic
964973504 3:162589578-162589600 CAGCTGAAGCTGCTGCTCATAGG + Intergenic
966623135 3:181987180-181987202 AAACTGCAGCAGCTGGGTATTGG - Intergenic
966823758 3:183946041-183946063 CACATGCAGCAGCTGGTCTTAGG + Intronic
968915595 4:3495795-3495817 CACCGGGAGCAGCTGGGGAGGGG + Intronic
969055956 4:4402844-4402866 CACCTGGAGAAGCCAGGCATGGG + Intronic
969826885 4:9764742-9764764 CACATGAAGCAACAGGGCAAGGG + Intergenic
970583209 4:17492177-17492199 CACCTGCAGCAGTGGGGCAGAGG + Intronic
971929829 4:33066399-33066421 CACCTAAAGCCTCTGGGCCTTGG + Intergenic
973148664 4:46860965-46860987 AACCTGCAGCACCTGGGTATTGG - Intronic
974027542 4:56746858-56746880 CAACTGAAGCCACTGAGCATTGG - Intergenic
976240113 4:82946367-82946389 CACTTGAATCTGCTGGACATTGG + Exonic
977323499 4:95548167-95548189 CACCTGAAGCAGCAGGCGAGGGG + Intronic
978104604 4:104886463-104886485 TTTCTGAAGCAGCTGGGCAATGG - Intergenic
980971191 4:139568715-139568737 GTCCTGGAGCAGCTGGGCCTGGG + Intronic
983323330 4:166223714-166223736 CTCCTGGAGCTGGTGGGCATTGG + Intergenic
984363713 4:178771082-178771104 CACCCACAGCAGCTGGGCAAAGG - Intergenic
984615867 4:181896788-181896810 CAGCTGGAGCATCTGGGCAGAGG - Intergenic
984915283 4:184718141-184718163 CCACTGCAGCAGCTGGGCAGAGG + Intronic
988085274 5:26468113-26468135 CACCTCAAGCAGCCAGGCAGAGG - Intergenic
988231373 5:28483947-28483969 TAGGCGAAGCAGCTGGGCATTGG - Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
992819451 5:80481407-80481429 AACCAGAAGCAGCTGAGCAAAGG + Intergenic
997299245 5:132790357-132790379 TAACTGAAGCCGCTGGGCACTGG + Intronic
999145479 5:149390415-149390437 GACCTTAAGCATCTGGGCGTGGG - Intronic
999322287 5:150623054-150623076 CACATGTGGCAGCTGTGCATGGG - Intronic
1001774170 5:174316203-174316225 CCCCTGCTGCAGCTGGACATGGG + Intergenic
1002524171 5:179806439-179806461 CACCTGGCGCACCTGGGCGTCGG - Intronic
1005106754 6:22232014-22232036 CACCTGCAGCAGCTGGGCAGTGG + Intergenic
1005384339 6:25271133-25271155 CATCTGAGGCAGCTGTGCAGGGG + Intergenic
1005499365 6:26416607-26416629 CACCTGTAGCAGGTGTGCATGGG + Intergenic
1005504152 6:26455429-26455451 CTCCTGTAGCAGATGTGCATGGG + Intergenic
1007230557 6:40344980-40345002 CAGCTGAAGGAGCTGGGTGTGGG - Intergenic
1012632223 6:101485277-101485299 CACATGAAGCAGCTGGCTAGTGG + Intronic
1013073445 6:106750101-106750123 AACCTGGAACAGCTGGGCAAGGG - Intergenic
1021390017 7:20080959-20080981 AACCTGAATCAGCTTGGAATAGG + Intergenic
1022287138 7:28964317-28964339 CACCTGAAGCTGCTGGACACTGG - Intergenic
1023030009 7:36083154-36083176 CAGGAGAAGCAGCTGGCCATCGG - Intronic
1023415177 7:39925436-39925458 GACTTAATGCAGCTGGGCATGGG + Intergenic
1024230655 7:47360985-47361007 CGCCCGTAGCAGCTGGACATTGG - Intronic
1024603637 7:51008093-51008115 CTCCAGAAGCAGCAGGGAATGGG + Intergenic
