ID: 902394780

View in Genome Browser
Species Human (GRCh38)
Location 1:16126664-16126686
Sequence CGTGGTCTGAGCGCTTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902394780_902394783 -9 Left 902394780 1:16126664-16126686 CCTGGAAAAGCGCTCAGACCACG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 902394783 1:16126678-16126700 CAGACCACGGTGAAGGAGACAGG 0: 1
1: 0
2: 2
3: 14
4: 185
902394780_902394785 -1 Left 902394780 1:16126664-16126686 CCTGGAAAAGCGCTCAGACCACG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 902394785 1:16126686-16126708 GGTGAAGGAGACAGGACCCCCGG 0: 1
1: 0
2: 2
3: 41
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902394780 Original CRISPR CGTGGTCTGAGCGCTTTTCC AGG (reversed) Intronic
900451109 1:2750265-2750287 GGGGGTCTGGGCTCTTTTCCAGG - Intronic
902394780 1:16126664-16126686 CGTGGTCTGAGCGCTTTTCCAGG - Intronic
910493851 1:87803430-87803452 CATGGTCTTAGCTCCTTTCCTGG - Intergenic
1075844359 10:125533740-125533762 CGTGGTTTGAGCCGTTTGCCTGG + Intergenic
1076667409 10:132101056-132101078 CCTGGTCTGAGAGCTTTCACTGG - Intergenic
1077908912 11:6557731-6557753 CCAGGTCTGAGGGCTTTTCCTGG - Exonic
1086229316 11:84549290-84549312 CATGGTCTGAGTAATTTTCCAGG + Intronic
1088697455 11:112380531-112380553 CTTGGACTGAGGGGTTTTCCTGG + Intergenic
1091641289 12:2239515-2239537 CTGGGTCTCAGCTCTTTTCCTGG + Intronic
1096845915 12:54406431-54406453 CCTGGTGTGAGCCCTTTCCCAGG + Intronic
1102025222 12:109710819-109710841 ACTGGCCTGAGGGCTTTTCCAGG - Intergenic
1102635326 12:114318670-114318692 CATTGTCTGAGGGCTGTTCCTGG - Intergenic
1104809759 12:131613032-131613054 TGAGGACTGAGCGCTTTTTCTGG - Intergenic
1118050346 14:62019797-62019819 CGGGCACTGACCGCTTTTCCTGG + Intronic
1128282432 15:66407437-66407459 TGAGATCTGAGCTCTTTTCCTGG + Intronic
1129871452 15:78944375-78944397 GTTGGTCTGAGTGCTTTCCCTGG + Intronic
1131570278 15:93527954-93527976 TCTGGTCGGAGCTCTTTTCCTGG - Intergenic
1135852841 16:25980268-25980290 CGTGCTCTCAGCCCTCTTCCTGG + Intronic
1140454154 16:75095054-75095076 CATGGTCTCAGAGCATTTCCTGG + Intronic
1141460701 16:84177141-84177163 AGTGGCCTGAGTGCATTTCCCGG + Intronic
1142173519 16:88634730-88634752 CGTGTTCTCAGCGCTGTCCCGGG - Intergenic
1152268904 17:79312397-79312419 TGTGGTCTGAGCACTTTTGATGG + Intronic
1159507218 18:69353417-69353439 CTTGGTCTGAGAGCTTTCTCTGG + Intergenic
1160939633 19:1614268-1614290 TTTGGTCTGTGCGCTTGTCCTGG - Intronic
1161323584 19:3652437-3652459 AGTGGTCTGGGCGGTTTTCTGGG + Intronic
1163185068 19:15632004-15632026 CAAGGACTGAGCGCTTTTCAGGG + Intronic
1166272710 19:41726608-41726630 CGTGGTCTGAGGGCTCTCTCAGG - Intronic
1166414497 19:42583950-42583972 CGTGGTCTGAGGGCTCTCCCAGG + Intronic
1166419107 19:42620939-42620961 CATGGTCTGAGGGCTTTCCCAGG + Intronic
1167455747 19:49596114-49596136 CTTGGCCTCAGCGCCTTTCCTGG + Exonic
934780513 2:96966852-96966874 CCTGGTGAGAGCGCTCTTCCAGG - Intronic
