ID: 902398465

View in Genome Browser
Species Human (GRCh38)
Location 1:16144883-16144905
Sequence CTCTGGGTTGTGTGTGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 276}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902398456_902398465 21 Left 902398456 1:16144839-16144861 CCTCAGTTTCCTCATCTGTAAAA 0: 820
1: 4098
2: 9933
3: 17082
4: 22900
Right 902398465 1:16144883-16144905 CTCTGGGTTGTGTGTGAAGATGG 0: 1
1: 0
2: 1
3: 16
4: 276
902398460_902398465 12 Left 902398460 1:16144848-16144870 CCTCATCTGTAAAATGGGGATCA 0: 18
1: 452
2: 2038
3: 5504
4: 10610
Right 902398465 1:16144883-16144905 CTCTGGGTTGTGTGTGAAGATGG 0: 1
1: 0
2: 1
3: 16
4: 276
902398455_902398465 26 Left 902398455 1:16144834-16144856 CCGGACCTCAGTTTCCTCATCTG 0: 10
1: 111
2: 530
3: 1527
4: 3312
Right 902398465 1:16144883-16144905 CTCTGGGTTGTGTGTGAAGATGG 0: 1
1: 0
2: 1
3: 16
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902398465 Original CRISPR CTCTGGGTTGTGTGTGAAGA TGG Intronic
901699591 1:11038039-11038061 AGCTGGGTTATGTGGGAAGATGG + Intronic
901794025 1:11670287-11670309 CTCTAAGTTCAGTGTGAAGAGGG + Intronic
902334526 1:15747429-15747451 CTCTGGGTTGTTGCTGGAGAGGG - Intronic
902398465 1:16144883-16144905 CTCTGGGTTGTGTGTGAAGATGG + Intronic
902728965 1:18356279-18356301 CTCTGGGGTGTGTGTGGTGGGGG - Intronic
903559241 1:24215652-24215674 CTCTGGCTGCTGTGTGCAGAAGG + Intergenic
903655688 1:24947712-24947734 CTCTGGGTTGTGGGGAAAGGAGG - Intronic
904417768 1:30373598-30373620 CCCTGGTCTGTGTGTGAGGACGG + Intergenic
904671732 1:32171093-32171115 CTTTGGGTTTTGTGACAAGAAGG + Exonic
905484069 1:38283402-38283424 CTCTGGGTTTTATAAGAAGATGG + Intergenic
907615707 1:55923752-55923774 CTTTGGGTGGTATGTGAATAAGG - Intergenic
911770638 1:101736676-101736698 ATCTGAGCTGTCTGTGAAGACGG + Intergenic
913370096 1:118089145-118089167 CTGTGTGTTGTGTGGGGAGAGGG + Intronic
914338490 1:146738558-146738580 GTGTGGGGTGTGTGTGCAGAAGG + Intergenic
916474188 1:165152985-165153007 TTCTGGGATGTCTGTCAAGAAGG - Intergenic
916856866 1:168759056-168759078 CACTGGGTTGAGTGGGCAGAAGG + Intergenic
917929248 1:179812538-179812560 CACTGGGGTGTGTGCCAAGAGGG + Intronic
918148795 1:181780851-181780873 CTCTGGTGTGTGTGTGCAGCAGG - Intronic
919918229 1:202152358-202152380 GTCTGGGTTCTGCGTGAAGGAGG + Intronic
920999345 1:211026790-211026812 CTCTGGGTTGTGGGGGATGGAGG - Intronic
921470543 1:215543162-215543184 CTCTGGGTTATGGGGGAAAAGGG - Intergenic
1062859863 10:802997-803019 CTCTGGGTTTACTGAGAAGAGGG + Intergenic
1064567190 10:16653386-16653408 CTCTGTTGTGTGTGTGCAGAGGG + Intronic
1066231233 10:33435781-33435803 CTCTGGCTACTGTGTGGAGAAGG - Intergenic
