ID: 902388467

View in Genome Browser
Species Human (GRCh38)
Location 1:16089156-16089178
Sequence CTGACTCAGCGCCTGGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902388458_902388467 7 Left 902388458 1:16089126-16089148 CCGTTGCCTCCCTCACCTCCACA No data
Right 902388467 1:16089156-16089178 CTGACTCAGCGCCTGGACACTGG No data
902388457_902388467 25 Left 902388457 1:16089108-16089130 CCTCAGCGACTCGTGCAACCGTT No data
Right 902388467 1:16089156-16089178 CTGACTCAGCGCCTGGACACTGG No data
902388462_902388467 -2 Left 902388462 1:16089135-16089157 CCCTCACCTCCACACACAGGGCT No data
Right 902388467 1:16089156-16089178 CTGACTCAGCGCCTGGACACTGG No data
902388464_902388467 -8 Left 902388464 1:16089141-16089163 CCTCCACACACAGGGCTGACTCA No data
Right 902388467 1:16089156-16089178 CTGACTCAGCGCCTGGACACTGG No data
902388459_902388467 1 Left 902388459 1:16089132-16089154 CCTCCCTCACCTCCACACACAGG No data
Right 902388467 1:16089156-16089178 CTGACTCAGCGCCTGGACACTGG No data
902388455_902388467 27 Left 902388455 1:16089106-16089128 CCCCTCAGCGACTCGTGCAACCG No data
Right 902388467 1:16089156-16089178 CTGACTCAGCGCCTGGACACTGG No data
902388463_902388467 -3 Left 902388463 1:16089136-16089158 CCTCACCTCCACACACAGGGCTG No data
Right 902388467 1:16089156-16089178 CTGACTCAGCGCCTGGACACTGG No data
902388456_902388467 26 Left 902388456 1:16089107-16089129 CCCTCAGCGACTCGTGCAACCGT No data
Right 902388467 1:16089156-16089178 CTGACTCAGCGCCTGGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902388467 Original CRISPR CTGACTCAGCGCCTGGACAC TGG Intergenic
No off target data available for this crispr