ID: 902385155

View in Genome Browser
Species Human (GRCh38)
Location 1:16072222-16072244
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 835
Summary {0: 2, 1: 0, 2: 4, 3: 92, 4: 737}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902385155 Original CRISPR CTGGGGAAGGGGAAGGTACA GGG (reversed) Intronic
900117631 1:1035207-1035229 CTGGGCAAAGGGATGGGACAGGG + Intronic
900135543 1:1115668-1115690 CTGGGGAGGGGAAAGGTTCCCGG - Intronic
900140135 1:1136391-1136413 CGAGGGAAGGGGAAGGGACAGGG + Intergenic
900175698 1:1290524-1290546 CTGGGGCAGCGGGAGGTACAGGG - Exonic
900620157 1:3583076-3583098 TTGGGGAAAGGGAGGGTGCAAGG + Intronic
900656340 1:3760265-3760287 TTGGGGAATGGAAAAGTACATGG - Intronic
901212393 1:7534037-7534059 CTGGGCAAGGGCAGGGTTCAGGG - Intronic
901659464 1:10789327-10789349 CTGGGGAAGTGGCAGGCCCAGGG - Intronic
902300982 1:15502581-15502603 CTGGGGAAGGTGAAGTGGCAGGG + Intronic
902385155 1:16072222-16072244 CTGGGGAAGGGGAAGGTACAGGG - Intronic
902601275 1:17541150-17541172 TGGTGGAAGGGGAAGGGACAGGG - Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902826067 1:18975152-18975174 CTGCGGAAGGTGAAGCTACAGGG - Intergenic
903189268 1:21647708-21647730 CTGGGGTAGGGGAAAGAGCATGG - Intronic
903363246 1:22790378-22790400 CTGGGGTTGGGGAGGGAACAGGG - Intronic
903557859 1:24206398-24206420 CTGGGGCTGGGGAAGGGAGAGGG - Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904126272 1:28241906-28241928 CTGGGGGAGTGGGAGGTACATGG + Intronic
904268094 1:29329437-29329459 CCGGGGCAGGGGGAGGTCCATGG - Intergenic
904419812 1:30384366-30384388 GTGGGGAGGGGGAAGGTGCCAGG + Intergenic
904497094 1:30893144-30893166 CTGAGGGTGGGGAAGGTGCAGGG + Intronic
904922535 1:34020272-34020294 CTTGGGAAGTGGAGGGGACAGGG - Intronic
904935819 1:34128818-34128840 CTAGGGATGGGGGAGGTTCAAGG + Intronic
904985798 1:34547434-34547456 CTTGGGTAGGGGAAGGGGCAGGG + Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905263679 1:36736589-36736611 CTGGGGGAGGGGAGGTGACAAGG + Intergenic
905709584 1:40089834-40089856 CTGGGGGAGGGGAAGGAAATGGG - Intronic
905862054 1:41358347-41358369 CTGGAGGAGGGGAAGTGACAGGG + Intergenic
905898934 1:41567834-41567856 CTGGGGAAGGTGAAGTCAGATGG - Intronic
905942436 1:41874837-41874859 CTGGAGAAGGGAAAGGTAGCTGG - Intronic
906282871 1:44566111-44566133 CTGGGGAAGGGCAAGCTAGGGGG - Intronic
906326281 1:44848111-44848133 CTGAGGAAGGGGGAGGCCCATGG - Intergenic
906542288 1:46596527-46596549 CTGGGGAAGTAGAAAGCACAGGG + Intronic
906710359 1:47924829-47924851 CTGGGGATGGGAAAGGTGCAGGG + Intronic
907286040 1:53380346-53380368 CTGGGGAATGGGGAGGCAAATGG + Intergenic
907467862 1:54651441-54651463 CTGGGGAAGGGGAGTGGAGATGG + Intronic
907470505 1:54670692-54670714 CTGGGCAAGGGGAGGGGAAAAGG - Intronic
907621291 1:55983455-55983477 AAGGGGAAGGGGAAGGGGCAGGG + Intergenic
907766117 1:57412212-57412234 CAGAGGAAGGGGAAAGTAGACGG - Intronic
908112462 1:60910835-60910857 AAGGCGAAGGGGTAGGTACAGGG - Intronic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
909506095 1:76391582-76391604 AAGGGGAAGGGGAAGGTGAAAGG - Intronic
911155040 1:94628526-94628548 CTGGGGTAGGGGCAGGGGCAGGG + Intergenic
911897261 1:103452388-103452410 CTGGTGGAGGGGAAGGTTCCTGG - Intergenic
912981727 1:114380002-114380024 CTGGTGAATGGGGAGGTAAATGG - Intergenic
913132242 1:115851301-115851323 CTGGGGATGGGGAAAATCCATGG - Intergenic
913531303 1:119736067-119736089 GTGAGGAAGGGGAAAGGACATGG + Intronic
913550445 1:119912512-119912534 GTGGGGAAGGGAAAGGTATGAGG - Exonic
914815824 1:151061296-151061318 ATGGGGAAGGGGGAAGGACAAGG - Intronic
915004416 1:152623246-152623268 CTGGGGAAGGGGAATGCAAACGG + Intergenic
915131390 1:153697843-153697865 CTGGGGCATGGGAGGCTACAGGG - Intergenic
915147957 1:153806490-153806512 CTGGGGAAGGGGAGGGGGTAGGG - Exonic
915399484 1:155611898-155611920 CTGGGGAAGGGCAGGGAAGATGG - Intronic
915416597 1:155747478-155747500 CTGGGGAAGGGCAGGGAAGATGG - Intergenic
915555342 1:156657970-156657992 CCGGGGAAGGGGAAAGGAGAGGG - Intronic
915882527 1:159687137-159687159 CTGGCCAAGGGGAAGGGCCATGG - Intergenic
916526275 1:165612278-165612300 CTGGGGTAGGTGTGGGTACAGGG + Intergenic
916801828 1:168223108-168223130 TAGGGGAAGGGAAAGGGACAAGG + Intergenic
916934004 1:169609185-169609207 ATGGGGAAGGGTAATGGACAAGG - Intronic
917429769 1:174953885-174953907 TTGGGCAAGGAGTAGGTACAAGG + Intronic
917452884 1:175161855-175161877 ATGAGGAAGAGGAAGGTAGAAGG - Intronic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
918211596 1:182356280-182356302 TTGGGGAAAGGGATGGTAAAGGG + Intergenic
918733950 1:188035553-188035575 CTGGGAATGAGGAATGTACAAGG - Intergenic
919090748 1:192976685-192976707 CTGGGGAAGGGGAATGTCAAAGG - Intergenic
919708672 1:200704511-200704533 CTGAGGAAGGGGAAGACATAAGG - Intergenic
919739756 1:200974492-200974514 CAGGGGAGGAGGAAGGTACTGGG - Intronic
920070073 1:203296453-203296475 CTGGGGAAGGGGAAGAGACGTGG - Intergenic
920748006 1:208647195-208647217 AGGGGGAAGGGGAAGGGAGAGGG - Intergenic
920771717 1:208892787-208892809 CTGGGGGTGGGGAAGAGACAGGG - Intergenic
921263015 1:213400526-213400548 CTCTGGAAGGGGCAGGGACAGGG - Intergenic
921973180 1:221173346-221173368 GTGGGGGGGGGGAGGGTACATGG + Intergenic
922207342 1:223459979-223460001 CTGGGGAAGAGGAAACTGCAAGG - Intergenic
923119794 1:230979136-230979158 CAGGGGAAGGGGAACGTGGATGG + Exonic
923373896 1:233340591-233340613 CAGGGGAAGGGGGAGGCAGATGG + Intronic
924120259 1:240790154-240790176 CTGGGGAGGTGGAAGTTGCAGGG + Intronic
924583108 1:245338776-245338798 TTGGGGATGGTGAATGTACAGGG - Intronic
924589758 1:245392619-245392641 CAGGGAAAGGGGAAGGGAGAGGG - Intronic
1063403944 10:5774886-5774908 CAGGGGAAGGGGAAGGGCAAGGG + Intronic
1063482333 10:6386631-6386653 GTGAGGAAGGGGAAGGCCCAGGG - Intergenic
1064075956 10:12269019-12269041 CTGGGCAGGGTGAAGGCACACGG - Intergenic
1064294146 10:14062855-14062877 CAGTGAAAGGGGAAGATACATGG + Intronic
1065031377 10:21589897-21589919 AAGGGGAAGGGGAAGGGAAAGGG - Intronic
1065212922 10:23422203-23422225 CTGGGAATGGGGAAAATACAAGG + Intergenic
1065232441 10:23612230-23612252 CTGGGGAAGGGGCATGACCATGG + Intergenic
1066023395 10:31325648-31325670 ATGGGGGAGGGGAAGGGAGAGGG - Intronic
1066080795 10:31928813-31928835 CTGAGGGAGGGTAAGTTACAGGG + Intronic
1066609320 10:37222259-37222281 CTGGGGAAGGTGAAGAAACATGG - Intronic
1066746456 10:38606480-38606502 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1067062463 10:43084847-43084869 TGGAGGAAGGGGAAGGTGCAAGG + Intronic
1067223938 10:44363328-44363350 CCTGGGAAGGGGAAAGGACAAGG + Intergenic
1067713622 10:48670788-48670810 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1068182590 10:53541335-53541357 CTGAGGAAGGGGAAATAACAAGG + Intergenic
1069020787 10:63486101-63486123 GTGGAGAAGGGGAAAGTAAAGGG + Intergenic
1069152480 10:64981572-64981594 AAGGGGTAGGGGAAGGTACCAGG + Intergenic
1069441469 10:68432689-68432711 AGAGGGAAGGGGAAGGTCCAAGG + Intronic
1069535226 10:69248231-69248253 CTGGGGCAGTGGAAGGCACTTGG - Intronic
1069608647 10:69757528-69757550 CTGGGGAGAGGGCAGGCACAGGG + Intergenic
1069862132 10:71478385-71478407 CTGAGGAAGGGGAGGGCACTAGG - Intronic
1069911901 10:71765131-71765153 CTGGGGAAGGGGGCAGCACAGGG - Intronic
1069960277 10:72075276-72075298 CTGGGGCAGGGGTGGGGACAAGG + Intronic
