ID: 902394783

View in Genome Browser
Species Human (GRCh38)
Location 1:16126678-16126700
Sequence CAGACCACGGTGAAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 185}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902394776_902394783 21 Left 902394776 1:16126634-16126656 CCACACACTTGAAGGTCTCAAAT 0: 1
1: 0
2: 0
3: 16
4: 167
Right 902394783 1:16126678-16126700 CAGACCACGGTGAAGGAGACAGG 0: 1
1: 0
2: 2
3: 14
4: 185
902394780_902394783 -9 Left 902394780 1:16126664-16126686 CCTGGAAAAGCGCTCAGACCACG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 902394783 1:16126678-16126700 CAGACCACGGTGAAGGAGACAGG 0: 1
1: 0
2: 2
3: 14
4: 185
902394779_902394783 -8 Left 902394779 1:16126663-16126685 CCCTGGAAAAGCGCTCAGACCAC 0: 1
1: 0
2: 2
3: 6
4: 92
Right 902394783 1:16126678-16126700 CAGACCACGGTGAAGGAGACAGG 0: 1
1: 0
2: 2
3: 14
4: 185
902394775_902394783 22 Left 902394775 1:16126633-16126655 CCCACACACTTGAAGGTCTCAAA 0: 1
1: 0
2: 0
3: 10
4: 159
Right 902394783 1:16126678-16126700 CAGACCACGGTGAAGGAGACAGG 0: 1
1: 0
2: 2
3: 14
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902394783 Original CRISPR CAGACCACGGTGAAGGAGAC AGG Intronic
900867218 1:5277084-5277106 CAGGACACAGCGAAGGAGACGGG + Intergenic
902378572 1:16041953-16041975 CAGGGCACGCTGAAAGAGACAGG - Intergenic
902394783 1:16126678-16126700 CAGACCACGGTGAAGGAGACAGG + Intronic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
904975647 1:34454213-34454235 CAGACCACAGTTAAGGTGTCAGG + Intergenic
906261445 1:44394456-44394478 GAGAAGTCGGTGAAGGAGACTGG - Intergenic
909595958 1:77406317-77406339 CAGGCCACGGTGCAGGAAAAAGG + Intronic
910669550 1:89759321-89759343 CAGAACACAAGGAAGGAGACTGG + Intronic
912386051 1:109271714-109271736 CTGACCTCGGTGAGGGAGCCAGG + Exonic
912548379 1:110467410-110467432 CAGTCCCAGCTGAAGGAGACAGG - Intergenic
913203507 1:116515332-116515354 CAGACCACGGGGGAGGAGGCCGG - Intronic
914718293 1:150268937-150268959 CAGACCCCGGGGAAGGGGAAGGG + Exonic
914901198 1:151712054-151712076 CAGGCCACGAAGAAGGAGGCTGG - Intronic
917210672 1:172628891-172628913 CAGGCCACCGTGAAGGAAAATGG - Intergenic
919823907 1:201490338-201490360 CAGACCACTGTGGAGGGGAAGGG + Exonic
920022187 1:202964943-202964965 CACTCCCTGGTGAAGGAGACAGG + Intronic
920503667 1:206501389-206501411 CAGAGCACAGAGGAGGAGACAGG + Intergenic
920696049 1:208182017-208182039 CAGGCCACGGTGAAAGAGACAGG - Intronic
920738490 1:208557808-208557830 CAGGCCACACTGAAGGTGACAGG - Intergenic
921369673 1:214408555-214408577 CAGATGACAGTGAAGAAGACAGG + Intronic
922534947 1:226372778-226372800 TAGACCAAGGTGTGGGAGACTGG + Intronic
922758103 1:228107837-228107859 CAGAGCACCGTGAAGGCCACCGG - Exonic
922961255 1:229647540-229647562 CCGACCACTGTGAGGGACACAGG - Exonic
924830498 1:247588996-247589018 GAGACCAGGATGAATGAGACAGG - Exonic
1064284963 10:13984106-13984128 CTGACCACGGTGAAGTGGCCTGG + Intronic
1064417068 10:15159131-15159153 CAGTCCACTGTGATGGAGAAGGG - Intronic
1072472914 10:95731211-95731233 CAGAGCAGGGTGGAGGAGAATGG - Intronic
