ID: 902391039

View in Genome Browser
Species Human (GRCh38)
Location 1:16106667-16106689
Sequence TCCGTGGACCCTTGCCAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902391039_902391048 11 Left 902391039 1:16106667-16106689 CCCCACTGGCAAGGGTCCACGGA No data
Right 902391048 1:16106701-16106723 ACCTTTTGCGAGGGTTCCCCAGG No data
902391039_902391045 1 Left 902391039 1:16106667-16106689 CCCCACTGGCAAGGGTCCACGGA No data
Right 902391045 1:16106691-16106713 TCCTGTTGGGACCTTTTGCGAGG 0: 33
1: 50
2: 28
3: 27
4: 76
902391039_902391047 2 Left 902391039 1:16106667-16106689 CCCCACTGGCAAGGGTCCACGGA No data
Right 902391047 1:16106692-16106714 CCTGTTGGGACCTTTTGCGAGGG No data
902391039_902391050 18 Left 902391039 1:16106667-16106689 CCCCACTGGCAAGGGTCCACGGA No data
Right 902391050 1:16106708-16106730 GCGAGGGTTCCCCAGGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902391039 Original CRISPR TCCGTGGACCCTTGCCAGTG GGG (reversed) Intergenic
No off target data available for this crispr