1070313340 10:75289237-75289259 CTGGGGGAGAGGAAGGGCCAGGG + Intergenic
1070491049 10:76976952-76976974 TTGGAGAATGGGAAGGTACTAGG + Intronic
1070595566 10:77830551-77830573 CTGGGGAAGGGCAGGGTCCTCGG - Intronic
1070844158 10:79508151-79508173 CTGGAGGAGGGAAAGGTGCAAGG - Intergenic
1070929639 10:80252160-80252182 CTGGAGGAGGGAAAGGTGCAAGG + Intergenic
1071402119 10:85283647-85283669 ATGAGGAAGTGGAAGGTACGTGG + Intergenic
1071754950 10:88527240-88527262 CTGGGGATGGGGAAGGTTGCTGG - Intronic
1072453623 10:95558448-95558470 GCGGGGAAGGGGGAGGAACATGG + Intronic
1072645595 10:97251444-97251466 ACGGGGAAGGGGAAGGGAAAAGG + Intronic
1072686445 10:97540046-97540068 CTGAGGAAGGGGGAGGGGCATGG + Intronic
1072710592 10:97713625-97713647 GAGGGGAAGGGGAAGGGAAAGGG + Intronic
1074015473 10:109529902-109529924 CTGGGGAAGTGCAGGGAACAGGG + Intergenic
1074533956 10:114315496-114315518 TTGGGGAAGGGGCAGGGACAGGG - Intronic
1075282092 10:121147826-121147848 CAGGGGCAGGGGAAGAAACATGG + Intergenic
1075354033 10:121754799-121754821 TTGGGGAAGTGGAATGTACCAGG - Intronic
1075363777 10:121864232-121864254 GGGGAGAAGGGGAAGGTATAGGG + Intronic
1075585430 10:123653782-123653804 ATGGGGAAGGGGAAGGGAGAAGG + Intergenic
1075603551 10:123788324-123788346 CTGGTGAAGGGGGAGGTAAAAGG - Intronic
1075724585 10:124604881-124604903 CAGGGGCAGGGGAAGGGGCAGGG - Intronic
1075802342 10:125160925-125160947 CCGGGGAAGGAGAAGGAAAACGG + Intronic
1075984291 10:126770275-126770297 CTGGGGAAGAGGAAGGAGCCAGG - Intergenic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076409006 10:130232661-130232683 CTGGGGAAGGGGAAGAGACCGGG + Intergenic
1076760920 10:132605375-132605397 TGGGGGATGGGGAAGGGACAGGG + Intronic
1076760971 10:132605489-132605511 CTGGGGATGGGGAGGGGACAGGG + Intronic
1077019102 11:409654-409676 CTGGGGCAGGAGAGGGTGCAGGG + Intronic
1077226772 11:1442060-1442082 CTCGGGAAAGGGGAGGTGCAGGG - Intronic
1077243613 11:1524977-1524999 CTGGGGAAGGGGAAGGAAGGTGG + Intergenic
1077362728 11:2147888-2147910 CCGGGGAGGGGGATGGGACAGGG - Intronic
1077382563 11:2251090-2251112 CTGGGGAGGGATAAGCTACATGG + Intergenic
1077874677 11:6294111-6294133 CAGGGGCAGGGGAAGGGGCAGGG + Intergenic
1078106755 11:8362748-8362770 CTGAGGAAGGGGCAGCTTCAGGG - Intergenic
1078342158 11:10505408-10505430 CTGGGGATGGGAAAGGCAAAGGG - Intronic
1078447686 11:11416885-11416907 CTGGGGGAGGGGATGGGGCAGGG - Intronic
1078614314 11:12850864-12850886 TTGGGGAAGTGGCAGGGACATGG + Intronic
1079520167 11:21316843-21316865 CTGGGGAAGAGGCAGGGAAAGGG + Intronic
1079776497 11:24536959-24536981 CTGAGGAAGAGGAAGGCCCAAGG + Intronic
1080928745 11:36785226-36785248 CTGGGGAAGGGGATAGAACAGGG + Intergenic
1081006072 11:37741955-37741977 CTGGGGGAGGGGAGGGAACCTGG + Intergenic
1081198097 11:40185874-40185896 CACGGGAAGGGGGAGGGACAGGG - Intronic
1081702718 11:45162126-45162148 CTGGGGAAGGGCAGGGCCCAGGG - Intronic
1081870888 11:46382009-46382031 GTGGGGAAGGGGACGGGCCAGGG + Intronic
1082017269 11:47499682-47499704 CTGGGGAAGGGGTAGGGAAAGGG + Intronic
1082196805 11:49316270-49316292 AAGGGGAAGGGGAAGGGAAAAGG + Intergenic
1082986729 11:59175481-59175503 CTGGGGAAGGAGAAGGGCCCAGG - Intronic
1083656151 11:64230658-64230680 CAGAGGAAGGGGCAGGTCCAAGG + Exonic
1083670833 11:64299266-64299288 CTGGTGAAGGGGCAGGTTCCCGG + Intronic
1083795918 11:65016606-65016628 CTGGGGGAGGAGCAGGTTCAGGG + Intronic
1083929603 11:65833565-65833587 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1084329586 11:68422830-68422852 GTGGGGGAGGTGAAGGTACAGGG - Intronic
1084935442 11:72584314-72584336 CTGGGGAAGGGAGAGGGGCAAGG + Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085271042 11:75269987-75270009 TTGGGAAAGAGGAAGGGACAGGG + Intronic
1085507283 11:77067524-77067546 CTGGGGAAGGGGCAGGGCCGAGG + Intronic
1086132946 11:83420112-83420134 GTGGAGAAGGGGTAGGTATATGG - Intergenic
1086278698 11:85161084-85161106 CTGGGGAAGGGGTATGTGGATGG + Intronic
1086659020 11:89391916-89391938 AAGGGGAAGGGGAAGGGAAAAGG - Intronic
1086832615 11:91584035-91584057 CTGTGGGAGGGCAAGGAACAAGG - Intergenic
1087138666 11:94744524-94744546 CTGGGGAGGGGAAAGGGACTGGG - Intronic
1087959286 11:104327689-104327711 CAGGAGAAGGGGAAAATACAGGG + Intergenic
1088429598 11:109744635-109744657 CTGGGAGAGGGGCAAGTACAGGG + Intergenic
1088645629 11:111913985-111914007 TGGGGGAAGGGAAAGGTGCATGG + Exonic
1088746278 11:112807642-112807664 CAGGGGAAGTGGAAGTTAGAGGG + Intergenic
1089163521 11:116457672-116457694 CTGAGGAAGGGGAAGAGGCAGGG + Intergenic
1089224898 11:116910619-116910641 CTGGGAAAGAGAAAGGGACAAGG + Intronic
1089256210 11:117195642-117195664 ATCGGGAAGGGGTAGGGACAAGG + Intronic
1089615276 11:119691569-119691591 CTGGGGAAAGGGAAAGCCCAGGG - Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090436790 11:126693896-126693918 CTGGGGAAGGGGCAAGGACTAGG - Intronic
1091192428 11:133706847-133706869 AAGGGGAAGGGGAAGGGAAAGGG + Intergenic
1091710148 12:2734121-2734143 CAGGGGAAGGGGAAGGGAAAGGG + Intergenic
1092093370 12:5822282-5822304 CTGGGGAAGAGGTATGTAGATGG + Intronic
1092817240 12:12322940-12322962 GAGGGGAAGGGGAAGGGAGAAGG + Intergenic
1093078858 12:14786796-14786818 CTGGAGGAGGGGAAGAAACAGGG + Exonic
1094047377 12:26182558-26182580 AAGGGGAAGGGGAAGGGAGACGG - Intronic
1095818475 12:46450642-46450664 CTGGGGGATGGGCAGGGACAGGG + Intergenic
1096192221 12:49627357-49627379 TTGCCGAAGGAGAAGGTACATGG + Intronic
1096379717 12:51145941-51145963 GTGGGGAGGGGGAAGGGACAGGG - Intronic
1096540872 12:52306288-52306310 CTGGGAAAGGGAAAGGTCTATGG - Intronic
1096716225 12:53493083-53493105 GTGGGGAAAGGGAAGGGACACGG + Intronic
1096976664 12:55703186-55703208 ATGGGGCAGGGGCAGGGACAGGG + Intronic
1097548904 12:61041656-61041678 CTGTGGAATGGAAAGGTAGAGGG - Intergenic
1098555747 12:71816987-71817009 TTGGGGAAGGGGAGGGAAAAGGG + Intergenic
1099748090 12:86733357-86733379 CTTAAGAAGGGGAAGGCACAAGG + Intronic
1100825685 12:98472320-98472342 CTGGGGAAGGGGATGGGCCTGGG - Intergenic
1101686686 12:107030784-107030806 AGGGGGCAGGGGAAGGCACAAGG + Intronic
1102316063 12:111888596-111888618 CTGCGGAAGAGGAAGTTACTTGG + Exonic
1102562153 12:113769822-113769844 CCGGGAAAGTGGAATGTACAGGG - Intergenic
1102796667 12:115694993-115695015 ATGGGAAAGTGGAAGGAACATGG - Intergenic
1104910338 12:132237216-132237238 CTGGGGCAGCTGAGGGTACACGG - Intronic
1104986969 12:132602812-132602834 CTGGGGAAGGGGAAGGGGCCTGG + Intergenic
1105564385 13:21529894-21529916 ATGGAGAAGGGGAAGGATCAGGG + Intronic
1105759760 13:23503216-23503238 CTGGGGCAAGGGCAGGAACATGG - Intergenic
1106086873 13:26550731-26550753 GTGGGGAAGGGGAGGGTGCCTGG - Intergenic
1106128807 13:26922491-26922513 CTGGAGAAGGGGAAGGGCCTCGG - Intergenic
1107038207 13:35922313-35922335 ATGGGGAAAGGGAAGGTAATAGG - Intronic
1107069776 13:36257105-36257127 CTGGGGATAGGGGAGGTACCCGG + Intronic
1108530200 13:51321215-51321237 CTGGGGATGGGGTAGAGACATGG - Intergenic
1110121700 13:71889732-71889754 CTGGGGGACAGGAAGGTTCAGGG + Intergenic
1111859343 13:93682246-93682268 CTAGGGAAAGTGAAGGAACAAGG + Intronic
1112522375 13:100108150-100108172 CTAGGGAAGGGAAAGGAAGAAGG + Intronic
1112532202 13:100216053-100216075 GAGGGGAAGGGGAAGGGAAAGGG - Intronic
1113660361 13:112103424-112103446 CTTGGGAAGGAGGAGGTACAGGG - Intergenic
1113960140 13:114121647-114121669 CTGGGGAAGCCGAAGGTCAAAGG - Intronic