1066998916 10:42588014-42588036 CCCTGGGTTGTGCATGCAGATGG - Intronic
1069619697 10:69829262-69829284 TTCTGGCTTCTGTGTAAAGAAGG - Intronic
1070682355 10:78457322-78457344 CCCTGGGTTGTGGGGGAAGGGGG - Intergenic
1071470045 10:85977666-85977688 CACTGCGTTGTGTCTGGAGAGGG - Intronic
1072899361 10:99393752-99393774 CTCTGGGTTGTTGGGGAAGAGGG - Exonic
1074297531 10:112204387-112204409 CACTGGCTTGAGTGGGAAGAGGG + Intronic
1074574166 10:114652722-114652744 CTCTTGTTTGTTTGTCAAGAAGG + Intronic
1075455425 10:122581932-122581954 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075457548 10:122594635-122594657 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075458629 10:122601130-122601152 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459260 10:122605189-122605211 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459892 10:122609248-122609270 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075460524 10:122613307-122613329 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1076327892 10:129642583-129642605 CTCAGGGGTGTGTGTGGAGGGGG + Intronic
1076804711 10:132849662-132849684 CCCTGGGCTGAGAGTGAAGAAGG + Intronic
1077462872 11:2719521-2719543 CTCTGGGATTTGTGTGCAGGGGG - Intronic
1078613001 11:12838173-12838195 TTCTGGGTTCTGTGTTAATACGG + Intronic
1078792534 11:14558942-14558964 CTCTGGGTTGTTGGTCAAGTGGG + Intronic
1080124095 11:28710950-28710972 CTCTGGCTGCTGTGTGAGGAAGG + Intergenic
1083050890 11:59775516-59775538 CTCTTTGTTAGGTGTGAAGATGG + Intronic
1083262496 11:61530805-61530827 CTCAGGGTTGTGGCTTAAGAAGG - Intronic
1083752827 11:64770598-64770620 GTCTGGGGTGTGTGTGAGAAAGG + Intronic
1085844271 11:80047977-80047999 TTTTGGGTTGTTTGGGAAGAAGG - Intergenic
1086338545 11:85824319-85824341 CTGTTGGGTGTGTGTGAGGAGGG + Intergenic
1087450025 11:98308852-98308874 CTTTGTGTTGTGTGTGGGGATGG + Intergenic
1089515272 11:119028093-119028115 CTCTGGGTTGGGTGTGGAGGTGG + Intronic
1090356820 11:126146178-126146200 CTCTGGGATGTGTGTTGGGACGG + Intergenic
1092993331 12:13924480-13924502 CTCTGGCTTTTGGGAGAAGAAGG + Intronic
1093194372 12:16112607-16112629 CTCTAGGTCCTGGGTGAAGAAGG + Intergenic
1094431442 12:30374243-30374265 GTGTGGGTTGTGTATGTAGAAGG - Intergenic
1095959556 12:47825618-47825640 CTCAGGGTTGGGAGTGAAGCTGG - Intronic
1097492721 12:60290826-60290848 CACTGGCTAGTGTGAGAAGAGGG + Intergenic
1098847461 12:75555329-75555351 TTTTCTGTTGTGTGTGAAGAAGG - Intergenic
1101287448 12:103329512-103329534 TTCTGGGATGCATGTGAAGAAGG - Intronic
1101773971 12:107776942-107776964 CTTTGGTTTGTGGGGGAAGAAGG + Intergenic
1103055974 12:117820674-117820696 CTCTGGGTTGTAGGGGAAGGAGG - Intronic
