ID: 902398998

View in Genome Browser
Species Human (GRCh38)
Location 1:16147341-16147363
Sequence CTGTTGAGGGAGAGGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 404}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902398998_902399010 24 Left 902398998 1:16147341-16147363 CCCTCCAACCTCTCCCTCAACAG 0: 1
1: 0
2: 2
3: 38
4: 404
Right 902399010 1:16147388-16147410 GTGATCCTGATATGCAGCCAGGG 0: 1
1: 3
2: 51
3: 235
4: 693
902398998_902399005 2 Left 902398998 1:16147341-16147363 CCCTCCAACCTCTCCCTCAACAG 0: 1
1: 0
2: 2
3: 38
4: 404
Right 902399005 1:16147366-16147388 GCATTTCCCAAAAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 25
4: 151
902398998_902399004 1 Left 902398998 1:16147341-16147363 CCCTCCAACCTCTCCCTCAACAG 0: 1
1: 0
2: 2
3: 38
4: 404
Right 902399004 1:16147365-16147387 AGCATTTCCCAAAAGCTCCGCGG 0: 1
1: 0
2: 1
3: 23
4: 268
902398998_902399009 23 Left 902398998 1:16147341-16147363 CCCTCCAACCTCTCCCTCAACAG 0: 1
1: 0
2: 2
3: 38
4: 404
Right 902399009 1:16147387-16147409 GGTGATCCTGATATGCAGCCAGG 0: 2
1: 4
2: 43
3: 215
4: 624
902398998_902399011 25 Left 902398998 1:16147341-16147363 CCCTCCAACCTCTCCCTCAACAG 0: 1
1: 0
2: 2
3: 38
4: 404
Right 902399011 1:16147389-16147411 TGATCCTGATATGCAGCCAGGGG 0: 1
1: 0
2: 5
3: 31
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902398998 Original CRISPR CTGTTGAGGGAGAGGTTGGA GGG (reversed) Intronic
900985892 1:6072654-6072676 CTGTTGGGGGAGTGGGTGGGGGG + Intronic
901002316 1:6154899-6154921 CTGTAGGGGGAGAGGCAGGAGGG + Intronic
901750033 1:11400402-11400424 CTGGACAGGGAGAGGTGGGACGG + Intergenic
902398998 1:16147341-16147363 CTGTTGAGGGAGAGGTTGGAGGG - Intronic
903005543 1:20295734-20295756 CCATTGAGGGAGTGGCTGGAGGG + Intronic
903065476 1:20697006-20697028 CTGTTTGGGGAGAGGCTCGATGG - Intronic
904329305 1:29747519-29747541 CAGCTCAGGGAGAGGTAGGAGGG - Intergenic
904405652 1:30286450-30286472 CTGGTGAGGGCGAGGTGGGCTGG - Intergenic
904421563 1:30397796-30397818 CTGCTGAAGGAGGGGTTGGTGGG - Intergenic
904428896 1:30449202-30449224 CTGTTGATGGTGAGGCTCGATGG + Intergenic
904433394 1:30479381-30479403 CTGTAGCGGGAGAGGTTGAGAGG - Intergenic
904458631 1:30662419-30662441 CTGGTGAGGGCGAGGTGGGCTGG - Intergenic
904779622 1:32935820-32935842 CTGGGGAGGCAGAGGTTGCAGGG - Intergenic
904794046 1:33045433-33045455 CTCTTGAGGGAGAGAGAGGAAGG + Intronic
904810746 1:33161908-33161930 GTGTTCAGGGTGAGGATGGAAGG - Intronic
905092728 1:35442364-35442386 CTGTGGAGGGAGAGGCTGGGAGG + Intronic
905271871 1:36792670-36792692 CTGCTGAAGGAGTGGGTGGACGG + Intergenic
905573309 1:39023748-39023770 CTGGAGAGGCAGAGGTTGCAGGG - Intergenic
906349138 1:45042259-45042281 CTGGTGTGGGAGAGGTTACATGG - Intronic
906357890 1:45123108-45123130 CTCTTGTGGCAGAGGTAGGAAGG - Intronic
906546189 1:46621005-46621027 ATGTTGAGGGTGAGGTCTGAGGG - Intergenic
906671268 1:47656773-47656795 CTGTTGAGGGATGGGTGGAATGG + Intergenic
907593095 1:55694376-55694398 CTGTAGAGTGGGAGGTTGGATGG + Intergenic
908304859 1:62802072-62802094 CAGGAGAGGGAGAGGTTAGAGGG - Intronic
909046987 1:70722378-70722400 CTGTTGGGAGTGAGGGTGGAGGG - Intergenic