1115900772 14:38145066-38145088 CTGGAGAAGGAGAAGTTACCTGG + Intergenic
1117409510 14:55438557-55438579 ATGGGGAAGGGGAAGGGGAAGGG - Intronic
1118082525 14:62377743-62377765 CTGGGGAAGGGACAGGTACAGGG - Intergenic
1118723412 14:68609751-68609773 CTGGAGAAGAGGAAGGTGAAAGG - Intronic
1118849760 14:69574323-69574345 CTGGGGATGGAGAAGGTGCCTGG + Intronic
1119655429 14:76413886-76413908 CAGGGGCAGGGGACGGTGCAGGG - Intronic
1119655480 14:76414028-76414050 CAGGGGCAGGGGACGGTGCAGGG - Intronic
1120188020 14:81414702-81414724 CTCGGGGAGGAGAAGGTACCAGG + Intronic
1120298196 14:82671781-82671803 CTGGGGAAGGGAATGACACAAGG + Intergenic
1120395877 14:83966365-83966387 TTTGGGAAGGGGAACGTAGAGGG - Intergenic
1121123766 14:91392982-91393004 CTGGGGAAGGAGAAACTGCAAGG + Intronic
1121291161 14:92776699-92776721 CTGGGGTGGGGGAAGGAATATGG + Intergenic
1121593360 14:95137482-95137504 ATAGGGAAGGGGAAGGGAAAGGG + Intronic
1121593367 14:95137500-95137522 AAGGGGAAGGGGAAGGAAAAGGG + Intronic
1121593385 14:95137555-95137577 ATGGAGAAGGGGAAGGGAAAGGG + Intronic
1121732379 14:96195448-96195470 CTTGGGAGGGGGAAGGTGCAGGG + Intergenic
1121965124 14:98296747-98296769 CTGGTGAAGGGGAGGTCACATGG - Intergenic
1122059022 14:99124412-99124434 GTGGAGAAGGGGAAGGTGCATGG - Intergenic
1122079550 14:99257376-99257398 CTGGTGCAGGGGAAGGCCCAGGG - Intronic
1122082515 14:99275113-99275135 CTGAGGCAGGGGTGGGTACATGG - Intergenic
1122154549 14:99742378-99742400 CTGGGGATGGAGAAGGTACATGG + Intronic
1122201270 14:100124052-100124074 GTGGGGAAGAGGAAGGGCCAAGG + Intronic
1122203296 14:100135684-100135706 CTGGGGAAGGGGAAGGCTACAGG - Intronic
1122539017 14:102486543-102486565 CTGTGGAAGGGGCAGTTTCATGG - Intronic
1122631304 14:103108967-103108989 CTGGGGAAGGGGATGAACCAGGG - Intronic
1122920020 14:104876165-104876187 CTGGGGCAGGGGATGGAGCAGGG + Intronic
1123882655 15:24690103-24690125 CTGGAGAAGGGGTAGAGACATGG + Intergenic
1123915551 15:25022188-25022210 CTGGGGAAGGTGGATATACATGG + Intergenic
1124100695 15:26690083-26690105 CTGGAGAATGAGAAGGTACACGG + Intronic
1124366507 15:29075456-29075478 ATGGGGATGGGGTAGGTACAAGG - Intronic
1124486221 15:30119588-30119610 CTGGGGAAGGGAAAGGAAAGGGG - Intergenic
1124541295 15:30588573-30588595 CTGGGGAAGGGAAAGGAAAGGGG - Intergenic
1124630310 15:31332745-31332767 CTGGGGAAGGGCAAAAGACATGG + Intronic
1124757363 15:32419014-32419036 CTGGGGAAGGGAAAGGAAAGGGG + Intergenic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126575593 15:50193256-50193278 CAGGGGAAGGAGAAGGTATTTGG - Intronic
1126636622 15:50786295-50786317 CTGGGGAATAGGAAGCAACATGG - Intergenic
1126847001 15:52769662-52769684 CTGGAGAAGCAGAAGGCACAGGG + Intronic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1127671443 15:61198897-61198919 CTGGGTAAGGAGAATGGACAGGG - Intronic
1127857332 15:62963245-62963267 CTCAGGAAAGGGAAGGTAGAGGG - Intergenic
1128073703 15:64813014-64813036 CTGCGGAAGGGGAAGGGGCTGGG + Intergenic
1128346336 15:66854744-66854766 CTGGGGAAGGGGGAGGGGCCAGG + Intergenic
1128561104 15:68668275-68668297 CTGGGGAGGGGGGCGCTACAGGG + Intronic
1128755714 15:70182401-70182423 CAGGGGAAGGGGATGGCTCAAGG - Intergenic
1129025235 15:72565786-72565808 ATGGGGAATGGGAAGGAGCAGGG - Intronic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129167464 15:73786889-73786911 CTGGGTACTGGGAAGCTACACGG - Intergenic
1129332048 15:74832719-74832741 ATGGGGAGGGGGAAGGAAGAAGG - Intergenic
1129821156 15:78602835-78602857 ATGGGGGTGGGGAGGGTACAGGG - Intronic
1129988170 15:79936925-79936947 CTGGGGCTGGGAAAGGAACAAGG - Intergenic
1130533805 15:84768571-84768593 ATAGGGAAGAGGTAGGTACAGGG - Intronic
1130709679 15:86267448-86267470 CTGTTGAAGGGAAGGGTACATGG + Intronic
1130766614 15:86877534-86877556 CTGGGGAAGGGATAAGTAGAAGG + Intronic
1130770683 15:86920512-86920534 GTGGGGAAGGGGAAAACACAGGG + Intronic
1131131120 15:89901117-89901139 CAAGGTAGGGGGAAGGTACAAGG + Exonic
1131422574 15:92319618-92319640 CTGGGAAAAGGGAGGGGACAGGG - Intergenic
1131777999 15:95823189-95823211 CTGGGGAAGGGGAGGTGTCAAGG + Intergenic
1131990498 15:98088644-98088666 CTGGGGGAGGGGAAGGGGCCGGG - Intergenic
1132039185 15:98510889-98510911 CTGGGGCTGGGGAGGGTAGAAGG + Intronic
1132097237 15:98996727-98996749 CTGGGCAAGCAGAAGGTAAAGGG - Intronic
1132099646 15:99014653-99014675 CTGGGGGAGGGGAAGGGGCCGGG + Intergenic
1132240391 15:100253349-100253371 GTGAGGGAGGGGAAGGTAGAGGG + Intronic
1132240399 15:100253367-100253389 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240407 15:100253385-100253407 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240415 15:100253403-100253425 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240423 15:100253421-100253443 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240431 15:100253439-100253461 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240439 15:100253457-100253479 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132240454 15:100253493-100253515 GAGGGGGAGGGGAAGGTAGAGGG + Intronic
1132833794 16:1942636-1942658 CGGGGGAATGGGAAGGGCCAGGG + Intronic
1132940432 16:2504317-2504339 TGGGGGAAGGTGAGGGTACATGG - Intronic
1133233045 16:4375284-4375306 CTGGGAGAGGGGCAGGCACAGGG - Intronic
1133344034 16:5058442-5058464 CAGGGGAAGGGGAAGGAAAAAGG - Intronic
1133621596 16:7531895-7531917 CTGGGGAAGGGGATGGGTTAGGG - Intronic
1134149443 16:11794879-11794901 CTGGGGAATGGGAAGGAAAGAGG + Intronic
1134596575 16:15500527-15500549 TTGAGGAAGGGGAAGGTATCAGG + Intronic
1134770600 16:16806037-16806059 AGGGGGAAGGGGAAGGGAGAAGG - Intergenic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135436216 16:22428431-22428453 GTGGGGAAGGGGAGGTTCCAGGG + Intronic
1135809678 16:25576021-25576043 CTGGGGAAGTTGCAGGGACAAGG - Intergenic
1135924341 16:26679412-26679434 CTGGGGATGGGGTATGTCCAAGG - Intergenic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136234200 16:28904366-28904388 GTTGGGAAGGGGAATTTACAAGG - Exonic
1136736605 16:32473162-32473184 CTGGGGCAGGGGAAGGAAAATGG - Intergenic
1137566301 16:49534684-49534706 CTGGGGTAGGGGCATGGACATGG - Intronic
1137975939 16:53032315-53032337 GTGGGGAAGGAGTAGGGACAGGG - Intergenic
1138458804 16:57135954-57135976 AAGGGGAAGGGGAAGGGAGAAGG + Intronic
1139910075 16:70392231-70392253 CAAGGGAAAGGGAAGGAACATGG + Intronic
1141482928 16:84318690-84318712 CTGGGGGTGGGGGAGGTACCAGG + Intronic
1142045429 16:87922265-87922287 GTGGGGAAGGGGAGGTTCCAGGG + Intronic
1142388820 16:89784707-89784729 TTGGGGAAGGGGAAGGGGAAGGG + Intronic
1203016463 16_KI270728v1_random:356415-356437 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1203034798 16_KI270728v1_random:629573-629595 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1142610439 17:1106862-1106884 CAGAGCAAGGGGCAGGTACAGGG - Intronic
1143048339 17:4100966-4100988 GAGGGGAAGGGAAAGGGACAAGG + Intronic
1143513452 17:7408034-7408056 GTGGGGAAGGGGAAGGAAATGGG - Intronic
1143580770 17:7824386-7824408 CTGTAGAAGTGGGAGGTACAGGG - Intronic
1143593354 17:7899248-7899270 GTGGGGAGGGGGAAGATAAAGGG + Intronic
1144490399 17:15704125-15704147 CTGGGGTCGGGGAGGGTACAGGG - Intronic
1144508202 17:15851598-15851620 CAGAGGACGTGGAAGGTACAGGG - Intergenic
1144732608 17:17537305-17537327 CAGGGCAAGGGGAAGGCAAAGGG - Intronic