1073178210 10:101569288-101569310 CACAGGAAGGTGAAGGAGACAGG - Intergenic
1075107257 10:119548506-119548528 CAGACCACAGAGAAGAGGACAGG + Intergenic
1075996504 10:126880740-126880762 CAGACCACAGGGAAGGGGAATGG + Intergenic
1076564974 10:131392474-131392496 CAGAACACACTGACGGAGACTGG - Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1079152408 11:17912170-17912192 GAGAAGATGGTGAAGGAGACAGG + Intronic
1081385828 11:42471694-42471716 CTGACCACTGTGAATGAGCCAGG + Intergenic
1082162419 11:48900303-48900325 CAGGCCAAGGTGCAGGAGAAGGG - Intergenic
1083171267 11:60925065-60925087 CAGACCACAGTGAGGGAGTGGGG - Intronic
1085121935 11:73973040-73973062 CAAACCAGGGTAAAGGTGACAGG - Intergenic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1086775306 11:90823795-90823817 CAGTAAAAGGTGAAGGAGACAGG + Intergenic
1088696173 11:112367752-112367774 AAGACAACAGGGAAGGAGACAGG + Intergenic
1089453766 11:118613882-118613904 CAGACCATGGTGCAGGTGAGTGG + Exonic
1090397963 11:126431709-126431731 AAGACCAGGGTGGAGGACACAGG + Intronic
1091178485 11:133582089-133582111 CAGATCACTCTGAAGGAGAAAGG + Intergenic
1092123485 12:6060359-6060381 CACACCCAGGGGAAGGAGACCGG + Intronic
1092141066 12:6183623-6183645 CTGACCACAGTCTAGGAGACAGG + Intergenic
1096694287 12:53338939-53338961 CAGGGCACTGGGAAGGAGACTGG - Intronic
1098270187 12:68762438-68762460 CAGGCCAAGTTCAAGGAGACTGG + Intronic
1098366827 12:69712219-69712241 CAGAGCAGGGTGGAGAAGACTGG + Intergenic
1098957130 12:76699121-76699143 CAGACCCCTGTGGTGGAGACAGG + Intergenic
1099390431 12:82072347-82072369 CAGACCACAGTTAAGGAGTATGG + Intergenic
1101371036 12:104130845-104130867 AAGATCAAGGTGCAGGAGACAGG + Intronic
1103774093 12:123352759-123352781 CAGACCACTGTGTAGAAGAGTGG + Intronic
1103795207 12:123498623-123498645 CAGACCAAGGAGCAGGAGATGGG - Exonic
1103909948 12:124346658-124346680 GTGGCCACGGTGAAGGAGGCGGG - Exonic
1107750351 13:43558465-43558487 CAGAACACTCTGAAGGAGCCAGG + Intronic
1111597355 13:90428397-90428419 CTGGCCATGTTGAAGGAGACAGG + Intergenic
1111905958 13:94256463-94256485 CAGACCAAGAGCAAGGAGACTGG + Intronic
1113857290 13:113454396-113454418 CAGGCCCCGAGGAAGGAGACGGG - Intergenic
1116172887 14:41426110-41426132 GAGCCCACTGTGCAGGAGACCGG + Intergenic
1117061951 14:51972492-51972514 CACAGCACACTGAAGGAGACAGG - Intronic
1117315878 14:54569579-54569601 CACACCCCAGTGAAGGAGGCTGG - Intronic
1118579720 14:67283168-67283190 CACACCACGGGGAAGAAAACCGG + Intronic
1118596263 14:67437798-67437820 TTTACCACGGTGGAGGAGACTGG + Intergenic
1121090405 14:91177609-91177631 CAGACCATGGTCATGGACACTGG + Intronic
1121329341 14:93040326-93040348 CAGGCCACAGTGAAGGACATTGG - Intronic
1121901629 14:97698162-97698184 GAGAGCACTGTGAAGGTGACTGG - Intergenic
1123137110 14:106038180-106038202 CAGATCACCTTGAAGGAGTCTGG - Intergenic
1125010958 15:34874663-34874685 CAGAGCAAGGTAAAAGAGACAGG - Exonic
1125549913 15:40537466-40537488 CAGAGCAAGGGGTAGGAGACAGG - Intronic
1127207183 15:56733305-56733327 CAGAGCGCGGGGGAGGAGACCGG - Intronic
1127370272 15:58332472-58332494 CAGAGCCCTGTGAAGGAGACAGG + Intronic