1103412061 12:120719457-120719479 GTCAGGGTTGTGTGTGGAGGTGG + Intronic
1104038266 12:125113491-125113513 CTCTGGGTTGTGCCTGGCGATGG + Intronic
1104509494 12:129364294-129364316 CTCTGGGTATAGTGTGCAGATGG + Intronic
1104675522 12:130709729-130709751 CGCTGGGTTGGGTGGGAAGGGGG - Intronic
1104682577 12:130761681-130761703 CACTGAGCTGTGTGTGGAGAGGG - Intergenic
1105429156 13:20321463-20321485 CTCTGGGTCATGTTTTAAGAGGG + Intergenic
1105574292 13:21635978-21636000 CTCTGGGCTGTGTTGTAAGAAGG + Intergenic
1106560710 13:30843767-30843789 CTCTGTGGTGTGTGTGCATATGG + Intergenic
1107956011 13:45512284-45512306 CTCTGGGTTGTGTGACTAGAAGG + Intronic
1107961158 13:45560463-45560485 CTCTGGGCTGTGGGTGATAATGG - Intronic
1108530104 13:51320613-51320635 CTTTGGGATGTGTGTAAACAAGG - Intergenic
1109122476 13:58475312-58475334 CTATGTGATGTCTGTGAAGATGG - Intergenic
1111848027 13:93536071-93536093 CCCTGGGTGGTGTGGGAACACGG + Intronic
1113475234 13:110575965-110575987 CTCTGGGGTGTGTGGGAGGGAGG - Intergenic
1113583704 13:111448486-111448508 CTCAGGGTTTTGTGTGATGTGGG + Intergenic
1113701649 13:112393101-112393123 CTCTGGCCTGTACGTGAAGAGGG + Intronic
1116543367 14:46129811-46129833 CTTTGGGTAATGTTTGAAGAAGG + Intergenic
1120206335 14:81591020-81591042 CTCTGGGTAGTGGTTGAAGATGG + Intergenic
1121302294 14:92881341-92881363 CTCTGGGCTCTGTGCAAAGAGGG - Intergenic
1121577640 14:95001442-95001464 CTCTGGGTGGTGGGTTCAGATGG + Intergenic
1122225029 14:100270764-100270786 TTCTGTGTTGAGTGTGAAGATGG - Intronic
1122635852 14:103129339-103129361 CTCTGGCTGCTGGGTGAAGAAGG + Intronic
1122722528 14:103730307-103730329 CTCAGGGATGTGTGTGGAGCCGG + Intronic
1123756854 15:23403637-23403659 ATCTGGGCTGTGTCTGAAGCGGG - Intergenic
1124420651 15:29518559-29518581 CTCTGGGTTGCGGGTCCAGAAGG - Intronic
1125083998 15:35708674-35708696 CTCTGTCTTCTGTGTGGAGATGG + Intergenic
1125580694 15:40783395-40783417 CTCTGGGATGGGTGAGAGGAAGG + Intronic
1127254138 15:57274149-57274171 CTTTCGATTTTGTGTGAAGACGG + Intronic
1127338407 15:58013933-58013955 CTCTTGGTTCAGTGTGGAGAAGG - Exonic
1127671071 15:61195617-61195639 CTGGGGGTTGTGTGTGGAGAAGG - Intronic
1127690363 15:61389617-61389639 CTGTGGGTGGTTTGTGAAGAAGG + Intergenic
1127785027 15:62348202-62348224 CACTGGGCTGTGGGTGGAGAGGG + Intergenic
1128523351 15:68390200-68390222 CTCTGAGTTGTGAGTGAGGTGGG + Intronic
1128997954 15:72310519-72310541 CTCTGGCTATGGTGTGAAGAAGG - Intronic
1129126556 15:73446876-73446898 CTCTGGCTGTGGTGTGAAGATGG + Intronic
1131403639 15:92145966-92145988 CTCTGTGTTCTGTGGGGAGAGGG + Intronic
1131824387 15:96306321-96306343 CTCTGGGTTCAGTGGGAAGTTGG + Intergenic
1131829280 15:96344014-96344036 CTCTGGGTTGGGGGTGAGGTGGG + Intergenic