1144849865 17:18238616-18238638 CAGGGGCAGGGGCAGGGACAGGG + Intronic
1144910568 17:18677844-18677866 CTGGGGTCGGGGAGGGTACAGGG + Intronic
1145042876 17:19589900-19589922 CGGGGGAAGGGGCATGTGCAGGG - Intergenic
1145157543 17:20553198-20553220 CAGGGTAAGGGGAAGAAACAGGG + Intergenic
1145172325 17:20669232-20669254 CAGAGGATGTGGAAGGTACAGGG - Intergenic
1145788880 17:27611785-27611807 CCGGGAATGGGGAAGGAACAGGG + Intronic
1146283503 17:31559736-31559758 CTGGGGGAGGGGGAGGTGCGGGG - Intergenic
1146558821 17:33850595-33850617 CTGGGGGAGGGGATTGTTCATGG + Intronic
1146724839 17:35148434-35148456 CTGGGGCAGGGCAGGGCACAGGG + Intronic
1146954378 17:36928632-36928654 CTGGGGAGGTTGATGGTACAAGG - Intergenic
1147335233 17:39723610-39723632 CTGAGGAAGGTGAAGGTGCTTGG + Exonic
1147341100 17:39753816-39753838 TTGGGGTAGGGGAGGATACACGG + Intergenic
1147587461 17:41660612-41660634 CTGGGGGATGGGAAGCAACACGG - Intergenic
1147615100 17:41822871-41822893 CTAGGGAAGGGGAAGGCTCCTGG + Exonic
1147624699 17:41892495-41892517 CTGGGGAAGGGGAAGCTGAGGGG + Intronic
1147875838 17:43619839-43619861 CCGGGGAAGGGGTAGGGTCAGGG - Intergenic
1148382391 17:47209488-47209510 CTGGGGCAGGGGCTGGTGCAGGG - Exonic
1148741932 17:49897915-49897937 CTAGGGAAGGGGAAGGTGAGAGG + Intergenic
1150125290 17:62631009-62631031 CTGGGCAAGGTGAGGGTACATGG + Intronic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150280242 17:63925873-63925895 CTGGGGAGGGGGCAGGCAGAGGG + Intergenic
1150292316 17:63988776-63988798 CTGGGGGAGGGGCAGGGACGTGG + Intergenic
1150356911 17:64494813-64494835 CTGGGGTTAGGGAAAGTACAAGG - Intronic
1150422378 17:65049692-65049714 CTGGGGAAAGGGAGGGGGCATGG + Intronic
1150430510 17:65112024-65112046 CTGGGGAGGGGAGAGGGACAAGG - Intergenic
1150815559 17:68389605-68389627 CTGAAGAAGAGGAAGGGACAGGG - Intronic
1150824206 17:68460285-68460307 ATGGGGAAGGGGGAGGGGCAGGG + Intergenic
1151202960 17:72482390-72482412 CTGGTGAGTGGGAAGGTAAAAGG - Intergenic
1151278048 17:73050790-73050812 CTGGGGATGGGGGAGGTGAAAGG + Intronic
1151697279 17:75724072-75724094 CTGGGGCAGGCAGAGGTACAGGG + Intronic
1151995714 17:77607738-77607760 ATGGGGATGGGGGAGGTGCAAGG + Intergenic
1152027358 17:77819733-77819755 CGGGGGAAGGGGGAGGTTCTGGG + Intergenic
1152364104 17:79845091-79845113 GTGGGGAGGGGGAAGGGACGGGG - Intergenic
1152417336 17:80171146-80171168 GAGGGGAAGGGGAAGGTGAATGG - Intronic
1152802889 17:82340038-82340060 TTGGGGGAGGGCAAGGTAGAGGG - Intergenic
1152814068 17:82397343-82397365 CTGGGGACGGGTAAGGTAGTGGG + Intronic
1152944897 17:83193161-83193183 CTGGGGAGGGGCTTGGTACAGGG - Intergenic
1152960026 18:74031-74053 AAGGGGAAGGGGAAGGGAGAAGG + Intergenic
1155053080 18:22165092-22165114 CTGGGGAAGGTGGAGGTCCCCGG - Intergenic
1155382129 18:25235373-25235395 CTGGGGAAGCAGAAGGTAAAGGG + Intronic
1156490334 18:37492196-37492218 GTGGGGAATGGGAAGGTAGCAGG + Intronic
1157034496 18:43954643-43954665 CAGGGGAAGGAGTATGTACAAGG - Intergenic
1157331909 18:46710467-46710489 AAGGGGAAGGGGAAGGGAGAAGG - Intronic
1157847942 18:51021161-51021183 CAGGGGAATTGGGAGGTACAGGG - Intronic
1157849094 18:51030633-51030655 CGGGGGAAGGGGAGGGGACATGG - Intronic
1158859699 18:61580434-61580456 CAGGGGAAGGGGAAAGGAGAAGG - Intergenic
1158941128 18:62406567-62406589 CTGGGGGATGGGAAAGGACATGG - Intergenic
1159438698 18:68449823-68449845 CTGGGGAAGGTGAAGTTTCATGG + Intergenic
1159463715 18:68752407-68752429 CAGGGAAAGGGGAAGGGAAAAGG + Intronic
1159706991 18:71702855-71702877 CTGGGGAAGCAGAAGACACATGG + Intergenic
1160753250 19:745196-745218 CTGGGGAACTGGAGGTTACAGGG - Intronic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161104920 19:2438555-2438577 GTGGGGAGGGGCAAGGTCCATGG + Intronic
1161219296 19:3110684-3110706 CTGGGGAAGGGGCCGGAACCAGG - Intronic
1161698194 19:5782015-5782037 CTGGGGAAGGGGTAGGCTGAAGG + Intergenic
1161769894 19:6225435-6225457 CTGGGGAAGAGGCCGGTTCATGG + Intronic
1161957963 19:7506746-7506768 CTGGGGAAGAGGGAGGAACTGGG - Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162326668 19:10003659-10003681 CGGCGGAAGGGGAAGGGAAAAGG - Exonic
1162686184 19:12386479-12386501 AAGGGGAAGGGGAAGGGAAAGGG + Intronic
1162801496 19:13113232-13113254 CTGGGGAAGCGGAGGTTGCAGGG - Intronic
1162854486 19:13458029-13458051 CTGGGGAATGGCAAGGGAAATGG + Intronic
1163276635 19:16288636-16288658 CTGGGGTGGGGGAAGGGAAATGG - Intergenic
1163376156 19:16931736-16931758 CTGGGGATGGGGAAGCCAGATGG - Intronic
1163732168 19:18955460-18955482 CTGGGTGAGAGGAAGGGACAGGG - Intergenic
1164680556 19:30131195-30131217 AAGGGGAAGGGGAAGGGAGAAGG - Intergenic
1164840725 19:31390311-31390333 ATGGGGAGAGGGAAGGAACAGGG + Intergenic
1164917787 19:32065858-32065880 CTGGGGCAGGGGGAGGGCCAGGG + Intergenic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166617570 19:44264323-44264345 CTGGGGAAGGGCAGGGTCCTGGG - Exonic
1166705463 19:44905735-44905757 CTGGGGGAGGGGGCGGGACAGGG + Exonic
1166718199 19:44982588-44982610 CTGGTGGAGGGGGAGGCACAGGG - Intronic
1166746030 19:45142280-45142302 CTGGGGACGGGGAGGGGGCACGG - Intronic
1166929049 19:46290191-46290213 GTGGGGAAGGGGTAGGGAGAGGG - Intergenic
1166936917 19:46339637-46339659 CTGGGGGAGGAGAAGGCAGATGG - Exonic
1166954537 19:46454589-46454611 AAGGGGAAGGGGAAGGGATAGGG - Intergenic
1167067232 19:47195669-47195691 AAGGGGAAGGGGAAGGGAAAGGG - Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167294149 19:48639668-48639690 CTGGGGGAGGAGAAGGTTGAGGG - Intronic
1167421103 19:49403855-49403877 GTGTGGAGGGGGAAGGTAGAGGG - Intronic
1167585147 19:50370267-50370289 CTGGCGAATGGGTAGGTAAAAGG + Intronic
1167776957 19:51564720-51564742 CTGGGGTAGGAGAAGGAGCAGGG + Intergenic
1168275621 19:55276731-55276753 CTGGGGAAAGGTAAGCTAGAGGG + Intronic
1168300315 19:55401329-55401351 CTGGGGTCGGGGAGGGTACAGGG - Exonic
1168379076 19:55905113-55905135 CTGTGGAAGGTGCAGGTGCAAGG + Intronic
925307545 2:2861045-2861067 CTGGGAAAGGGGTAGGGCCAGGG + Intergenic
925309488 2:2872336-2872358 CTGGGGAAGGGGAGGGGACAAGG - Intergenic
925542878 2:4985268-4985290 CAGGGGAAGAGGAAGGGATAGGG + Intergenic
925548320 2:5041826-5041848 AAGGGGAAGGGGAAGGGAAAGGG - Intergenic
925601928 2:5616967-5616989 CATGGGAAGGGGAATGTATATGG + Intergenic
925886044 2:8394432-8394454 CTGGGCAGGGGGAAGGTGAAGGG - Intergenic
926049841 2:9737675-9737697 CTGGGGGAGTGGGAGGTACTGGG - Intergenic
926061504 2:9807761-9807783 CTGGGGCAAAGGAAGGCACAGGG - Intergenic
926268670 2:11347848-11347870 CTGGGAAAGGTGAAGGGACATGG - Intronic
926823538 2:16879733-16879755 CTGGGGAAGGGGATGGTTTTGGG + Intergenic
927179293 2:20433174-20433196 CTGGGCAAGGAGAATGTTCAGGG - Intergenic
927292631 2:21419911-21419933 CTGCGGCAGGGGAAGGGACAAGG + Intergenic
927333744 2:21896343-21896365 CTGGGGAGGGGGAAGGTTGGGGG + Intergenic
927619167 2:24634207-24634229 AAGGGGAGGGGGAAGGAACAGGG + Intronic
929552714 2:42904583-42904605 GTGGGGCAGGGGCAGGAACATGG + Intergenic
929630906 2:43460979-43461001 GTGGAGAAGGGGATGGCACAAGG + Intronic
929657223 2:43745915-43745937 CTGGAAAATGTGAAGGTACAAGG + Exonic
929818741 2:45257082-45257104 CTGTGGAAGCGGGAGGAACATGG + Intergenic
929934136 2:46282065-46282087 ATGGGGAAGGAGAAGGAACAAGG + Intergenic
930027862 2:47040332-47040354 CTGGGAAAGGGGAAGGAGCGTGG - Intronic
930536525 2:52651635-52651657 CTGGGGAAGAGGTATGTAGATGG - Intergenic