910602521 1:89047389-89047411 CTGCAGAGGCAGAGGTTGCAGGG - Intergenic
912419880 1:109535737-109535759 CTGATGATGGGAAGGTTGGATGG + Intergenic
914803688 1:150977438-150977460 GTGTTGGGGGATGGGTTGGAAGG - Intergenic
915300798 1:154950550-154950572 CTGTTGAGTGACAGGATGGAGGG - Intronic
916174214 1:162024047-162024069 CGGCTGAGGGTGACGTTGGAAGG + Intergenic
916869829 1:168901609-168901631 CTTTTGAGAGGGAGGATGGAGGG - Intergenic
918534447 1:185558536-185558558 TTGTTGAGGAAAGGGTTGGAGGG + Intergenic
919800107 1:201348762-201348784 CTGTTGTGGCCCAGGTTGGAGGG + Intergenic
920320456 1:205117883-205117905 CCTGTGAGGCAGAGGTTGGAGGG - Intronic
921027587 1:211301304-211301326 CTGATGTGGGAGATGTGGGAAGG - Intronic
921217406 1:212949925-212949947 CTGTTGAGTGAGAGGAGGGATGG - Intergenic
921888974 1:220334939-220334961 CACTTGAGGGTGAGGTTGGGAGG - Intergenic
922073526 1:222219977-222219999 GTGTTGAGAGAGAAGGTGGAAGG - Intergenic
922228009 1:223662371-223662393 CTGGGGAGGCAGAGGTTGCAGGG + Intronic
922593322 1:226795416-226795438 CTGGAGAGGGAGAGGCAGGAAGG - Intergenic
922701869 1:227765932-227765954 CTGTGGAGGGTGGGGTTGGAAGG + Intronic
922849145 1:228717521-228717543 CTGGAGAGGGATAGGTAGGATGG + Intergenic
1062796489 10:348425-348447 GTGTGGAGGCAGAGGCTGGATGG - Intronic
1064394998 10:14974556-14974578 CTGTCGAGGGAGGGGTGGAATGG + Intronic
1065890130 10:30113768-30113790 CAGGTGAGGAACAGGTTGGAAGG - Intronic
1066061831 10:31730916-31730938 CTGGCCAGGGAGAGGTTGCAGGG - Intergenic
1066369649 10:34809627-34809649 CTGCAGAGGGAGTGGCTGGAAGG + Intronic
1068936284 10:62638557-62638579 CTGCTGAGCTAGAGGGTGGAAGG - Intronic
1069861327 10:71473471-71473493 CTTTTGGGGGTGAGGTTGAAGGG + Intronic
1069981330 10:72255004-72255026 CTGTTCATGGAGAGATTGCAGGG - Intergenic
1070787005 10:79167828-79167850 CTGATGTGGGAGGGGCTGGAGGG - Intronic
1071515810 10:86295976-86295998 CTGTTGCCAGAGAGGTTTGAGGG + Intronic
1071970127 10:90896674-90896696 CTGGTGAGGGAGAAGAAGGAAGG - Intronic
1072072367 10:91931587-91931609 TTGGTGAGGGAGAGGTCTGAAGG - Intronic
1072211932 10:93254218-93254240 CTCCTGAGGCAGAGGTTGGTGGG - Intergenic
1072521819 10:96236239-96236261 CTGTTGGGGGAGAGATGGGCAGG - Intronic
1072591943 10:96833900-96833922 CTGTTGGGGGGAAGGGTGGAGGG + Intronic
1073076046 10:100826474-100826496 CTCTTGAGGGAAAGGCGGGAGGG + Intronic
1073077633 10:100834698-100834720 TGGTTGAGGCAGAGGGTGGAAGG + Intergenic
1073366680 10:102948506-102948528 ATGTTGAGGGGTAGGTTGGGTGG + Intronic
1074501586 10:114029852-114029874 CGGTGGAGGAAGAGGTGGGAGGG - Intergenic
1075001903 10:118804888-118804910 CTGGGGAGGGAGAGGTGGGCAGG + Intergenic
1075191785 10:120315987-120316009 CTGTTGAGTGACTGGATGGAGGG + Intergenic
1077060855 11:617323-617345 CGGCTGGGGGAGAGGGTGGAGGG + Exonic
1077494847 11:2881996-2882018 CCCCTGTGGGAGAGGTTGGAAGG + Intergenic
1077936958 11:6798303-6798325 GTGTTGGGGGAAAGGGTGGATGG - Intergenic
1080026409 11:27619945-27619967 CTTTTGAGGGGGAGAATGGAGGG + Intergenic
1080390141 11:31837945-31837967 GTTTTCAGGGAGAGTTTGGATGG + Intronic
1081479001 11:43466410-43466432 CTGTTGATGGTGATGTTGAAGGG - Intronic