1132770597 16:1560545-1560567 CTCAGGGGTGTGTGTGGAGCCGG + Intronic
1132791776 16:1694117-1694139 TTCTGGGATGTAAGTGAAGAAGG + Intronic
1133913648 16:10088444-10088466 CTCAGGGCTGTGAGTGAGGATGG + Intronic
1134046787 16:11107034-11107056 CTCTTGGTGGTGTGGGCAGAGGG + Intronic
1134459482 16:14419125-14419147 ATCTGGGCTGTGTCTGAAGCCGG + Intergenic
1134749890 16:16617625-16617647 CTCTGGCTGCTGTGTGGAGAAGG + Intergenic
1134995586 16:18735990-18736012 CTCTGGCTGCTGTGTGGAGAAGG - Intergenic
1136143608 16:28302452-28302474 CTCTGGGCAGGGTGTGAAGGGGG + Intronic
1136870493 16:33803127-33803149 CTTTGAGTTGTCTGTGGAGATGG - Intergenic
1138773079 16:59687862-59687884 CCCTGGGTTGAGAGTGAGGAGGG - Intergenic
1139259209 16:65576015-65576037 TTTTGGGGTATGTGTGAAGATGG + Intergenic
1139995788 16:70978796-70978818 GTGTGGGGTGTGTGTGCAGAAGG - Intronic
1140428829 16:74884270-74884292 CTTTGGGTTGTGTTTTAAGAGGG - Intronic
1140719016 16:77753660-77753682 CTCTGGATGTTGGGTGAAGAAGG - Intergenic
1142195562 16:88737843-88737865 CTCTGGGTGGGGTGTGGAGCTGG - Intronic
1203101679 16_KI270728v1_random:1312923-1312945 CTTTGAGTTGTCTGTGGAGATGG + Intergenic
1143125571 17:4639377-4639399 CTCTGGGCTGTGTGAGAAGCTGG - Intronic
1144455962 17:15418454-15418476 CGCTGGTATGTGTGTGAGGATGG + Intergenic
1145842057 17:28003518-28003540 CTCTGGCTGCTATGTGAAGAAGG + Intergenic
1146519650 17:33516253-33516275 GTTCTGGTTGTGTGTGAAGAAGG - Intronic
1146651416 17:34609161-34609183 GTCTGGGGGGTGTCTGAAGAAGG + Intronic
1151509609 17:74550200-74550222 CTCTGGGGTCTGGGGGAAGAGGG - Intergenic
1151680146 17:75618893-75618915 CTCTGGGCAGTGAGTGAAAAGGG + Intergenic
1152587701 17:81196382-81196404 GTCTGGGGTGTGTGAGAATAGGG - Intronic
1155045630 18:22100655-22100677 CTCTGGCTGCTGTGTGGAGATGG + Intergenic
1156698181 18:39793417-39793439 TTGTGGGTTGTGTGTGGTGAGGG - Intergenic
1156740153 18:40316281-40316303 CTCTGTTTTGTGGGTGAAAATGG - Intergenic
1156883584 18:42108687-42108709 GTCTGGTTTGTATGTGAAGGTGG + Intergenic
1156997019 18:43481098-43481120 CTCTAGGTGGTGTGAGAAGCTGG + Intergenic
1157404611 18:47412491-47412513 CGCAGGGGTGTGTGGGAAGAAGG - Intergenic
1157638453 18:49186685-49186707 CTCTTCGGTGTGAGTGAAGATGG - Intronic
1158068480 18:53441772-53441794 CTCTGGCTGTTGTGTGGAGAGGG - Intronic
1159172532 18:64789872-64789894 CACAGGGTTGTGTGTTAAGTAGG + Intergenic
1159888397 18:73932397-73932419 TTCTGTGTTCTGTGTGAAGGAGG + Intergenic
1160179375 18:76620518-76620540 CGCTTCGTTGCGTGTGAAGAAGG - Intergenic
1160719581 19:591286-591308 CCGTGGGCTGTGTGTGAACAGGG + Intronic
1160827828 19:1088944-1088966 CCCTGGGCTGAGTGTGAAGTGGG + Intronic
