ID: 902393164

View in Genome Browser
Species Human (GRCh38)
Location 1:16117964-16117986
Sequence CCTACTACTGCCCCATAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902393164_902393170 23 Left 902393164 1:16117964-16117986 CCAGCTTATGGGGCAGTAGTAGG No data
Right 902393170 1:16118010-16118032 GGATTAAATGAGTTAATCCTTGG No data
902393164_902393167 -2 Left 902393164 1:16117964-16117986 CCAGCTTATGGGGCAGTAGTAGG No data
Right 902393167 1:16117985-16118007 GGACTAGGTCACAGAGTTTTTGG No data
902393164_902393169 2 Left 902393164 1:16117964-16117986 CCAGCTTATGGGGCAGTAGTAGG No data
Right 902393169 1:16117989-16118011 TAGGTCACAGAGTTTTTGGGAGG No data
902393164_902393168 -1 Left 902393164 1:16117964-16117986 CCAGCTTATGGGGCAGTAGTAGG No data
Right 902393168 1:16117986-16118008 GACTAGGTCACAGAGTTTTTGGG No data
902393164_902393171 24 Left 902393164 1:16117964-16117986 CCAGCTTATGGGGCAGTAGTAGG No data
Right 902393171 1:16118011-16118033 GATTAAATGAGTTAATCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902393164 Original CRISPR CCTACTACTGCCCCATAAGC TGG (reversed) Intergenic
No off target data available for this crispr