1081732591 11:45381969-45381991 CTGATGAGTGAATGGTTGGATGG - Intergenic
1081876799 11:46414075-46414097 CTGTTCAGGGAGCCCTTGGAAGG - Intronic
1083331136 11:61898932-61898954 CTGTGGGGGGAGGGGGTGGAGGG + Intronic
1083334940 11:61916991-61917013 GGGTTGAGGGACAGGTTGGGAGG + Intronic
1084641706 11:70430174-70430196 CTGCAGAGGGAGAGGAGGGAAGG + Intronic
1084846948 11:71908484-71908506 CTGTTGAGGGAGGAGTGGAATGG - Intronic
1084960382 11:72713244-72713266 CTGGTGAGAGAGGGGTTGGGGGG + Intronic
1085023360 11:73222571-73222593 CTGTGGAGGGTGAGGTGGCATGG - Intronic
1085024575 11:73229124-73229146 GTGTTGGGGTAGAGGATGGAAGG + Intronic
1085250448 11:75140283-75140305 CTGTGGAGGGAGACAGTGGATGG - Intronic
1088850424 11:113699551-113699573 CTGGTGTGGGGGAGGTTGGAAGG - Intronic
1090248870 11:125237128-125237150 CTGTTGGCTGAGAGGTTGGCTGG + Intronic
1090305031 11:125683974-125683996 GAGTAGAGGGAGAGGTTGGAAGG - Intergenic
1090393825 11:126406365-126406387 CTGTTGAGTTAGGGGTCGGAGGG + Intronic
1090406575 11:126479320-126479342 CTGGTGAGAGAAAGGTTGGGAGG - Intronic
1091521828 12:1253290-1253312 TTTTTGAGGGAGATGTTTGAGGG + Intronic
1093598727 12:20995245-20995267 CTGAAAAGGGTGAGGTTGGAAGG - Intergenic
1094502819 12:31036042-31036064 CTGTAGAAGGAGAGGTTGCCAGG - Intergenic
1095898296 12:47302557-47302579 CTGCTGAAGGAGAGGTTGTGTGG + Intergenic
1096550321 12:52367837-52367859 GTCTCAAGGGAGAGGTTGGAGGG + Intergenic
1097052842 12:56233821-56233843 CTGTTGAGAGGGAGATTAGATGG + Intronic
1097339149 12:58417578-58417600 TTGTTGATGGTGAAGTTGGAAGG + Intergenic
1097725617 12:63072296-63072318 GTGTAGAGGGACATGTTGGAGGG + Intergenic
1098328364 12:69326024-69326046 CTGGGGAGGCAGAGGTTGCAGGG + Intergenic
1099012402 12:77307765-77307787 CTCTTGAGAGAGAGATTAGAGGG - Intergenic
1099015480 12:77338915-77338937 CTGCTGGGGGTGAGTTTGGAGGG + Intergenic
1099928442 12:89046191-89046213 CTGTTGATGGAGAGTTTAGGGGG - Intergenic
1101177797 12:102173845-102173867 TTTTTGAGGGAGAGATTGGGTGG + Intronic
1101318288 12:103649858-103649880 CTGTCTAGGGAAATGTTGGAGGG - Intronic
1101968172 12:109294843-109294865 CTGATGAGGGAGAGGTGTGGAGG - Intronic
1102995680 12:117348247-117348269 CTGATGTCGCAGAGGTTGGAAGG + Intronic
1103191882 12:119008723-119008745 CTGATGAGGGAGGGGTTTCAAGG - Intronic
1103214218 12:119189160-119189182 TTGCTGAGGGAGAGGAAGGAAGG + Intronic
1103297296 12:119898757-119898779 CTGTTGTGGGGGTGGGTGGAGGG - Intergenic
1103470145 12:121173804-121173826 TGGTTGAGGGATTGGTTGGAGGG + Intronic
1104435633 12:128754285-128754307 CTGTTGAGCAAGAGTTAGGATGG + Intergenic
1104882505 12:132082348-132082370 CTGTGGAGGGAGAGACTGGGGGG + Intergenic
1105590242 13:21785868-21785890 ATGTTGAGGGTGACGTTGAAAGG + Intergenic
1105635820 13:22214412-22214434 CTAGAGAGGGAGAGGCTGGAGGG - Intergenic
1106020889 13:25914552-25914574 CTGGTGAAGGAGAGGAGGGATGG - Intronic
1106219863 13:27736764-27736786 CTGGTGAGGGTGAAGTTGGGAGG - Intergenic
1106343823 13:28856861-28856883 TTCTTGTGGGAGAGGTTGTACGG - Intronic
1108697137 13:52912469-52912491 CAGTTGAGGGAGATGTTGGTTGG + Intergenic
1109344786 13:61100924-61100946 GTGTTGTGGGAGGGGCTGGATGG + Intergenic