1161197726 19:2996358-2996380 CCCTAGCTTGTGTGGGAAGAAGG - Intergenic
1162788842 19:13052784-13052806 CTCTGGTCTGTGTGTGTGGACGG - Intronic
1162942730 19:14023159-14023181 CTCTGAGTTCATTGTGAAGATGG - Intergenic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164407957 19:27971473-27971495 CTATAGGTTGGCTGTGAAGAGGG - Intergenic
1166059995 19:40320233-40320255 CTCTGGCTTCTGTGAGGAGAAGG - Exonic
1166241989 19:41500555-41500577 CTCTGGGTTGTGTGCTGAGGAGG - Intergenic
1166248808 19:41551501-41551523 CTCTGGGTTGTGTGCCGAGCAGG + Intronic
1166485152 19:43206084-43206106 CTCTGTGTTGTCTGGTAAGAGGG + Intronic
1167446135 19:49538732-49538754 CTCTGCTTTATGTGTGAACATGG - Intronic
925176231 2:1785757-1785779 CACAGGGATGTGTGTGCAGATGG - Intergenic
925952068 2:8924167-8924189 CTCTGAATCTTGTGTGAAGATGG - Intronic
928900953 2:36317025-36317047 ATCTGGGGTGTGTGTGGACAAGG - Intergenic
928949564 2:36802602-36802624 CTCTGTCATGTGTGTGATGAAGG - Intronic
929545963 2:42855404-42855426 CTCTGGGTAGGGTGTGAATGGGG - Intergenic
930375784 2:50565073-50565095 CTTTGGGTTGTGTGAGAATTTGG - Intronic
930614399 2:53578589-53578611 CTCTGGTTACAGTGTGAAGAAGG + Intronic
930769668 2:55118978-55119000 GGCTGATTTGTGTGTGAAGAAGG + Intergenic
933177387 2:79190915-79190937 CTATGGGTAGAGTGAGAAGATGG - Intronic
933676996 2:85065900-85065922 ATCAGGGTTGTGGTTGAAGAAGG - Intergenic
934157048 2:89212913-89212935 ATCTGGGTAGTGTTGGAAGAAGG + Intergenic
934210268 2:89969833-89969855 ATCTGGGTAGTGTTGGAAGAAGG - Intergenic
935807226 2:106761129-106761151 CTATCGTTTGTCTGTGAAGATGG + Intergenic
935953881 2:108355349-108355371 CTGTGGTTTGTGTGTGAGGATGG - Intergenic
936150957 2:110022269-110022291 CACTGGGTTGGGTGTGTGGATGG - Intergenic
936275356 2:111091350-111091372 TTCTGGATTGAGTGAGAAGATGG + Intronic
938163775 2:129009105-129009127 CACTGGGTAGAGTGTGAACAAGG + Intergenic
938395898 2:130947746-130947768 TGCTGGGTTGGGTGTGAGGAAGG - Intronic
939168448 2:138665348-138665370 CTCTGGCTTGTCTCTGGAGAAGG + Intergenic
941123342 2:161557473-161557495 CTCTCTGTTGTATGTGAAGCTGG - Intronic
941135683 2:161715492-161715514 CTGAGGGGTGTGTGAGAAGAGGG - Intronic
941946154 2:171100200-171100222 TTCTGGGTGATGTGTGAAGTGGG - Intronic
943792281 2:191946864-191946886 CTCTGGGTTTTGTGAAGAGAAGG + Intergenic
944360021 2:198842875-198842897 CTTTAGATTTTGTGTGAAGATGG - Intergenic
945437243 2:209833094-209833116 CTTTGGGTTCTGTGGGAAGCAGG - Intronic
946224908 2:218259300-218259322 GTGTGGGATGTGTGTGAAGGGGG - Intergenic
946565351 2:220958079-220958101 CTCTTGGTTGTGTGTCTTGAAGG - Intergenic
948433223 2:237933967-237933989 TTCTGGGCTGACTGTGAAGATGG - Intergenic
948716553 2:239869267-239869289 GTCTGTGGTGTGTGTGAGGAGGG - Intergenic