937701683 2:124869190-124869212 TGTGGGCAGAGAGCTTTTCCTGG - Intronic
939674296 2:145052993-145053015 TGTGGTCTCAGGGCCTTTCCAGG + Intergenic
940565186 2:155351521-155351543 CCTGGCTTCAGCGCTTTTCCAGG + Intergenic
1174115617 20:48224647-48224669 CCTGGGCTGAAAGCTTTTCCTGG - Intergenic
1174810649 20:53642586-53642608 CGTGGTCTGAGAGCTTTCTTTGG - Intergenic
1179922596 21:44515313-44515335 CGTGGTCCCAGCGCCTTCCCAGG + Intronic
1181312002 22:21949950-21949972 CCTGCTCTGAGCACTCTTCCTGG + Intronic
950425727 3:12923862-12923884 CCTGCTCTGAGTGCTCTTCCTGG + Intronic
957570764 3:81945248-81945270 CATAGTCTGAGGGCTTTTCTGGG - Intergenic
959778370 3:110199078-110199100 CTTGGTCTGCTGGCTTTTCCTGG + Intergenic
965543167 3:169890470-169890492 CGAGCTCTGAGGGCTTTTCCAGG + Intergenic
965656387 3:170989454-170989476 CGTGGCCTGAGAGCTTCCCCAGG + Intergenic
966718560 3:183038280-183038302 CCTGCTCTGAGCCCTTTCCCAGG - Intronic
966897430 3:184456357-184456379 CCTGGACTGAGCCCTTTTCTGGG - Intronic
968903061 4:3440153-3440175 GGTGGTCTGAGGGCCTTTCTGGG + Intergenic
968941695 4:3642400-3642422 CGTGCTCTGCGCGGGTTTCCGGG + Intergenic
968941714 4:3642526-3642548 CGTGCTCTGCGCGGGTTTCCGGG + Intergenic
968941717 4:3642556-3642578 CGTGCTCTGTGCTCTTCTCCAGG + Intergenic
972675624 4:41257255-41257277 CGTGGGCTGGGCGCCTTTCCTGG + Intronic
974016908 4:56656207-56656229 CCTGGACTGAGCGCTGTTGCGGG + Intronic
976815013 4:89138080-89138102 CATGGTCTGATGGCTCTTCCAGG + Intergenic
978762577 4:112370360-112370382 TATGGTCTGATTGCTTTTCCTGG + Intronic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
1005455991 6:26020566-26020588 GGTGGCCGGAGCGCTTTTGCGGG - Exonic
1010193270 6:73214756-73214778 TGTGGTGTGAGTGTTTTTCCAGG - Intronic
1015902827 6:138085159-138085181 CTTGGCCTGAGAGCTTTACCTGG + Intergenic
1016073364 6:139767785-139767807 CGGGTTCTGTACGCTTTTCCAGG + Intergenic
1017722659 6:157254830-157254852 CCTGGGCTGAGGGCTTTCCCAGG + Intergenic
1019879886 7:3849325-3849347 TGAGGTCTGAGCTCCTTTCCTGG + Intronic
1022133313 7:27424138-27424160 TGTGTTCTGTGCGGTTTTCCTGG - Intergenic
1023056904 7:36298187-36298209 CGTGGGCTGGCCTCTTTTCCTGG - Intronic
1023353494 7:39343775-39343797 TGTGGTCTGAGGTCTTTTTCAGG + Intronic
1025955145 7:66177021-66177043 CGTGGTCTGGGCACTGTTCCTGG - Intergenic
1028010344 7:85635049-85635071 TGTGGTCTGAGCCCTTAACCTGG + Intergenic
1038451000 8:27638843-27638865 GGTGGGCTGGGCTCTTTTCCTGG + Intronic
1038891141 8:31725506-31725528 TGAGGTCTCAGCACTTTTCCAGG + Intronic
1046849108 8:118952463-118952485 CATTGTCTGAGCCCTTTTCGGGG + Intergenic
1047222662 8:122930984-122931006 CCTGGCCTGAGGGCTGTTCCAGG + Intronic
1054777365 9:69134838-69134860 CGTGGTGAGAACCCTTTTCCTGG + Intronic
1057952050 9:99376983-99377005 CGTGGTTTGGGCACTTTTTCTGG + Intergenic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1190792662 X:53714605-53714627 CGTGGTTTGAGTGTTGTTCCTGG - Intergenic
1192338859 X:70245190-70245212 CCTGGTAAGGGCGCTTTTCCTGG + Intergenic