ID: 902391626

View in Genome Browser
Species Human (GRCh38)
Location 1:16110491-16110513
Sequence CAGGAAAACCGCTCTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902391616_902391626 18 Left 902391616 1:16110450-16110472 CCAGAGGTTTGGGATAGAGAGTG No data
Right 902391626 1:16110491-16110513 CAGGAAAACCGCTCTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902391626 Original CRISPR CAGGAAAACCGCTCTGAGGA GGG Intergenic
No off target data available for this crispr