930735169 2:54770996-54771018 GTGGGGAAGTGGAAGGTCAAAGG + Intronic
931054160 2:58449992-58450014 CTGGGGAGGGGAAAGGTAGTAGG - Intergenic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
931502206 2:62881473-62881495 AAGGGGAAGGGGAAGGAAAAAGG + Intronic
931644189 2:64406527-64406549 CTGGGAAAGGGCAGGGTTCATGG + Intergenic
931983121 2:67715215-67715237 ATGGGGAAGGGAGATGTACAGGG - Intergenic
932050753 2:68395657-68395679 CTGGGGAAAGAGAAGGCAAATGG - Intronic
932413164 2:71559091-71559113 CTGGGGAAGGGGGAGGCTCCCGG - Intronic
932544064 2:72688528-72688550 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
932938036 2:76129174-76129196 CCGGGGAAGGGTCATGTACAAGG + Intergenic
933809530 2:86024351-86024373 CTGGGGAGGTGGAAGGAATAGGG + Exonic
933997495 2:87680423-87680445 CTGGAGGAGAGGAAGGCACATGG + Intergenic
934123574 2:88864056-88864078 CTGGGATGGGGGAAGGTAAAAGG + Intergenic
934187759 2:89762279-89762301 CTGGGGCAGGGGAAGGAAAATGG - Intergenic
934308858 2:91845669-91845691 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
934974870 2:98794383-98794405 TTGGGGAAGAGGAAGGAACCAGG - Exonic
935308439 2:101759717-101759739 GGGGGGAAGGGGATGGTAAAGGG - Intronic
936296357 2:111270489-111270511 CTGGAGGAGAGGAAGGCACATGG - Intergenic
936539708 2:113340371-113340393 CTGGAAAAGGGGAAGTTAAAAGG - Intergenic
937060395 2:118976522-118976544 CTGGGGCAGGGGCAGGGGCAGGG - Intronic
937287961 2:120765109-120765131 CAGGGGCAGGGGGAGGTTCAGGG - Intronic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937909540 2:127068792-127068814 CTGGGGGTGGGGACGATACAGGG - Intronic
937914448 2:127092125-127092147 CTGGGGCAGGGGCAGGGACAGGG - Intronic
937936598 2:127250334-127250356 CTGGAGAAGGGAAAGAAACAGGG - Intergenic
937985027 2:127634573-127634595 CTGGGGAAGGGGAAGGTACAGGG - Intronic
938043423 2:128095407-128095429 GAGGGGAAGGGGAAGGTAAAGGG - Intronic
938073645 2:128320820-128320842 GTGGGGAAGGGGAGGGTTCTGGG - Intergenic
938078941 2:128359009-128359031 CTGGGGAATGGGGAGGAATATGG + Intergenic
938258324 2:129877692-129877714 CTGGGGAGGGGGCGGGGACAGGG + Intergenic
938555855 2:132423620-132423642 CTGGGGAAGGGGATGGAAGTGGG - Intronic
938668535 2:133564803-133564825 GTGGGAAAGGGGTAGGCACAGGG + Intronic
938957673 2:136314498-136314520 AAGGGGAAGGGGAAGGGAAAGGG - Intergenic
939572486 2:143856851-143856873 CTGTGGAAGGGGACTCTACATGG + Intergenic
939925810 2:148172466-148172488 CTGGGGTTGGGGAAGGCAGAGGG + Intronic
940616873 2:156059789-156059811 GTGGGGAGGAGGAAGGAACAAGG + Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942117591 2:172743362-172743384 CTGGGGCAGGGGAAGCAAGAGGG - Intronic
942794485 2:179801364-179801386 CTAGGTAAGGGGAAGTTACTGGG - Intronic
943324837 2:186485895-186485917 CTCAGGATGGGGATGGTACAGGG + Intergenic
943449377 2:188028764-188028786 CTAGGGAAGGGGAAGGAAGCCGG + Intergenic
944155613 2:196604270-196604292 CTGGGGCAGTGGAAGGGGCATGG - Intergenic
944504993 2:200402024-200402046 ATGGGGAAGATGAAGGCACATGG - Intronic
945293462 2:208147597-208147619 CTGGGGTAGAGGAATGTGCAGGG - Intergenic
945986680 2:216360130-216360152 CTCAGGAAGGGGATGATACATGG - Intronic
946040799 2:216781290-216781312 AGGGGGAAGGGGAAGGGAAAGGG - Intergenic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946299232 2:218812443-218812465 CTGGGGAAGGGAATGGGTCAGGG + Intronic
946329277 2:219000605-219000627 CAGGGGCAGGGGAAGGTCCTTGG - Intergenic
946758761 2:222972628-222972650 CTGGGGCAGGTGAAGGGGCAGGG + Intergenic
947415266 2:229888848-229888870 GTGGGGAAGGAGAGGGTATAAGG + Intronic
947634565 2:231673464-231673486 GTGGGGAAGGGGAGGGAGCAGGG - Intergenic
948130807 2:235599381-235599403 CTGGGGAAGTGGATGCTGCAGGG + Intronic
948214926 2:236221571-236221593 CTGGGGAGGTGGAAGGTGAAAGG - Intronic
948618225 2:239215237-239215259 CCGGGGCGGGGGAAGGTACCAGG + Intronic
948644447 2:239395061-239395083 CTGGAGAAGAGGAAGGTAAAGGG + Intronic
1168732938 20:103293-103315 CTGGGGAAGGGGTAAGTAAGGGG + Intergenic
1169178635 20:3542586-3542608 AGGGGGAAGGGGAAGGGAGAAGG - Intronic
1169179737 20:3553013-3553035 CTAGGGGAGGGGATTGTACATGG + Intronic
1170188577 20:13620324-13620346 ATGGGGAAGAGGAAGAGACAAGG - Intronic
1171123350 20:22583453-22583475 CTGGGGTAGGGGAATGTATTTGG - Intronic
1172207801 20:33176768-33176790 GTGAGTAAGGGGAGGGTACAGGG - Intronic
1172272933 20:33664501-33664523 GTGGGGAAGGAGATGGGACAGGG - Intronic
1173118027 20:40264562-40264584 CTGGGGATTGGGATGGGACAGGG + Intergenic
1173441762 20:43083798-43083820 CTGGGGTAGGGGTGGGAACAGGG - Intronic
1173528254 20:43749370-43749392 CTGGGGGAGAGGAGGGGACATGG - Intergenic
1173577771 20:44124054-44124076 CTGGGGCCGGGGGAGGAACAGGG + Intronic
1173725330 20:45293396-45293418 CTGGGGGAGGGGAAGCCAGACGG - Intergenic
1174524035 20:51157094-51157116 CTGGGGCATGGACAGGTACATGG - Intergenic
1174733666 20:52943010-52943032 TTGGAGAAGGGGAAGGTATTAGG - Intergenic
1175147097 20:56905150-56905172 CTGGGGAAGGGACTGGGACAGGG - Intergenic
1175237914 20:57526124-57526146 CTGGGGGAGGGGAATGGATAAGG + Intergenic
1175261630 20:57678196-57678218 CTGGGGAAAGGTAAGGTTGATGG + Intronic
1175780199 20:61677188-61677210 CTGGAGTAGGGGAAGGAGCAGGG + Intronic
1175948269 20:62568813-62568835 CTGGGGTAGGGGTGGGTACGGGG - Intronic
1177507226 21:22034737-22034759 AGGGGGAAGGGGAAGAAACAGGG - Intergenic
1178319866 21:31597207-31597229 GAGGGGAAGGGGAAGGGAGAAGG - Intergenic
1178434480 21:32545909-32545931 CTAGGGAAAGGGAAGGAAGAAGG - Intergenic
1178480328 21:32974644-32974666 TTGGGGAAGGGGAAGGCTGAAGG + Intergenic
1178906679 21:36642538-36642560 ATGGGGATGGGGGAGCTACACGG - Intergenic
1178915874 21:36705400-36705422 CTGGGGTAGGGGAGGGGAGAGGG - Intronic
1179385457 21:40937668-40937690 CTGGGGCAGAGGAGGGTAGAGGG - Intergenic
1179644506 21:42767268-42767290 CTGGGGAAGGTCAAGGTCCCAGG - Intronic
1179959687 21:44761060-44761082 CTGGAGAAGGGGAGAGTCCAGGG + Intergenic
1180535941 22:16392757-16392779 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1180755307 22:18156948-18156970 CTGGGTTGGGGGAGGGTACACGG + Intronic
1180840526 22:18956920-18956942 CTGGGGAAGGGAGAGCTCCAGGG - Intergenic
1180956688 22:19744430-19744452 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1181031445 22:20150351-20150373 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
1181060967 22:20281854-20281876 CTGGGGAAGGGAGAGCTCCAGGG + Intronic
1181084401 22:20432605-20432627 CTAGGGAAGGAGCAGGCACATGG + Intronic
1181439257 22:22927384-22927406 CTGGGGCCGGGGAAGGAGCAAGG - Intergenic
1181496106 22:23288418-23288440 CTGGGGAAGGGGGATTCACAGGG - Intronic
1181880972 22:25979792-25979814 ATGGAGAAGGGGAAGGGAAAGGG - Intronic
1181977111 22:26737882-26737904 CTTGGGAAGGGGAAAGCACCTGG + Intergenic
1182247359 22:28969766-28969788 CTGGGGAAGGGGCAGTGTCAGGG + Intronic
1182303564 22:29352505-29352527 CATGGGAAGGAGGAGGTACAAGG + Intronic
1182447376 22:30397498-30397520 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
1182459961 22:30476509-30476531 CTGGGCAAGGGGAGGGGAGATGG - Intergenic
1182570658 22:31235255-31235277 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183461269 22:37952516-37952538 GGGGGGGAGGGGAAGGTTCAAGG - Intronic
1183667894 22:39255743-39255765 CAGGGGACGGGGCAGGCACAGGG + Intergenic
1184254703 22:43280443-43280465 ATGGGTGAGGGGAAGGGACAGGG - Intronic
