ID: 902383688

View in Genome Browser
Species Human (GRCh38)
Location 1:16064625-16064647
Sequence TTGGGTTGCCAGGATGCTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902383688 Original CRISPR TTGGGTTGCCAGGATGCTGA CGG (reversed) Intronic
902378346 1:16040895-16040917 TTGGGCTGCTGGGGTGCTGACGG - Intergenic
902383688 1:16064625-16064647 TTGGGTTGCCAGGATGCTGACGG - Intronic
903189909 1:21650732-21650754 TTGGCTGGCCAGGAAGCTCAGGG + Intronic
903548429 1:24141483-24141505 CTGGGTTGCAAGGAGGCTGGTGG + Intronic
905946249 1:41903824-41903846 TAGGGATGCAAAGATGCTGATGG - Intronic
906204703 1:43980466-43980488 TTGGGCCCCCCGGATGCTGAGGG + Intronic
906836606 1:49089750-49089772 TTTGGTGGCCAGGATGATGCTGG - Intronic
915667141 1:157455520-157455542 ATGGGATGCCATGAGGCTGAGGG + Intergenic
915819597 1:159007816-159007838 TTGGGTCTTCTGGATGCTGAGGG - Intronic
919281562 1:195496071-195496093 TTGGTTAGCCAGGATGTTGCTGG + Intergenic
920037965 1:203077682-203077704 TTGGGTTCCCATCATGCTGCTGG - Exonic
923039191 1:230307757-230307779 TTGGGTAGAGAGGATGCTCAGGG + Intergenic
923246334 1:232136358-232136380 TGGGGTTGGCAGGAGGCAGAGGG + Intergenic
923456685 1:234170877-234170899 TTGGCTTGCCAAGATCCTGAGGG - Intronic
924127186 1:240866883-240866905 TTGGGTTGCCAGGAGGATCCAGG + Intronic
1062990306 10:1808188-1808210 TTGGGTTCCCAGGACACTCACGG - Intergenic
1063240502 10:4164858-4164880 TTGGGGTGCTAGAATCCTGAAGG + Intergenic
1063966785 10:11352262-11352284 TGTGGTTGCCAGGATGATGCAGG + Intergenic
1064675404 10:17755380-17755402 TGAGGTTGGGAGGATGCTGATGG + Intronic
1065700217 10:28417845-28417867 GGGTCTTGCCAGGATGCTGATGG - Intergenic
1065833999 10:29640650-29640672 TTGGGTGGCCAAGTTGCCGATGG - Intronic
1069703650 10:70443358-70443380 TTGGGTTCCAACGATGATGATGG - Intronic
1070729913 10:78819549-78819571 TAGGGCTGTCAGGATGCTGTAGG + Intergenic
1071991018 10:91100932-91100954 ATGGGTTAGCAGGAGGCTGAGGG + Intergenic
1073071249 10:100794569-100794591 ATGGGTAACCAGGATGGTGAGGG - Intronic
1073541100 10:104316543-104316565 TTTGGTTGCTAGGTTGCTGAGGG + Intronic
1073635041 10:105189177-105189199 ATGGGTAGCCAGCAAGCTGAGGG - Intronic
1074209134 10:111312444-111312466 TTTGGCTGCCAGGAAGCTCAAGG + Intergenic
1075759600 10:124846041-124846063 TTGGTTTGCCAGGATCCTCCTGG + Intergenic
1076350794 10:129813965-129813987 CTGGGTTGCCAGGATAGTAAGGG + Intergenic
1077134800 11:993163-993185 TGGGGTCTCCAGGAAGCTGAGGG + Intronic
1077598591 11:3556408-3556430 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1080892000 11:36417148-36417170 TTGGGTACTCATGATGCTGAGGG - Intronic
1084163532 11:67364388-67364410 GTGGGTTGCCAGGCTGGGGAGGG - Exonic
1084254673 11:67932280-67932302 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1084571438 11:69962374-69962396 TTGGGTGGCCTGGATGCGGGAGG - Intergenic
1084818200 11:71663607-71663629 TTGGGATGTGAGGATGCTGCAGG + Intergenic
1088114918 11:106302887-106302909 TTGGGTTGCCATGAGGTGGAGGG + Intergenic
1090688262 11:129149260-129149282 TTGGTTAGCCAGGATGTTGTGGG - Intronic
1091288836 11:134425390-134425412 CTGGATTGCCAGGAGGCTGGGGG - Intergenic