1170110008 20:12794999-12795021 CTCTGGGTTATGAGAGAGGAAGG - Intergenic
1170874137 20:20234885-20234907 CTCAGGCTGGTGTGTGAGGAGGG - Intronic
1171179486 20:23082004-23082026 CTCTAGGTGATGTGTGAAGCTGG - Exonic
1173549818 20:43924870-43924892 CACAGGGCTGTGTGTGGAGAAGG - Intronic
1175315850 20:58046013-58046035 CTCTGGGGTTGTTGTGAAGATGG + Intergenic
1175345291 20:58268652-58268674 CTCTGGGGAGTGTGTGAAGTAGG + Intergenic
1177804947 21:25866031-25866053 CACTGGGTTGTGTATCAAAAGGG + Intergenic
1180909665 22:19440546-19440568 CTCTGGCTGCTGTGTGGAGAAGG - Intronic
1181859035 22:25804233-25804255 GGCTGGGTTTTGTGTGAAAAGGG - Intronic
1182059481 22:27386806-27386828 CTCTGGGTTGTGGGGGCAGGTGG - Intergenic
1182512688 22:30830326-30830348 CACTGGGTGGTGTGTCAAGGCGG + Intronic
1183758166 22:39790221-39790243 CTTTGGCTTTTATGTGAAGAGGG + Intronic
1184147300 22:42619190-42619212 CTCTGGCTAGAGTGGGAAGAGGG - Exonic
1185197388 22:49480630-49480652 CTTTGGGTTTTGTGTCAAAAGGG - Intronic
949490293 3:4582475-4582497 CTCCGGTGTGGGTGTGAAGATGG + Intronic
950509865 3:13419784-13419806 TTCTGGGTTGTGCGGGAGGAGGG - Intronic
951030269 3:17873656-17873678 GTCTGGGTGATGTGTGAAAATGG - Intronic
951144743 3:19213939-19213961 CTCTGGTTTCTGTGTCAAGAAGG - Intronic
954195947 3:48997322-48997344 CTATGTGTTGAGTGGGAAGATGG - Intronic
954372365 3:50175511-50175533 CTCTGGGTGCTGAGTGAGGAAGG - Intronic
956556411 3:70528227-70528249 ATCTGGGTAGGGGGTGAAGAAGG - Intergenic
956912024 3:73827983-73828005 CTCTGAATTGTGTGATAAGAAGG - Intergenic
961473044 3:127129611-127129633 CTCCGGGTGGTGAGTAAAGATGG - Intergenic
961869507 3:129977345-129977367 GGCTGGGATGTGTGTGAATATGG - Exonic
962198536 3:133382732-133382754 CTCTGGGTTGTTAGTGCAGGAGG + Intronic
962356443 3:134698390-134698412 CTCTGGCTTCTGAGTGAAGGGGG + Intronic
962526245 3:136240204-136240226 CTCTAGTTTCTCTGTGAAGAGGG - Intergenic
963198552 3:142562407-142562429 CTCTGTGTCATGTTTGAAGACGG - Exonic
964481834 3:157146438-157146460 GTGAGGGTTGTTTGTGAAGATGG - Intergenic
965346096 3:167552477-167552499 CTTCTTGTTGTGTGTGAAGAGGG + Intronic
966950834 3:184815862-184815884 CTCTTGGTTAGGTGTCAAGAAGG - Intronic
971132525 4:23828478-23828500 CTGTGGGTTTGGTGTGAGGAGGG + Exonic
972170697 4:36342227-36342249 CTCTGGGTTGAAAGTGATGATGG + Intronic
972638536 4:40905416-40905438 CTCCGTGTTGTGTGTGAAGAAGG - Intronic
974433454 4:61828277-61828299 CTCTGTGTTGTGTCTTAGGATGG - Intronic
979499148 4:121418932-121418954 CTCTGGGTTGTGTGGGAGCTGGG - Intergenic
982865250 4:160501968-160501990 CTCTGGCTGCTGTGGGAAGAAGG + Intergenic
985936552 5:3101952-3101974 CTGTGTGTTCTCTGTGAAGATGG - Intergenic