1184408528 22:44313538-44313560 GTGGGGATGGGGCAGGAACAGGG + Intergenic
1184570833 22:45323938-45323960 CTGGTGCAGGGGAAGGTGCGTGG + Intronic
1184827572 22:46963486-46963508 CTGGGGAAGGCACAGGAACAAGG - Intronic
950187491 3:10954036-10954058 CTGGGGAAGGGGAGCTTGCAGGG - Intergenic
950424832 3:12919463-12919485 CAGGGGAAGGGGAGGGCACCTGG + Intronic
950442935 3:13020249-13020271 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
950652932 3:14418929-14418951 CGGGGGAAGGGGAAGGGGCTGGG - Intronic
950654423 3:14427866-14427888 CTGGGGAGATGGAAGTTACAGGG - Intronic
950969014 3:17167967-17167989 CTGCGGATGGGGAAGCTGCAGGG + Intronic
951052334 3:18108256-18108278 CAGGTGAAGGGGAAGGATCATGG - Intronic
951160094 3:19408291-19408313 GGGTGGAAGGGGAAGGTAAAGGG + Intronic
951613296 3:24516477-24516499 ATGGGGAAGGAGAAGGTATCAGG - Intergenic
951963215 3:28352057-28352079 CGGGGGAAGGAGAAAGTACAGGG - Intronic
952782939 3:37121692-37121714 CTGGGAAAGGAGAAAGTACATGG + Intronic
952822329 3:37496012-37496034 CTGGGGAAGGGCATGGGACATGG + Intronic
952835463 3:37598356-37598378 CTGGGGGAGGGGATGGTGCCAGG + Intronic
953366917 3:42352947-42352969 TTTGGGAAGTGGAAGGAACATGG + Intergenic
954063399 3:48088161-48088183 GTGGGGGTGGGGAGGGTACAGGG - Intronic
954106424 3:48412075-48412097 CTGGGGAAGGGGACAGGACATGG + Intronic
954106559 3:48412690-48412712 CTGGAGAAGGGGCAGGGCCAGGG + Intronic
954372321 3:50175305-50175327 CAGGGGAAGGGGTGGGGACAGGG - Intronic
954389578 3:50261577-50261599 CTGGGACAGGGGGTGGTACAGGG - Intergenic
954802766 3:53196661-53196683 CCGAGGAAGGGGCAGGTGCATGG - Intergenic
955356844 3:58238413-58238435 CTGGGGAAAGGGAAGCTGAAAGG - Intronic
955837151 3:63068628-63068650 CTGGGGATGGGGAAGTGAAAGGG + Intergenic
955936731 3:64109547-64109569 CTGGGGAAGGGAAAGGGAAAGGG + Intronic
956014484 3:64867331-64867353 CAGGGGAAAGGGAAGTCACATGG - Intergenic
956861299 3:73326656-73326678 CTGGGGAGGGGGATGGCAGAGGG - Intergenic
958646291 3:96879441-96879463 TGGGGGATAGGGAAGGTACAGGG + Intronic
959723429 3:109517199-109517221 CTGGGGAAAGGGTAGATACAAGG - Intergenic
960061691 3:113329542-113329564 CTGAGGAAAGGGAATCTACATGG + Intronic
960158753 3:114325988-114326010 CTGGGGTTGGGGCAGGTGCAGGG + Intergenic
960706367 3:120485934-120485956 CTGGGGCAGGAGAAGGGATAAGG - Intergenic
961426008 3:126848650-126848672 CTGGGGGTGGAGAAGGTAGAGGG + Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961906668 3:130269883-130269905 CTGGGGCAGGGGCAGGGGCAGGG - Intergenic
962089830 3:132231307-132231329 CTGGGGAAAGCGAAGGAATAGGG - Intronic
963074665 3:141334683-141334705 CGGGGGCTGGGGAAGGTATAGGG - Intronic
963318367 3:143785350-143785372 CTAGGGAATGAGAAGCTACATGG + Intronic
964838391 3:160966700-160966722 GTGGGGAAGGGGATGATACTTGG + Intronic
965695273 3:171401494-171401516 CTGAGGAAGGAGAGGGTTCAGGG + Intronic
965772245 3:172193263-172193285 AGGGGGAGGGGGAAGGTAGAGGG - Intronic
966555205 3:181251364-181251386 AAGGGGAAGGGGAAGGGAGAAGG - Intergenic
966799330 3:183748234-183748256 GAGGGGAAGGGGAGGGGACAAGG - Intronic
966979067 3:185113774-185113796 ACAGGGAAGGGGGAGGTACATGG + Intronic
967315466 3:188148607-188148629 ATGAGGAAGGGGAAGCTGCAGGG + Intergenic
967872808 3:194246222-194246244 CTGGGCAAGAGGATGGCACAGGG + Intergenic
967885333 3:194329841-194329863 CTGGGGCAGGCGAAAGCACATGG + Intergenic
967930703 3:194688158-194688180 CTGGGGGCGGGCAAGGGACAGGG - Exonic
967983070 3:195077200-195077222 CTGGGGAAGGGAAAAGCAGAGGG + Intronic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968236201 3:197031129-197031151 CTGGATCAGGGGAAGGAACATGG + Intergenic
968555431 4:1244417-1244439 CTGAGGCTGGGGAAGGAACAGGG - Intronic
968606449 4:1537900-1537922 CTGGGGCAGGGGAAAGGCCAGGG + Intergenic
968747498 4:2367915-2367937 CTGGGTAAGGGGAGGGCACCTGG - Intronic
969121328 4:4913498-4913520 CTGGGGAAGGGGGAGGGAAAGGG + Intergenic
969414470 4:7049701-7049723 GGAGGGAAGGGGAAGATACAGGG + Intronic
969462089 4:7334281-7334303 CTGGGGAAGGAGGAGGTCCAAGG - Intronic
969484733 4:7465956-7465978 CTGGGGCAGGGGCAGGGCCAGGG + Intronic
969707442 4:8819594-8819616 CAGGGGAAGGGGAAGGGAGTAGG + Intergenic
970573442 4:17404901-17404923 CTGGGGCAGGGGCAGCTGCATGG - Intergenic
970573983 4:17409588-17409610 CTGAGGAATAGGAAGGGACATGG + Intergenic
970645300 4:18113838-18113860 AAGGGGAAGGGGAAGGGAAAGGG + Intergenic
971381133 4:26098991-26099013 CAGGGGAAGGGGATTGTCCAAGG + Intergenic
971975801 4:33684716-33684738 CAAGGGAAGGGCAATGTACAAGG + Intergenic
972575023 4:40343624-40343646 CTGAGGAAAGGGAAGGTAAGAGG + Intronic
972591737 4:40494510-40494532 CTGTGGGAGGGCAAGGAACAAGG + Intronic
974214951 4:58832985-58833007 AAGGGGAAGGGGAAGGGAAAGGG - Intergenic
974596211 4:64016892-64016914 CCTGGGAAGGGAAAGGAACAAGG + Intergenic
974931613 4:68366622-68366644 CTGGTGAAGGGGATGGTAAAAGG - Intergenic
975096686 4:70464793-70464815 CTGGGGAAAGGGGAGGTAATGGG + Intronic
975320156 4:73000955-73000977 GTGGGGAGGAGGAAGTTACAGGG + Intergenic
975442029 4:74421808-74421830 GAGGGGAAGGGGAAGGAAGATGG + Intergenic
975694084 4:76994358-76994380 AAGAGGAAGGGGCAGGTACAAGG + Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976753802 4:88477404-88477426 GAGGGGAAGGGGAAGGTGAAGGG + Intronic
977345592 4:95812263-95812285 GTGGGAAAGGGGCAGGGACAAGG + Intergenic
977433360 4:96960899-96960921 CTGAGGATGGGGAAGGAATATGG - Intergenic
977529034 4:98177835-98177857 GTGGTTAAGGGGAAGGTCCAGGG - Intergenic
979713757 4:123811997-123812019 ATGGGGCAGGGCATGGTACAGGG - Intergenic
982765462 4:159342813-159342835 CTGGGGAATGAGATGGCACAGGG - Intronic
982936825 4:161489249-161489271 CTGGCTAGGGGGAAGGTCCAGGG + Intronic
983917709 4:173310314-173310336 CTTGGTAAGGGGGAGGGACAGGG - Intronic
984402061 4:179278992-179279014 CAAGGGAAGGGAAAGGTAAAAGG - Intergenic
985377506 4:189356281-189356303 CTTGGGAAGTGGGAGGTAAACGG + Intergenic
985790856 5:1926297-1926319 CAGGGGAAGGGGCAGGCACAGGG - Intergenic
985790874 5:1926351-1926373 CTGGGGCAGGGGCAGGTGCAGGG - Intergenic
985790890 5:1926387-1926409 CAGGGGAAGGGGAAGGCGCAGGG - Intergenic
985790972 5:1926623-1926645 CAGGGGCAGGGGCAGGTGCAGGG - Intergenic
985855240 5:2419214-2419236 CTGGGGAAAGGGGAGGGAGAAGG + Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986616116 5:9619020-9619042 CTTGGGAAGAGGATGGTAGATGG - Intergenic
986723448 5:10577086-10577108 AAGGGGAAGGGGAAGGGAAAGGG - Intronic
986723456 5:10577104-10577126 AAGGGGAAGGGGAAGGGAAAGGG - Intronic
986820995 5:11466785-11466807 GTGGGGGAGGGGAAGATAAAAGG - Intronic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
989285489 5:39694446-39694468 CTGGGGAATGTGAAGGCATAAGG - Intergenic
990197822 5:53338215-53338237 CTGGGGAAGAGGCAAGTAGATGG + Intergenic
990582136 5:57174783-57174805 CTGAGGGGGTGGAAGGTACAGGG - Intronic
990861422 5:60331677-60331699 GTGGGGAAGGGGAAGGCAAGAGG + Intronic
991953365 5:71968514-71968536 GTGGGGAAAGGGAAGTGACAAGG - Intergenic
992004627 5:72465363-72465385 CTGGGGAAGGGGAGTGTTGAAGG + Intronic
994184821 5:96805928-96805950 CTGCGGAAGGGGTTGGTACCGGG + Intronic
994227068 5:97265188-97265210 ATGTGGAAGGGCAAGGTATAGGG + Intergenic
995655716 5:114423909-114423931 ATGGAGAAAGGGAAGGTGCAGGG + Intronic
995820015 5:116219290-116219312 AAGGGGAAGGGGAAGGGAAAGGG - Intronic
995869045 5:116725044-116725066 CTGGGGAGGGGCAAGGTCCTTGG + Intergenic