1092424739 12:8365759-8365781 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1096132692 12:49173001-49173023 TTGGGTGTCCAGGATATTGAAGG - Intergenic
1097665389 12:62472169-62472191 TTGGATTGACTGGATGATGATGG + Intronic
1097753800 12:63386956-63386978 TCAGGTTTCCAGGCTGCTGAGGG + Intergenic
1098239612 12:68453441-68453463 TTAGGTTGTCAGGATTCTGAAGG - Intergenic
1099012559 12:77309316-77309338 TTGGGCTTCGTGGATGCTGAGGG + Intergenic
1099234228 12:80063323-80063345 TTGTGTAGCCAGTATGCAGATGG + Intergenic
1100475150 12:94928603-94928625 TTGCGTTGCCAGGTTGCACAGGG + Intronic
1107032686 13:35869475-35869497 TTGGATTGCAAGGACACTGATGG + Intronic
1107084067 13:36406629-36406651 TAGGGTTTCCTGGATGCTGCAGG + Intergenic
1115314291 14:32009976-32009998 TGGGGGTGCCAGGGTGCAGAAGG + Intronic
1115334401 14:32230715-32230737 TTGTGTTGTCAGGATGGGGATGG - Intergenic
1117904139 14:60566701-60566723 CTGGGTTGACAGGATGAGGAAGG + Intergenic
1122070003 14:99200185-99200207 TTGGGAATCCAGGATGCTGCAGG + Intronic
1122344763 14:101051595-101051617 GTAGGTAGCCTGGATGCTGAGGG - Intergenic
1202923698 14_KI270724v1_random:5841-5863 TTGGGCTGCCAAGAAGCAGAAGG - Intergenic
1128616557 15:69114978-69115000 TTCTGCTGCCAGGCTGCTGAAGG - Intergenic
1130135255 15:81176840-81176862 CTGGGCTGCCAGGATGTTGGGGG - Intronic
1130225776 15:82057455-82057477 TTGTGGTGCAGGGATGCTGAGGG - Intergenic
1131075346 15:89492055-89492077 TTGGGTTGGCAACTTGCTGAGGG + Intronic
1132472830 16:116117-116139 TAGTGTTTCCAGGATGCTGTAGG - Intronic
1133390416 16:5405673-5405695 TTTGGGTGGCAGGATGCTCATGG + Intergenic
1134564362 16:15238239-15238261 CTGAGTGGCCAGGATGCTCAGGG + Intergenic
1134738133 16:16518460-16518482 CTGAGTGGCCAGGATGCTCAGGG - Intergenic
1134929367 16:18193703-18193725 CTGAGTGGCCAGGATGCTCAGGG + Intergenic
1136095701 16:27954518-27954540 TTTGATTCCCAGAATGCTGATGG + Intronic
1136178219 16:28533171-28533193 CTGAGTTACCAGGATGCTGCTGG - Intronic
1137910055 16:52368816-52368838 ATGGGTTGCAAGGGTGGTGAAGG - Intergenic
1137932379 16:52601417-52601439 TTGGGTTGCTTGAATGCTCAGGG - Intergenic
1141656655 16:85420330-85420352 TTGGGTGTCCAGGATCGTGAGGG + Intergenic
1141855162 16:86676297-86676319 TTGTGTTTCCAGGCTGCTGAGGG + Intergenic
1144853801 17:18257427-18257449 GTGAGTTGCCAGTGTGCTGATGG - Intronic
1146378473 17:32311106-32311128 TTGGGTGAGCAAGATGCTGAGGG + Intronic
1146581772 17:34044832-34044854 ATGGGATGCCAAGATGATGAGGG - Intronic
1149346966 17:55748708-55748730 TTGGATTGCCTGTATGATGATGG + Intergenic
1151702786 17:75752315-75752337 CTGGGTGGCCAGGTTGATGATGG - Exonic
1153588077 18:6644572-6644594 TTGGTTTCACAGGATACTGATGG - Intergenic
1155373911 18:25135413-25135435 TTGGGTTGGAAGGATGATGGGGG + Intronic
1156529948 18:37805794-37805816 CTGGGTTGCCAGGATCCTTGTGG + Intergenic
1157169882 18:45393519-45393541 TTGGGTTTCCATGATGCACAGGG - Intronic
1160533067 18:79576790-79576812 TTGGGTGGGCAGGATGCCCAGGG - Intergenic
1160862293 19:1242511-1242533 GTGGGCCGCCAGGATGCCGAAGG - Exonic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1162475483 19:10896879-10896901 GTGGGTGGCGAGGATGCTGAGGG + Intronic