1131098199 15:89669304-89669326 CAGACCACAGGGAAAGAGAAGGG - Intronic
1132285900 15:100662134-100662156 CAGACCACTCTGAAGGAAAAAGG + Intergenic
1135413588 16:22252597-22252619 CAGACCACAGGGACTGAGACTGG + Intronic
1136146162 16:28317779-28317801 CAGCCCAGGGGGAAAGAGACTGG + Intronic
1140178522 16:72690044-72690066 CAGACCACACTCAAGGAGACGGG - Intergenic
1142030126 16:87834452-87834474 CAGACCCCGAAGAAGTAGACGGG + Exonic
1142264635 16:89058046-89058068 CAGGCCCTGGTGGAGGAGACAGG - Intergenic
1143326697 17:6103687-6103709 CAGCGCACGGAGAAGGGGACTGG + Intronic
1145040190 17:19572227-19572249 CAGTACAGGGTGAGGGAGACAGG - Intronic
1146471186 17:33126373-33126395 GAGACCAAAGTGGAGGAGACTGG - Intronic
1156474385 18:37396486-37396508 AAGACCACGGTGAGTGAGTCAGG + Intronic
1160343814 18:78112781-78112803 CAGCACACGGTCAAGGAGAGAGG + Intergenic
1162921588 19:13906372-13906394 CAGAGCCCGGGGAAGGAGGCAGG + Exonic
1163361091 19:16846875-16846897 CAGCCCTCCGTGAAGGGGACAGG - Intronic
1164438786 19:28255606-28255628 CAGCCAAAGGTGTAGGAGACAGG + Intergenic
1167146353 19:47682483-47682505 GAGGCCACGGTTCAGGAGACGGG - Intronic
1167349856 19:48967894-48967916 CAGACCCAGGGGAAGGAGAAGGG - Intergenic
1167353726 19:48991438-48991460 CAGACGAAGGCGAAGGTGACAGG - Exonic
1167715293 19:51138992-51139014 CAGACATTGGTGCAGGAGACAGG + Intergenic
1168686548 19:58352635-58352657 CATAAGACTGTGAAGGAGACAGG + Intronic
925183987 2:1834779-1834801 CATACCACGGGGATGGATACAGG + Intronic
925183995 2:1834812-1834834 CATACCACGGGGATGGATACAGG + Intronic
925184001 2:1834845-1834867 CATACCACGGAGATGGATACAGG + Intronic
925184016 2:1834911-1834933 CATACCACGGGGATGGATACAGG + Intronic
925184031 2:1834977-1834999 CATACCACGGGGATGGATACAGG + Intronic
925184039 2:1835010-1835032 CATACCACGGGGATGGATACAGG + Intronic
925184047 2:1835043-1835065 CATACCACGGGGATGGATACAGG + Intronic
927848461 2:26484359-26484381 GAGAGCAGGGTGAGGGAGACGGG + Intronic
931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG + Intergenic
931240977 2:60452511-60452533 CAGACCACGCTGACGTCGACTGG + Intronic
931965721 2:67532006-67532028 CAGACCAAAGGAAAGGAGACTGG + Intergenic
932444323 2:71765781-71765803 CACAGCACAGTGAAGGAGAGAGG - Intergenic
933985371 2:87586693-87586715 CAGACCAGGTTGAAGGAGAAGGG + Intergenic
935591052 2:104845467-104845489 CAGGGAGCGGTGAAGGAGACTGG - Intergenic
936308470 2:111364116-111364138 CAGACCAGGTTGAAGGAGAAGGG - Intergenic
940754246 2:157663518-157663540 CAGACTACGGGGAAGGAGACTGG + Intergenic
942058175 2:172204656-172204678 CAGAGCAGGGTGAGGGAGACTGG - Intergenic
942692543 2:178601467-178601489 CAGACGACGATGGAGGAGACAGG - Exonic
944542981 2:200771320-200771342 CAGACCCCAGCCAAGGAGACAGG + Intergenic
947749415 2:232524861-232524883 CAGGCCATCGTGAAGGAGTCTGG - Intronic
947845100 2:233237432-233237454 CTGACCCTGGTGAAGGAGAGAGG + Intronic
1168801211 20:644424-644446 CAGACCAGAATGAGGGAGACTGG + Intergenic
1170368208 20:15619797-15619819 GAGAACACCGTGGAGGAGACAGG - Intronic
1170757482 20:19217219-19217241 CAGCCCACGTTGAAGGAGAAGGG + Intronic