995882451 5:116858275-116858297 AAGGGGAAGGGGAAGGGAAAGGG - Intergenic
996814579 5:127560549-127560571 CTGGGGGAGCGGGAGGTATAGGG + Intergenic
997465696 5:134086683-134086705 AAGGGGAAGGGGAAGGAAGAAGG - Intergenic
997583096 5:135029322-135029344 CTGGGGGAGGGGACGGGAGAAGG + Intronic
998192965 5:140042660-140042682 GTGGTGGAGGGCAAGGTACAGGG - Exonic
998324430 5:141266972-141266994 GTGGGGAAGAGAAAGGTTCAGGG + Intergenic
998377067 5:141698272-141698294 TGGGGGAAGGGGAGGGTACTGGG - Intergenic
998537818 5:142951035-142951057 AAGGGGAAGGGGAAGGGAAAGGG - Intronic
1000250270 5:159487921-159487943 CTGGGGTAGGGGACTGTATATGG + Intergenic
1000359800 5:160436358-160436380 CTGGGGAATGGGGTGGAACAGGG + Intergenic
1000486392 5:161849056-161849078 CTGGGGGAGGGGGAGGTTGAAGG + Intronic
1001288402 5:170439727-170439749 CTGGGGAAGGGGAATGTTGCTGG - Intronic
1001527156 5:172437138-172437160 CTGGGGAAGGGAAAGCAACAAGG + Intronic
1002061876 5:176630186-176630208 CTGGGGAAGGGGATGGAAAATGG - Intronic
1002106222 5:176880603-176880625 CTGGGGGAGGGGCAGGGGCAGGG - Exonic
1002202519 5:177538108-177538130 CTGGAGAAGGGGGAGGAAAAAGG + Intronic
1002260504 5:177990857-177990879 CAGGGCAAGGGGTAGGGACAAGG - Intergenic
1002564072 5:180100226-180100248 CTGGGGAACGGGCAGAGACAGGG - Intergenic
1002634748 5:180601747-180601769 CAGAGGAAGGGGGAGGTCCACGG + Exonic
1003052828 6:2795671-2795693 CAGGGGGAGAGGAAGGCACAGGG - Intergenic
1003524245 6:6885024-6885046 CGGGTGAAAGGAAAGGTACAGGG - Intergenic
1003772264 6:9318780-9318802 TTTGGGAGGGGGAAAGTACAGGG - Intergenic
1003899744 6:10643341-10643363 ATGGAGAAGGGGAAGGTCAAGGG - Intergenic
1004009543 6:11669070-11669092 GAGGGCAAGGGGTAGGTACAAGG - Intergenic
1005407129 6:25501290-25501312 CTTGGGGAGGGGAAGGAAGATGG - Intronic
1005759442 6:28954263-28954285 CTGGGGCAGGGGTGGGAACAAGG - Intergenic
1005777110 6:29146238-29146260 CTGGGGCAGGGGAAGGAAGGGGG - Intergenic
1005858219 6:29880470-29880492 CTGGGGAAGGACATTGTACAGGG + Intergenic
1005960340 6:30689091-30689113 CTGGGCCTGGGGAAGGTACATGG - Intronic
1006102310 6:31693150-31693172 CTGAGGAAGGGAAAGATGCAGGG + Intronic
1006390278 6:33754289-33754311 TTGGGGAATGGGGAGGTGCAAGG + Intergenic
1006459282 6:34148940-34148962 CAGGGGAAGGGGAAGGGTGAAGG + Intronic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1006567804 6:34974303-34974325 AAGGGGAAGGGGAAGGGAAAGGG - Intronic
1006567831 6:34974377-34974399 AAGGGGAAGGGGAAGGGAAATGG - Intronic
1006579643 6:35069319-35069341 CTGTGGATGGGGCAGGGACAAGG - Intronic
1006630836 6:35428436-35428458 CTGGGGAAGGGGAAGGCCCCTGG + Intergenic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1006868993 6:37233221-37233243 ATGAGCAAGAGGAAGGTACATGG - Intronic
1007093639 6:39200076-39200098 CTGGGTTAGGGGAAGGGACATGG + Intronic
1007483512 6:42165238-42165260 CTGGGGTGGGGGAAGGCGCATGG + Intronic
1007558055 6:42782970-42782992 CTGGGGAGGGGGAGGGGAGAGGG + Intronic
1007827758 6:44613908-44613930 CTGAGGAAGGGGAAGGTTTTGGG + Intergenic
1008392935 6:50973800-50973822 CTGGGAAAGGGAACAGTACATGG - Intergenic
1008502896 6:52200841-52200863 AAGGGGAAGGGGAAGGGAAAGGG + Intergenic
1008902742 6:56640762-56640784 CAGGGGAAGAGGGAGGTATAAGG + Intronic
1009438843 6:63651704-63651726 TTGGGGAAGGGGAAGGAGCAGGG - Intronic
1009628205 6:66163514-66163536 CTGGGGAAGGAGAAAGGAAAGGG + Intergenic
1009796570 6:68476893-68476915 CTGGGGAAGGAGAAGTGGCAAGG - Intergenic
1011275260 6:85625119-85625141 CTGGAGATGGGGAAGGGACAGGG - Intronic
1012464045 6:99497247-99497269 ATGGGGAAGGGGGAGGTAGAGGG + Intronic
1013109509 6:107053889-107053911 GGGGGGAGGGGGAAGGTAAAGGG - Intergenic
1013233962 6:108180973-108180995 CTGGGGAAGGAGAAGAAACAGGG - Intronic
1013301420 6:108808474-108808496 CTGGAGAAGGGGGTGGTGCATGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1016855243 6:148662855-148662877 ATGGGGAAGGGGAAAGATCAAGG - Intergenic
1017036931 6:150275330-150275352 CTGGGGATGGGGTGGGGACAGGG - Intergenic
1017346702 6:153391388-153391410 GTGGTCAAGGGGAAGGGACATGG - Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1018077408 6:160229570-160229592 GTGGAGAAGGGGTGGGTACATGG - Intronic
1018162264 6:161056747-161056769 CTGAGGAAGGTGAAGGAAAAAGG - Intronic
1018358827 6:163045152-163045174 CTCAGGAAGGGGGAGGTACCTGG + Intronic
1018617013 6:165696103-165696125 TTGGGGAGGGGGAAGGAAGATGG + Intronic
1019417048 7:932576-932598 CCGGGGAGGGGGATGGTCCAGGG + Intronic
1019803274 7:3104385-3104407 CTGGAGATGGGGAAGACACAGGG - Intergenic
1020241196 7:6396419-6396441 CTGGGGACGAAGAAGGAACAAGG + Intronic
1020660490 7:10974956-10974978 CTGGGAAAGGGGAAGAGAGAAGG - Intronic
1021550393 7:21865498-21865520 CAGGGGATGGGGAAGGAAAAAGG + Intronic
1021670083 7:23026824-23026846 ATGGGGAAGGAGAGGATACATGG + Intergenic
1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG + Intergenic
1021848814 7:24788186-24788208 CTGGGGCAGGGGAAGAGCCAGGG - Intergenic
1022511222 7:30935880-30935902 CTGGGGAAGGGGAGGGTTGGTGG + Intergenic
1023200349 7:37690419-37690441 CTGTGAAAGGGGAAAGGACAGGG - Intronic
1023745471 7:43318921-43318943 CTGGTGAAGTGGAAACTACAAGG + Intronic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024707143 7:51972872-51972894 CTGGGGGAGGCGAAAGGACAGGG - Intergenic
1025092882 7:56077982-56078004 CTGGGGAAGGGGAAGGGCACGGG - Intronic
1025264956 7:57449257-57449279 CTGGGGATGGGGAGGGTAGGGGG + Intergenic
1026623743 7:71974340-71974362 CTCGGGAGGGGGAAGTTGCAGGG + Intronic
1026739031 7:72966977-72966999 CTGGGGAAGGGGAGGAGAGAAGG - Intronic
1027052472 7:75028841-75028863 CTTGGGGAGGGGAAGCTACCAGG - Intronic
1027104702 7:75398096-75398118 CTGGGGAAGGGGAGGAGAGAAGG + Intronic
1027217911 7:76196040-76196062 CTGGGGAGGGGGAGGACACAGGG + Intergenic
1028782122 7:94749358-94749380 CTGAGGAAAGGGACGGGACAAGG - Intergenic
1029123715 7:98283951-98283973 CTAGGGAAGGGGAAGTGGCAGGG - Intronic
1029188613 7:98756317-98756339 CTGGGGGAGGGGGAGATACAAGG - Intergenic
1029479257 7:100802968-100802990 CTGGGGGAGGGGCATTTACAAGG + Exonic
1029528899 7:101112350-101112372 CGGGGGCAAGGGAAGGGACAGGG - Intergenic
1029670929 7:102030358-102030380 GAGGGGAGGGGGGAGGTACATGG - Intronic
1029744695 7:102510353-102510375 TAGGGGTAGGGGAAGATACAAGG - Intronic
1029762686 7:102609515-102609537 TAGGGGTAGGGGAAGATACAAGG - Intronic
1029952308 7:104599995-104600017 CATAGGAAGGGGAAGCTACAAGG - Intronic
1030370627 7:108695170-108695192 CTTGTGAAGGGGAAGATCCATGG + Intergenic
1030463920 7:109875801-109875823 CTGGGGAAGGTGGATATACATGG + Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1033652159 7:143351785-143351807 CTGGGGAAGGAGATGGCACAGGG - Exonic
1034720235 7:153285426-153285448 CTGGGGTAGGGGGAGGAACAGGG + Intergenic
1034840514 7:154391316-154391338 CTGGGGATGGAGGAGGTACAGGG - Intronic
1034936303 7:155202956-155202978 GAGGGGGAGGGGAAGGGACAGGG + Intergenic
1034964205 7:155381731-155381753 CGGGGGAAGGGGGATGTCCACGG - Intergenic
1034975478 7:155446856-155446878 AAGGGGAAGGGGAAGGAAAAGGG + Intergenic
1035045137 7:155960579-155960601 CCGGGGAACGGGAAGGAACAAGG - Intergenic
1035045848 7:155964768-155964790 CTGGGGGAGGGGTTGGGACAGGG + Exonic
1035676950 8:1462693-1462715 CTGGGGAAGGGGAAGGGACCAGG + Intergenic
1035856955 8:2985960-2985982 AAGGGGAAGGGGAAGGGAAAGGG + Intronic