1163009150 19:14413783-14413805 TGGGGCTGCCAGGATGCTGGTGG + Intronic
1163248226 19:16110638-16110660 TTGGGAAGCCAGGAGGTTGAGGG - Intergenic
1164564849 19:29318493-29318515 TTGGGATTCCAGGGTGCAGATGG - Intergenic
1165383376 19:35496075-35496097 CTGTGTTTCCAGGATGCAGAGGG - Intergenic
1165906609 19:39198124-39198146 TTGGAGGGCCAGGTTGCTGAGGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
925332437 2:3069154-3069176 GGGGGTTGCCAGGAGGCTGGGGG + Intergenic
926401229 2:12499164-12499186 TTGGTTTGTCAGGATGCTCCTGG - Intergenic
926819158 2:16833931-16833953 TTGAGATGTCAGGAGGCTGAGGG + Intergenic
926932310 2:18052813-18052835 TCGTGTTTCCAGGATGCTCAGGG + Intronic
927726363 2:25426659-25426681 TTGGTTCTCCAGGATGCAGATGG + Intronic
927890069 2:26742592-26742614 TTGGGGCTCCAGGATGCTGAGGG + Intergenic
929783582 2:44973389-44973411 TGGAGTTGCCAGGAGCCTGAGGG - Intergenic
933691483 2:85182366-85182388 CTGGGGTGCCAGGGAGCTGAGGG + Intronic
934525786 2:95050754-95050776 GGGGGATGCCAGGATCCTGAGGG - Intronic
934545229 2:95208670-95208692 TTGGGTTTCCAGCATGGAGAAGG - Exonic
934779437 2:96960430-96960452 TTGCCTTGCCAGGATGCTGGTGG - Exonic
937936412 2:127249194-127249216 CTGGAATGCCAGGATTCTGAGGG + Intergenic
938119690 2:128624831-128624853 CTTGGTAGCCAGGATCCTGATGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938541821 2:132289293-132289315 GTGTGTTGCAAGGATGCTGCTGG - Intergenic
939040361 2:137181763-137181785 TTTGTTTGCCATGATGATGAGGG - Intronic
940322819 2:152395234-152395256 CTGGGTTGCCATGGTGCTGTGGG + Intronic
940861884 2:158779208-158779230 TGGGGTCTCCAGGATGCTCAGGG + Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941308387 2:163898352-163898374 TTGTGTTGGCAGGATTGTGATGG - Intergenic
943943561 2:194029478-194029500 CTGGTTAGCCAGGATGTTGAAGG - Intergenic
944858617 2:203792497-203792519 TTTGGTTCCCAGGAGGCTGAAGG + Intergenic
945197327 2:207249543-207249565 TGGGGTTGCCAGTTTGGTGACGG - Intergenic
946662808 2:222019276-222019298 ATGGATGGCCAGGAGGCTGAGGG + Intergenic
946865828 2:224039902-224039924 CTGGGTTCCCAGGACGCTGCGGG - Intergenic
947127998 2:226891950-226891972 TCTGGCTGCCAGGAAGCTGAGGG + Intronic
947330551 2:229025202-229025224 TGGGGTGGGCAGGGTGCTGATGG - Exonic
1169397866 20:5250836-5250858 CTGGTTAGCCAGGATGCTGCAGG + Intergenic
1169924152 20:10765664-10765686 TTGGGTGGCTAGGAGGGTGATGG + Intergenic
1171209361 20:23304860-23304882 TTGGGGAGGCAGGATGCTGGTGG - Intergenic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1173270954 20:41534393-41534415 TTGGGTAACCAGCATACTGAAGG - Intronic
1174134350 20:48368754-48368776 CTGGTTTGCCAGGATGCAGGAGG - Intergenic
1175155872 20:56971221-56971243 TTGGGACCCCAGGATGGTGAGGG - Intergenic
1175574048 20:60047067-60047089 TTATTTTGCCTGGATGCTGAAGG + Intergenic
1177797875 21:25798180-25798202 TTTGGTTTTCAGTATGCTGATGG - Intergenic
1178595259 21:33947690-33947712 ATGGCTTGCCAGGTGGCTGATGG + Intergenic
1178859159 21:36274685-36274707 GTGGGTGGTCAGGATGGTGAGGG + Intronic