1172145368 20:32754038-32754060 CAGACTCAGGTGAAGAAGACAGG - Intergenic
1173228658 20:41177194-41177216 CAGACCAGGGACAAGTAGACTGG + Intronic
1173451429 20:43167583-43167605 CAGAGCATGGTAAAGGTGACGGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174677589 20:52373298-52373320 GAGAGCAATGTGAAGGAGACAGG - Intergenic
1176965855 21:15210536-15210558 CACACCACGGGCAAGGACACAGG + Intergenic
1177112181 21:17041962-17041984 CAGAGGACGTAGAAGGAGACAGG + Intergenic
1179075624 21:38118688-38118710 CAGGCCACTTTGAAGGACACAGG + Intronic
1179395509 21:41036476-41036498 AAGCCCAAGGGGAAGGAGACAGG + Intergenic
1179727163 21:43347064-43347086 CAGACCACAGTGAGGGGGCCAGG + Intergenic
1180338858 22:11601537-11601559 ACGAGGACGGTGAAGGAGACTGG - Intergenic
1182285888 22:29246703-29246725 CAGGCCAGGCTGAAGGAGACTGG + Intronic
1182768643 22:32777151-32777173 CATTCCACAGAGAAGGAGACAGG + Intronic
1183393428 22:37559005-37559027 CAAACCCGGCTGAAGGAGACTGG - Intergenic
1184077849 22:42194705-42194727 CAGGGCATGGTGGAGGAGACTGG + Intronic
1184356089 22:43980466-43980488 CAGAGCACGGTGAGGGAGCAAGG + Intronic
1184452356 22:44590716-44590738 CAGACCACTGAGTGGGAGACAGG + Intergenic
950206417 3:11084539-11084561 AAGACCACGGCGGAGGAGAAAGG + Intergenic
950448604 3:13053144-13053166 CACACCACGATGATGGAGAAAGG + Intronic
951724070 3:25736352-25736374 CTGACCACGTTAAAGGAGATTGG - Intronic
952978205 3:38714128-38714150 CAGTCCTCGTGGAAGGAGACAGG + Intronic
961096069 3:124157963-124157985 CAGAGCACTGTTAAGGAGAAAGG + Intronic
961192085 3:124970489-124970511 GTGACCACAGTGGAGGAGACAGG - Exonic
961441647 3:126957131-126957153 CAGGCCCCAGTGAAGGAGCCCGG + Intronic
961546179 3:127635162-127635184 CAGTACACTGTGAAGGAGAAAGG - Intronic
963484268 3:145916614-145916636 CAGACCACGTTGAATAAGAGTGG - Intergenic
964412281 3:156410387-156410409 CATACCACACTGAAGGAGATGGG - Intronic
965801644 3:172499785-172499807 CAGACCAATGTCAAGGATACAGG - Intergenic
969927413 4:10597827-10597849 GAGACCAAGGTGCAGGAGAAGGG - Intronic
973852435 4:54974585-54974607 CAGAGGACGGTGAGGGATACAGG - Intergenic
979099625 4:116598881-116598903 CAGACCAAGATGGAGGAGATCGG + Intergenic
981391059 4:144192457-144192479 CAGAACATGATAAAGGAGACTGG - Intergenic
981724699 4:147834797-147834819 CTGACCCAGGGGAAGGAGACAGG - Intronic
981936819 4:150248262-150248284 CAGACCACAGAGGAGGAGAAAGG - Intronic
983484733 4:168320077-168320099 GAGATCACAGTGAAGGAGACAGG - Intergenic
983622516 4:169775274-169775296 CACACCACGGTGCAAGAGACGGG - Intergenic
984999438 4:185469953-185469975 CAGAGCACGGGGCAGGAGAAGGG - Intronic
987010860 5:13762685-13762707 CAGACCTGGGTGAAGGTGGCTGG - Intronic
988636705 5:32992292-32992314 CAGACCACGGAGGAGAAGATGGG + Intergenic
988929528 5:36023162-36023184 CAGACCACAGTGAAGAAAATTGG - Intergenic
990669473 5:58111841-58111863 CAGAACACTTTGAAGGAGATGGG + Intergenic
991649391 5:68836671-68836693 CTGACCCCTGTGAAGGAGACAGG - Intergenic
1001169834 5:169408700-169408722 CAGGCCACTTTGATGGAGACTGG + Intergenic
1001289313 5:170445246-170445268 GAGACAACAGTGAAGGAGGCAGG - Intronic