987754157 5:22078624-22078646 CTCTGGGTTCTGTTTGATGGAGG - Exonic
992485002 5:77186142-77186164 CTCTGGGTTGTCTGTGATGCTGG - Intergenic
992966140 5:82002627-82002649 CACTGGGTTCTATGTGAAGGTGG + Intronic
994622279 5:102177813-102177835 CTCTGGGGTGCATGTGAAGAAGG + Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
997336199 5:133110374-133110396 TTCTGTGTTGTGTTTGAAGCTGG - Intergenic
998170732 5:139870777-139870799 CTCTGGTGAGTGTGTGAGGAGGG - Intronic
999419167 5:151426141-151426163 CTGTTGGTTGTGTCTGAAGGGGG + Intergenic
999579662 5:153022720-153022742 CTCTGGGTTTTGTTTTGAGATGG - Intergenic
999649146 5:153748564-153748586 CTCTGGCTCTTGTGTGAACATGG + Intronic
1000131457 5:158304316-158304338 TTCTGGGTTGTGGGTGAGGGTGG - Intergenic
1001341318 5:170848588-170848610 ATCTGGGTGGTGGGTGTAGAGGG - Intergenic
1002711000 5:181195021-181195043 CTCGGGGTTGTGTCTGTAGCAGG + Exonic
1003425977 6:5998711-5998733 TTCTTATTTGTGTGTGAAGACGG + Exonic
1003565086 6:7215932-7215954 CCATGTCTTGTGTGTGAAGAAGG + Intronic
1006616013 6:35327455-35327477 CTGTGGCTTGTATGTGAGGATGG + Intergenic
1009815550 6:68729185-68729207 CTCTGGGCTGTGTGCTTAGATGG + Intronic
1011752955 6:90471824-90471846 TTCTGGGTTGTGGGTGGATATGG + Intergenic
1013747999 6:113368411-113368433 CACTGGGATGTGTGTGGGGAGGG - Intergenic
1014727828 6:124994019-124994041 CTCTGGCTGGAGTGTGGAGAAGG + Intronic
1016197014 6:141356595-141356617 CTGTGGGGTGTGTGTGTATATGG - Intergenic
1016938168 6:149463855-149463877 CTCTGGCTTGTGTAAGAGGATGG + Intronic
1017021790 6:150145658-150145680 CTCTGGTTTGTGAATCAAGAAGG + Intronic
1017204021 6:151785870-151785892 CTGTGTGTTGAGTGTGAAGGAGG + Intronic
1017885233 6:158593898-158593920 CTCTGGGTGGTGTGTCAATGTGG - Intronic
1019074362 6:169375917-169375939 CTCTAGTTTTTGTGTGTAGAAGG - Intergenic
1023869324 7:44254411-44254433 CTCTGGGGTGTGGGTGAGCAGGG + Intronic
1023923064 7:44645040-44645062 CTTTGGGTTATGTGTGTTGATGG + Intronic
1024132635 7:46370915-46370937 CTTTTGTGTGTGTGTGAAGAGGG + Intergenic
1027865284 7:83638746-83638768 CACTGGGCTGTGTGTGTGGAAGG - Intronic
1029200710 7:98837377-98837399 CGCTGGGCTGTGTGGGGAGAGGG + Intergenic
1031082995 7:117276368-117276390 CTCTGAGCTTGGTGTGAAGAAGG - Intergenic
1031660162 7:124413878-124413900 CTCTGGTATGTGTGTAATGATGG - Intergenic
1033363330 7:140653299-140653321 TTCTTCGTTGTGTGTGGAGAGGG - Intronic
1033367381 7:140681948-140681970 CTCTGTGTGCTGTGAGAAGAAGG + Intronic
1035457170 7:159016163-159016185 CTCGGGGACATGTGTGAAGATGG - Intergenic
1035653477 8:1287037-1287059 CTCAGTGTTGTGTGTGTACATGG + Intergenic
1036685292 8:10905355-10905377 CTAAGGGTGGGGTGTGAAGAAGG - Intronic