1179548054 21:42125344-42125366 GAGGGTGGCCAGGAAGCTGAGGG + Intronic
1181361326 22:22339503-22339525 TTGGATTGTTAGGATGCTGCAGG - Intergenic
1181744013 22:24943141-24943163 TTGGGTTGGCAAGATAGTGAGGG + Intronic
1183586239 22:38754865-38754887 TTGTGATGCCAGGATGCCGCAGG - Intronic
1184782480 22:46656113-46656135 TCGGGAGTCCAGGATGCTGAAGG + Intronic
949677415 3:6471912-6471934 TTGGGCTGCCTTAATGCTGAGGG + Intergenic
950253171 3:11483872-11483894 TTGTGTTCCCAGCATTCTGAGGG + Intronic
950751858 3:15135441-15135463 TTGGGATGTTAGGATGCTGCAGG + Intergenic
951173886 3:19576539-19576561 TTCGGTTGCCAGGAACATGAAGG - Intergenic
951418254 3:22451190-22451212 TTGGGGAGCCAGAATGCAGATGG + Intergenic
951796279 3:26542198-26542220 TTGGTTTGCTAGGAAGCTGTGGG + Intergenic
954501818 3:51024889-51024911 TTGGTTTGCCAGGGTGTTGCAGG + Intronic
955103456 3:55874116-55874138 TTTGGTTTCCAGGAAGCTGAAGG - Intronic
957068755 3:75548863-75548885 TTGGGATGTGAGGATGCTGCAGG - Intergenic
958931259 3:100210418-100210440 TGGGGTTGGCAGGATGAGGAAGG + Intergenic
960684131 3:120280177-120280199 ATGGGTTGCCAGGCAACTGAGGG - Intronic
963771268 3:149388728-149388750 TGGGGTGGCCAGGAGGCAGAGGG + Intergenic
965693040 3:171377971-171377993 TGGGGTTACGGGGATGCTGAAGG + Intronic
967899756 3:194437380-194437402 TGTGGTTGCCAGGGTGCTGGGGG - Exonic
969013083 4:4083400-4083422 TTGGGATGTGAGGATGCTGCAGG - Intergenic
969453876 4:7290114-7290136 CTGGGCTGGCAGGAAGCTGATGG + Intronic
969676582 4:8617737-8617759 GTGGGGTCCAAGGATGCTGAAGG - Intronic
969683881 4:8658175-8658197 TAGGGTTGCCAGGAGGCTTGAGG - Intergenic
969740760 4:9024390-9024412 TTGGGATGTGAGGATGCTGCAGG + Intergenic
969800099 4:9557222-9557244 TTGGGATGTGAGGATGCTGCAGG + Intergenic
970172971 4:13307561-13307583 TTTGGTTGCCTGGATGCTCAGGG - Intergenic
974395743 4:61332883-61332905 TTGGGTTGCTGGCATGGTGAAGG + Intronic
975508165 4:75162299-75162321 TTGGGATGCCAAAAAGCTGAAGG + Intergenic
978372939 4:108047265-108047287 GAGGGTTGCCAGGATTCAGATGG - Intergenic
980114211 4:128663725-128663747 TTGGGTGTTCAGGCTGCTGAAGG + Intergenic
981923846 4:150116774-150116796 TTGGTTAGCCAGGGTGATGAAGG + Intronic
983056661 4:163104752-163104774 TTGCTTTGCCAGGATTCTTATGG - Intergenic
984923049 4:184782798-184782820 TGGGGTCGACAGGATGCAGAAGG - Intronic
986396156 5:7332952-7332974 CTGGGTTTCCAGCTTGCTGATGG - Intergenic
992414425 5:76539129-76539151 TTGGGCTGCCAGGCAGCTGATGG - Intronic
992461332 5:76963225-76963247 TGGTATTGCCAGGATGTTGAGGG + Intronic
994776439 5:104040442-104040464 TTGGTTTGCCAGCTTGCAGAAGG + Intergenic
995533109 5:113110346-113110368 TGAGGATGCCAGGATGCTCAAGG - Intronic
997546624 5:134713365-134713387 TAGGGGTGTCAGGATGGTGAGGG - Intronic
997571043 5:134927794-134927816 TTGGCTTGCCATGATTGTGAGGG + Intronic
1000670332 5:164054220-164054242 TGTGGTTGCCAGGATGAGGATGG - Intergenic
1002520138 5:179788212-179788234 TTGTGTTTCCAGGCTCCTGATGG - Intronic
1004156456 6:13172455-13172477 TCAGGTTACCAGGAGGCTGAAGG + Intronic
1005719738 6:28589699-28589721 TTGGGTTTCCACGTTGCTGCTGG - Intronic
1006104344 6:31707575-31707597 TTGGGCTACCAGGGTGGTGAAGG - Exonic