1026095575 7:67343774-67343796 CACCTGCTCCAGCTGGGCTTTGG + Intergenic
1026916117 7:74121215-74121237 CAGCTGGAGCAGCTGGACAGAGG + Exonic
1027574189 7:79911046-79911068 CAAATGATGCAGCTGAGCATTGG + Intergenic
1028231716 7:88313594-88313616 CAAGTGAAGGAGGTGGGCATGGG - Intergenic
1028904214 7:96135102-96135124 CACCTGAAGAAGATGGCCTTTGG - Intronic
1029225857 7:99028087-99028109 CCCCTGAAGCATCTGGGCAGAGG + Exonic
1030447005 7:109658334-109658356 GACCTGAAGCAGCAGAGCAAAGG + Intergenic
1031377087 7:121040153-121040175 CACCTCAAGTGGCTGGTCATGGG - Intronic
1031805529 7:126302388-126302410 AACATGGAGCATCTGGGCATTGG - Intergenic
1035418865 7:158710590-158710612 AACCTGAAACAGCTGAGAATCGG + Intergenic
1037725250 8:21478093-21478115 AAGCTGAGGCAGCTGGACATAGG + Intergenic
1038534971 8:28347298-28347320 TACCCGAGGCAGCTGGGCAGTGG + Exonic
1039780196 8:40777589-40777611 CCCCTGAAGCATCTGGGCAGAGG + Intronic
1040806133 8:51398295-51398317 AAGCTGAAGCAGCTGGGAACAGG + Intronic
1042951443 8:74204233-74204255 CAGCTGCAGCAGCCAGGCATGGG + Intergenic
1046664945 8:116990991-116991013 GACCTGAAGAATCTGGGCTTTGG + Intronic
1047898058 8:129388831-129388853 CAACTGAGGCAGCTGAGCAGGGG + Intergenic
1049621133 8:143598765-143598787 AAGCTGAAGCCGCTGGTCATCGG + Exonic
1049707520 8:144049771-144049793 CACCTCAAGCTGCTGGACAGCGG + Intergenic
1053053507 9:34979964-34979986 CATCTGAAGCAGCCAGGCCTGGG + Exonic
1055945462 9:81688471-81688493 TTCTTGAAGCAGCTGGGCCTGGG - Exonic
1056966044 9:91163670-91163692 CACCAGAACCAGGTGGGCAGTGG - Intergenic
1057443345 9:95097432-95097454 CATCTGATGCACCTGGGCAGGGG + Intergenic
1060588495 9:124801499-124801521 CACCTGAAGCAGCTTCTCCTTGG - Exonic
1061373642 9:130211851-130211873 CACCTCAAGCAGCTGTGCCTTGG - Intronic
1061568056 9:131457384-131457406 CCCCTGAAGGAACTGGACATTGG + Intronic
1062376360 9:136263619-136263641 CACCTGCTGCAGCTTGGCCTGGG + Intergenic
1062451577 9:136617897-136617919 CACATGAAGAGGCTGGGCAGGGG + Intergenic
1062530402 9:136997077-136997099 CATCTGCAGCACCAGGGCATCGG + Intergenic
1062708353 9:137957525-137957547 CACCTGCCTCAGCGGGGCATGGG - Intronic
1187101621 X:16198783-16198805 TTCCTGAAGCAGCTGGGTAGTGG - Intergenic
1187476295 X:19614084-19614106 CACCTGAGGCAGCAGGGACTAGG - Intronic
1189056261 X:37702149-37702171 CACCTGAAGCTGCTGGAGAGAGG + Intronic
1190562346 X:51697689-51697711 AACCTGAATGAGCTGGGAATCGG + Intergenic
1193311655 X:80016920-80016942 CACCTGAAGCTGGGGGGCAGAGG + Intronic
1195505132 X:105647572-105647594 CACCTTCAGCAGCTAGGCTTAGG + Intronic
1196044851 X:111246370-111246392 TACCTCCAGCAGCTGGACATGGG - Exonic
1196504956 X:116430918-116430940 CACCTAAATCAACTGGGCAATGG - Intergenic
1198774571 X:140166085-140166107 TACATGACGCAGCTGGGCAATGG - Intergenic