1002276856 5:178109432-178109454 GAGGCCAAGGTCAAGGAGACGGG + Intergenic
1004788926 6:19001927-19001949 AAGACCACCGTGATGGAGAGAGG + Intergenic
1005380148 6:25225395-25225417 CAGCCCATGGTGAAGGCAACTGG - Intergenic
1006751492 6:36380717-36380739 GAGACCACAGTGACTGAGACAGG - Intronic
1007727928 6:43927889-43927911 CAGAGCCCGGTGAAGCAGAGGGG + Intergenic
1007784598 6:44272399-44272421 CAGAACATGGGGAATGAGACTGG + Intronic
1008491321 6:52089967-52089989 CTGACCACAGTGAAAGAGAGGGG - Intergenic
1011198067 6:84802963-84802985 CAGAGCAGGGTGGAGAAGACTGG - Intergenic
1012599698 6:101079867-101079889 CAGATGAGGGTGAAGGAGAGTGG - Intergenic
1013437570 6:110126831-110126853 CAGATTAGGGAGAAGGAGACAGG - Intronic
1016471411 6:144378549-144378571 GAGAACAGGGTGAAGGAGGCAGG + Intronic
1017728710 6:157295514-157295536 CAGACCACTGGAAGGGAGACTGG - Intronic
1021023867 7:15640284-15640306 CTGGCTACCGTGAAGGAGACTGG + Intronic
1021791271 7:24208241-24208263 CCAACCAAAGTGAAGGAGACTGG + Intergenic
1022442944 7:30448619-30448641 CACACGACCGTGAAGGACACAGG + Intronic
1026607243 7:71826610-71826632 CAGACCATGTTGGAGGGGACAGG + Intronic
1028746529 7:94333704-94333726 CAGCCCACGGTTGAGGAGAGGGG - Intergenic
1029667411 7:102004703-102004725 CAGACCACGTGGAAGGAACCAGG - Intronic
1037101512 8:15052824-15052846 CAGAACACGTTGAAGGATAATGG + Intronic
1042191944 8:66195924-66195946 CAGACTATACTGAAGGAGACAGG + Intergenic
1042391541 8:68241330-68241352 CAGATTAGGGAGAAGGAGACAGG + Intergenic
1042409832 8:68451569-68451591 AAGCCCAAGGTGAAGGAGAGAGG + Intronic
1042805247 8:72764176-72764198 CAGAGCACAGTGACGGAGAAAGG + Intronic
1044537583 8:93375119-93375141 CAGACCTCAGTGAAGAAGAGAGG + Intergenic
1044568624 8:93693173-93693195 CAGCCCACACTTAAGGAGACAGG + Intergenic
1044701374 8:94968228-94968250 CAGGCCACGCTGAAGGGGAGGGG + Intronic
1045320154 8:101076285-101076307 CAGACCACACTCAAGGAGAGCGG - Intergenic
1045640172 8:104241074-104241096 CAGAGCACAGTGAAGGAGTCAGG - Intronic
1051107052 9:13592429-13592451 CAGACTACTGGGAAGGAAACAGG + Intergenic
1053566177 9:39254962-39254984 CAGCCCACGGTGCAGGGGAGGGG - Intronic
1053831946 9:42092813-42092835 CAGCCCACGGTGCAGGGGAGGGG - Intronic
1054130971 9:61364046-61364068 CAGCCCACGGTGCAGGGGAGGGG + Intergenic
1054598597 9:67094613-67094635 CAGCCCACGGTGCAGGGGAGGGG + Intergenic
1057415960 9:94862498-94862520 CAGAGCATGTTCAAGGAGACTGG - Intronic
1057448444 9:95135976-95135998 AAGAACACTGTGAAGGAGATAGG - Intronic
1058035405 9:100247196-100247218 AAGAGCACAGTAAAGGAGACTGG - Intronic
1203793305 EBV:162991-163013 CTGACCCCGGTGCCGGAGACGGG - Intergenic
1185553468 X:1002245-1002267 CAGACCCTGGAGAAGGAGAGGGG + Intergenic
1191965019 X:66748496-66748518 CAGACCACGGTGGAATAAACTGG - Intergenic
1192169971 X:68848133-68848155 CAGACAACGGGCAAGGGGACGGG - Intergenic
1194808803 X:98364637-98364659 CAGCCCACTGTGCAGGAGACTGG - Intergenic
1199839512 X:151630324-151630346 CAGACAAGGGTGAGGGTGACAGG - Intronic
1200024485 X:153245187-153245209 CTGAACACTGTGGAGGAGACCGG - Intergenic