1011520344 6:88197502-88197524 TTGGGTCACAAGGATGCTGGTGG + Intergenic
1016760994 6:147737467-147737489 TTGTTTTGCCAGAATACTGAAGG + Intronic
1018202675 6:161410187-161410209 GTGGGTGGCCAGGAATCTGAAGG + Intronic
1018639232 6:165891476-165891498 TGAGGTTTCCAGGACGCTGAGGG - Intronic
1019212845 6:170420471-170420493 GAGGGTTGCCAGGGTGCTGTGGG + Intergenic
1019446117 7:1072187-1072209 GTGGGCAGCCAGGATGCTTACGG - Intronic
1021477930 7:21084028-21084050 TTGGGTTGCTAATATGCTTAAGG + Intergenic
1022307309 7:29159336-29159358 CTGTGATGCCAGGATGCTGCAGG - Intronic
1023740504 7:43277024-43277046 TTGGATTTTCAGGATGCTCAGGG + Intronic
1025799671 7:64774074-64774096 CTGGGTTACAAGGATGCTGCTGG + Intergenic
1029071736 7:97905037-97905059 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1029701844 7:102252341-102252363 TTGGAATGCCAGCCTGCTGAAGG - Exonic
1029963949 7:104718541-104718563 CTGGCTTACCACGATGCTGAGGG - Intronic
1032873365 7:136010756-136010778 TTGGGTATCCTGGATGCTGGAGG + Intergenic
1033462717 7:141562184-141562206 TTGGTTAGCCAGGATGTTGCAGG + Intronic
1036079591 8:5540517-5540539 TTAGGTTCCCTGGATGCAGACGG - Intergenic
1036245965 8:7116957-7116979 TTGGGATGTGAGGATGCTGCAGG + Intergenic
1036888305 8:12577070-12577092 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1037854453 8:22360880-22360902 TTTTGTTACCAGCATGCTGAAGG + Intergenic
1039293511 8:36124402-36124424 TTCGGGTGTCAGGATGGTGATGG + Intergenic
1041718727 8:60956879-60956901 TTGGTGTGACAGGATGCTAAAGG - Intergenic
1042359546 8:67867332-67867354 TTGGGATGCCATCAGGCTGAGGG + Intergenic
1042850582 8:73212253-73212275 TTGGGTAGACAGGATGAGGAAGG - Intergenic
1044466216 8:92509569-92509591 TTTAGTTTCCAGGATGCTGGAGG - Intergenic
1045014313 8:97986437-97986459 TTGGGGTGGGAGGATGGTGAGGG - Intronic
1046724489 8:117659555-117659577 ATCGTTTGCCAGGATGCTTAAGG + Intergenic
1056620739 9:88211532-88211554 TTCCGTTCCCAGGATTCTGAAGG - Intergenic
1056709362 9:88978167-88978189 TGGGCTTGACAGGAAGCTGATGG - Intergenic
1056844252 9:90023772-90023794 TTGGGCTGCCAGGAGGGGGACGG - Intergenic
1059015485 9:110510988-110511010 CTGTGTTGCCAGGATTCTGAGGG - Intronic
1059583296 9:115576435-115576457 TTGGGTGGACTGGATGATGATGG - Intergenic
1060873258 9:127059793-127059815 TTTGGTTTCCAGGAAGATGATGG + Intronic
1202630300 M:10980-11002 TTGGCTTGCCATGATTGTGAGGG - Intergenic
1186037238 X:5437813-5437835 TTGGCTACTCAGGATGCTGATGG - Intergenic
1188469843 X:30525839-30525861 TTGGGTCTCCAGGTTGCAGACGG - Intergenic
1188566985 X:31537779-31537801 CTGGCTTGGCAGGATGCAGAAGG - Intronic
1191608541 X:63086905-63086927 TTGAGGTGCAAGGATGCTGGGGG - Intergenic
1192886271 X:75337713-75337735 CTGGTTAGCCAGGATGCTGCAGG + Intergenic
1194113099 X:89861468-89861490 TTTGGTTACCAGGATAATGATGG - Intergenic
1196703488 X:118696809-118696831 TTGGGTTGGGGGGATGCTGCCGG + Intergenic
1198673417 X:139106219-139106241 TGGAGTTGCCAGGAGGCTTAAGG - Intronic
1200465748 Y:3516299-3516321 TTTGGTTACCAGGATAATGATGG - Intergenic
1201691711 Y:16774666-16774688 CTGGGTGGCCACCATGCTGATGG + Intergenic