1035868108 8:3106893-3106915 CTGGGGAAGGGAAACCAACACGG - Intronic
1036180016 8:6576493-6576515 AAGGGGAAGGGGAAGGGAAAGGG - Intronic
1036224957 8:6949791-6949813 CTGGGGAAAGGGAATGAACCAGG - Intergenic
1036678176 8:10851955-10851977 GCGGGGAAGGGGAAGGGAAAGGG + Intergenic
1037344413 8:17883787-17883809 AAGGGGAAGGGGAAGGAAAAGGG - Intronic
1037606250 8:20439861-20439883 CTGTGGAAGAGGAAGAAACATGG - Intergenic
1038105682 8:24431304-24431326 CAGGGGATGGGTAAGGGACAAGG + Intergenic
1038426926 8:27469677-27469699 CTGGGGTAGAGGAAGGAGCAGGG + Intronic
1039374140 8:37016285-37016307 GTGGGGAGGGGTAGGGTACATGG - Intergenic
1040584202 8:48725094-48725116 CTGTGGTAGGGAAAGGCACATGG + Intronic
1041284835 8:56249551-56249573 AAGGGGAAGGGGAAGGGAAAGGG - Intergenic
1041368103 8:57130661-57130683 CTGAGGGAGGGGAAGGAGCAGGG - Intergenic
1041838761 8:62246450-62246472 ATGGGAAAGGGAGAGGTACAAGG + Intergenic
1042587652 8:70359553-70359575 CTCTTGAAGGGGAAGTTACAAGG + Intronic
1042655598 8:71092024-71092046 ATGTGGCAGGGGAGGGTACAGGG - Intergenic
1042722692 8:71842531-71842553 CAGGGAAAGGGGAAGGGTCAAGG + Exonic
1042749837 8:72146723-72146745 CTGGGAAAGGGGAAGGGATAGGG + Intergenic
1042871712 8:73405656-73405678 TTGGGGAAGGGGAAGCTGGAAGG - Intergenic
1043725082 8:83601322-83601344 CGGGGGAGGGTGAAGGGACACGG + Intergenic
1044603282 8:94026783-94026805 CTGGGGAAGGGGTAGGGGAATGG - Intergenic
1044838414 8:96317240-96317262 CTGGGCATGGGAAAGGCACAAGG - Intronic
1045342240 8:101265407-101265429 CTGGGTAGGGGGAAGCTAGATGG + Intergenic
1045527263 8:102951780-102951802 ATTGGGAAGGGGAAGGGAGAGGG - Intronic
1047015698 8:120720849-120720871 CTGTGGAAGGGTAAGGTAGGTGG - Intronic
1047869753 8:129069867-129069889 GTGGGGAAGTAGGAGGTACAAGG - Intergenic
1048209818 8:132445446-132445468 TTGGGGATGGGGCAGGTGCATGG - Intronic
1048890802 8:138944639-138944661 CTGGGGCTGGGTAAGGGACAGGG + Intergenic
1049157625 8:141076466-141076488 CTGGGACAGGGGAAGGTAAATGG + Intergenic
1049509829 8:143021922-143021944 CTGGGGCAGGTGGAGGTGCAGGG - Exonic
1049528613 8:143142412-143142434 CTGGGGAAGGAGGAGGGACAGGG - Intergenic
1049528763 8:143142901-143142923 CTGGGGAGGGAGGAGGGACAGGG - Intergenic
1049556701 8:143286091-143286113 CTGGGGGAGGGGAAGGGAAAGGG - Intergenic
1049565905 8:143338880-143338902 CTGGGGAAGAAGAGGGCACAAGG - Intronic
1049646172 8:143736780-143736802 CTGGGGTGGGGGAGGGTACTGGG - Intergenic
1049684481 8:143933876-143933898 CTGGGGCAGGGGCAGGGGCAGGG - Intronic
1050460045 9:5869832-5869854 CTGGAGAAAGGGAAGGCTCATGG + Intergenic
1050473966 9:6021025-6021047 GTGGAGAAGGGGTAGGGACATGG - Intergenic
1050888656 9:10796111-10796133 CTGGGGAAGAGGTATGTAAATGG - Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1052342265 9:27375365-27375387 CTGGGGATGATGAAGGCACATGG + Intronic
1052951856 9:34219822-34219844 GAGGGGAAGGGGAAGGGAGAGGG - Intronic
1053124078 9:35565314-35565336 CTGGGGCAGGGGAGGGTCCTGGG + Intergenic
1053144488 9:35703287-35703309 CTGGGGTAGGGGAAGTCACATGG + Intronic
1053268935 9:36736613-36736635 CTAGGGAAGGGCAGGGTTCAGGG + Intergenic
1053428714 9:38027835-38027857 CTGGGGAGGCAGAAGGGACAGGG + Intronic
1053571501 9:39313583-39313605 CTGGGTAAAGGGTAGGTATATGG + Intergenic
1054093060 9:60872285-60872307 CTGGGTAAAGGGTAGGTATATGG + Intergenic
1054114537 9:61148197-61148219 CTGGGTAAAGGGTAGGTATATGG + Intergenic
1054125644 9:61305429-61305451 CTGGGTAAAGGGTAGGTATATGG - Intergenic
1054593217 9:67034330-67034352 CTGGGTAAAGGGTAGGTATATGG - Intergenic
1055484660 9:76745598-76745620 TGGGGGAAGGGGGAGGTACTAGG - Intronic
1056805006 9:89721655-89721677 CTGGGGAAGGTGGTGGAACAGGG + Intergenic
1056935766 9:90913921-90913943 CTGGGGAATGGGCAGGTGAAAGG + Intergenic
1057133330 9:92669783-92669805 CCGGGGAGGAGGAAGGTACTGGG + Intronic
1057205068 9:93166926-93166948 CTGTGGGATGGGAAGGTACAGGG - Intergenic
1057477149 9:95412285-95412307 CTGGGGAAGGGGCATGAACTCGG + Intergenic
1057531975 9:95857033-95857055 AGGGGGAAGGGGAAGGGCCAGGG - Intergenic
1057593952 9:96398740-96398762 CTGGGGAAGGGAAAGAGAGAGGG - Intronic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1059293377 9:113247614-113247636 CAGGTGATGGGGCAGGTACAGGG + Intronic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059352947 9:113678500-113678522 AAGGGGAAGGGGAAGGGAAACGG - Intergenic
1059687405 9:116650838-116650860 CTGTGGAAGGGGAAAGAACAGGG - Intronic
1059956678 9:119523237-119523259 CAGGTGATGGGGAAAGTACAAGG + Exonic
1060206658 9:121686396-121686418 CTGGGGAAATGGAATTTACAGGG - Intronic
1060479351 9:124008934-124008956 CTGGGGGAGGGGGAGGTCGAGGG + Intronic
1060802106 9:126551400-126551422 CAGGGGCAGGGGAAGGGTCAGGG - Intergenic
1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG + Intronic
1061389591 9:130310088-130310110 CTGGGAAAGGGGAATGGGCAGGG - Intronic
1061634561 9:131899067-131899089 CAGGTGAAGGGGATGGCACAGGG + Intronic
1061657488 9:132104238-132104260 CTGGGGAGGGTGAGGGTAGAGGG - Intergenic
1062096582 9:134706919-134706941 CTGGGGAAGGTGCTGGGACAGGG - Intronic
1062197669 9:135283140-135283162 CTGGGGAAGGGGCAGGGTCAGGG + Intergenic
1062204418 9:135328079-135328101 CAGGGGAATAGGAAGGTAAAGGG + Intergenic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1062352779 9:136147401-136147423 CTGGCGGAGGGGATGGCACAGGG + Intergenic
1062469304 9:136695573-136695595 CTGGGGAGGAGGAAGGCCCAGGG - Intergenic
1062738052 9:138149558-138149580 AAGGGGAAGGGGAAGGGAGAAGG - Intergenic
1185641906 X:1593021-1593043 CTGGGGAAGGGAAGGGGCCAGGG - Intronic
1186255255 X:7711301-7711323 CAGAGGAAGTGGAAGCTACAGGG - Intergenic
1186732883 X:12429140-12429162 CTGGAGAAGGGGAAGACACTGGG + Intronic
1186836705 X:13445590-13445612 CAAGGGGAGGGGAATGTACAAGG + Intergenic
1187569082 X:20482838-20482860 AAGGGGAAGGGGAAGGGAAAGGG - Intergenic
1189196656 X:39159290-39159312 CTGGGGGAGGAGGAGGTTCAGGG + Intergenic
1190210641 X:48443921-48443943 CTGGGGAAGGGAAAGGCAGAGGG + Intergenic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1190747350 X:53332452-53332474 CTGGGGTGGGGGTAGGGACAAGG - Intergenic
1190879478 X:54482616-54482638 CTGGTGAATGGGAAGGGAGATGG - Intronic
1191085491 X:56563552-56563574 CTGGGGGAGGGGAAGGGGCGGGG + Intergenic
1192017416 X:67346775-67346797 TATGGGAAGGGGAAGGCACATGG - Intergenic
1192078923 X:68029213-68029235 CTGGGAATCGGGAAGGTACAGGG - Intergenic
1192135786 X:68599105-68599127 CTGAGCCAGGGGAAGGAACAGGG - Intergenic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1192269646 X:69566673-69566695 CTGGAGAAGGGGCAGGTGTAGGG + Intergenic
1192448957 X:71230897-71230919 AAGGGGAAGGGGAAGGAAGAGGG + Intergenic
1192562590 X:72137248-72137270 GTGGGTAAGGGGAAGGGACTGGG - Intronic
1195065034 X:101232750-101232772 CCGGGGAAGGGGTAGGTTAATGG - Intronic
1195086283 X:101417470-101417492 CTGGAGCAGGGGAAGGCAAAGGG - Intergenic
1195602179 X:106762266-106762288 CAGGGGCTGGGGAGGGTACAGGG - Intronic
1199086748 X:143636233-143636255 CTGGGGAAGGGGGTGGTAGTTGG + Intergenic
1199741672 X:150741458-150741480 ATGGGGTAGGGGAAGGAACAGGG - Intronic
1199827511 X:151515325-151515347 ATGGGGAAGAGGAGGGGACAAGG - Intergenic
1199904955 X:152216635-152216657 CTGGGGAAGGAGAAGAGAGAGGG + Intronic
1200315131 X:155124525-155124547 TTGGGGGAGGGGCAGGTACATGG + Intronic
1201274115 Y:12282811-12282833 TGGGTGAAGGAGAAGGTACAGGG + Intergenic