1041329562 8:56710322-56710344 CTGTGCTTTGTGAGTGAAGATGG + Intergenic
1044205963 8:89492166-89492188 GTCTGGGTTGTGGTGGAAGAGGG + Intergenic
1045064364 8:98432485-98432507 CTCGGGTTTGTGAGTGAGGAAGG + Exonic
1045155357 8:99462826-99462848 CTCTTGGTCGTGTGAGAACATGG + Intronic
1045779803 8:105849662-105849684 CTTTGGTTTGTGTGGGAACAGGG + Intergenic
1046550209 8:115706541-115706563 CTCTGGGTAGTCTTTGAAGAAGG - Intronic
1046873274 8:119226944-119226966 GTGTGGGATGTGTGTTAAGAAGG - Intronic
1047994584 8:130321797-130321819 CTCTGGGTTTTATGTGATGGTGG - Intronic
1049249131 8:141578793-141578815 CTCTGGGCTGTGGGATAAGAGGG - Intergenic
1049467307 8:142757497-142757519 CTCTGGGTTCTGGGTGAGGGTGG - Intergenic
1050270777 9:3942386-3942408 CTTTGGGTTGTATGTGGAGATGG - Intronic
1050969041 9:11845594-11845616 CACTGGCCTGTGTGTCAAGAAGG + Intergenic
1051362346 9:16292311-16292333 CTCTGACTTCTTTGTGAAGAAGG + Intergenic
1053714496 9:40873584-40873606 CTTTGTGATGTGTGTGTAGATGG + Intergenic
1057062716 9:92019879-92019901 CTCAGGCTTGTGTGTGTGGAGGG + Intergenic
1059561503 9:115339091-115339113 CTGTGTCTTGTGTGTGCAGAGGG - Intronic
1060552324 9:124491492-124491514 CTGGGGTTTGTGTGTGAAGGAGG - Intronic
1061541917 9:131282088-131282110 CTGTGGGGTGTGTGTGCAGTGGG + Intergenic
1062179366 9:135182740-135182762 CTCCAGGCTGAGTGTGAAGAGGG - Intergenic
1062438283 9:136556806-136556828 CTGTGGGCTGTGGGGGAAGAAGG - Intergenic
1203408017 Un_KI270538v1:65896-65918 CTATGGGGAGTGGGTGAAGATGG + Intergenic
1186977211 X:14920651-14920673 CTCTGGAATGGGGGTGAAGATGG - Exonic
1189910395 X:45805154-45805176 CTCTTGTGTGTGTGTGAGGAGGG + Intergenic
1190065284 X:47236598-47236620 GTCTGATTTGTGTTTGAAGATGG - Intronic
1192012394 X:67288985-67289007 CTCTTGTTTATTTGTGAAGAAGG - Intergenic
1194820678 X:98502881-98502903 CTGTGGGGTGTGAGTGAAAAGGG - Intergenic
1195152054 X:102082131-102082153 ATGTGGGTTGTGTGGGAATAAGG - Intergenic
1196038723 X:111176758-111176780 TTGTGGGGTGTGTGTGAAAATGG - Intronic
1196547139 X:116975509-116975531 CTCCTGCTTCTGTGTGAAGAAGG + Intergenic
1197887809 X:131236544-131236566 CTCTGGCTTGGGTGTGGAGTGGG - Intergenic
1198036504 X:132806085-132806107 CTCTGGGTTGGTTGTGAATGTGG - Intronic
1199350145 X:146790660-146790682 CCCTGGGTGGTGCATGAAGATGG - Intergenic
1201799907 Y:17943942-17943964 CTCTGGTATGTGTGTATAGATGG + Intergenic
1201801646 Y:17962014-17962036 CTCTGGTATGTGTGTATAGATGG - Intergenic
1202361629 Y:24116657-24116679 CTCTGGTATGTGTGTATAGATGG - Intergenic
1202363444 Y:24136439-24136461 CTCTGGTATGTGTGTATAGATGG + Intergenic
1202507336 Y:25533678-25533700 CTCTGGTATGTGTGTATAGATGG - Intergenic
1202509149 Y:25553456-25553478 CTCTGGTATGTGTGTATAGATGG + Intergenic