1111812299 13:93106116-93106138 CTGTTTAAGCAGAGGTTGAAGGG + Intergenic
1112098167 13:96158247-96158269 CTGTAGAGGGAGATGCGGGAAGG + Intronic
1112650629 13:101393211-101393233 CTTTTGAGAGTGAGGTTAGATGG - Intronic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1113239660 13:108322725-108322747 CTGTAGAGAGGGAGGTTAGAGGG + Intergenic
1114203246 14:20542697-20542719 CTGGTGAGGCAGTGTTTGGAAGG - Intergenic
1115334687 14:32233099-32233121 CTTTTCAGGGAGATGTAGGAAGG + Intergenic
1115641443 14:35337923-35337945 CTAATGAAGGAGAGGTGGGAGGG + Intergenic
1116317634 14:43417811-43417833 CTGTTGGGGAGGAGGTTGGTTGG + Intergenic
1117403070 14:55375428-55375450 CTGTGGAGGCTGAGGTGGGAGGG - Intronic
1117819540 14:59633162-59633184 GTGTGGAGAGAGATGTTGGATGG + Intronic
1118454123 14:65929676-65929698 CTGTTGAGGGCCAGGGTGGTGGG + Intergenic
1118867792 14:69717083-69717105 CTGCTCCTGGAGAGGTTGGAAGG + Intergenic
1119271405 14:73308236-73308258 CTGTTGATGGAGTGGATGTAGGG + Intronic
1120209990 14:81624450-81624472 ATGGTGAGGGAGAGGTTGCTGGG + Intergenic
1120248584 14:82034380-82034402 CTGTTGACAGAGAGATTGGAGGG + Intergenic
1120865952 14:89295275-89295297 CAGAGGAGGGAGAGGTTGTAGGG - Intronic
1120910790 14:89664992-89665014 CTGTTGAGGCAGAAATTGGCAGG + Intergenic
1121263949 14:92587007-92587029 CTGTTGGGGGAGAGGTAGATTGG + Intronic
1121494732 14:94384360-94384382 CTTTTGAGGGAGGGGTTGGCAGG + Intronic
1121496412 14:94394612-94394634 CTGAGGAGGGAGAGGTTAGCAGG + Intergenic
1121613025 14:95294089-95294111 CTGTTTAGGGTGAGGTAGGTAGG - Intronic
1121743939 14:96273342-96273364 CTGATAAGGGCTAGGTTGGAAGG - Intergenic
1123934285 15:25186635-25186657 CTTATGAGGGAGTGGTGGGAAGG + Intergenic
1126136375 15:45396409-45396431 CAATTTAGGGAGAGATTGGAGGG + Intronic
1126881995 15:53109228-53109250 CTCCTGAGGCAGAGGTTAGAAGG - Intergenic
1127546847 15:60000381-60000403 GTGCTGAGGGAGAGGGTCGAAGG - Intergenic
1128223299 15:65983513-65983535 ATGTTCTGGGAGAAGTTGGATGG + Intronic
1128757062 15:70190281-70190303 CTGATGAGAGAGATGTTGGACGG + Intergenic
1129924494 15:79350786-79350808 CTGCTGAGGGAGAGCATGGCTGG + Intronic
1130760370 15:86813220-86813242 ATGTGGAGGGAGAGGTTAGTAGG + Intronic
1131096003 15:89654803-89654825 GTGCTGAGAGAGAGGTTGAAGGG - Intronic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1133690261 16:8207595-8207617 CTGTTAAGGGAGAGGGGAGAGGG - Intergenic
1133887094 16:9840419-9840441 CTGTTGAGGGAGAGACCTGATGG - Intronic
1133976683 16:10604109-10604131 CGATGGAGGCAGAGGTTGGAGGG + Intergenic
1134126656 16:11620832-11620854 CTGCTGAGGGAGATGTGGGCAGG - Intronic
1135251978 16:20908005-20908027 ATGTTGAGTGAGTGGATGGATGG + Intronic
1136609201 16:31356029-31356051 CTGAGCAGGGAGAGGATGGATGG - Intronic
1137233725 16:46595075-46595097 CAGTTAAGGAAGAGGTTGGTGGG + Intronic
1138247933 16:55480695-55480717 AGGTTGAGGGGGAGGCTGGAGGG - Intronic
1138349146 16:56337299-56337321 ATGCTGAGGGAGAGGTGGGGAGG + Intronic
1139174872 16:64674789-64674811 CTTTTTAGGGTGAGGCTGGAGGG - Intergenic
1141150311 16:81560070-81560092 CTGGGGAGGCAGAGGTTGCAGGG + Intronic
1141337063 16:83165926-83165948 CAGTGGTGGGAGAGGCTGGAGGG + Intronic
1141709700 16:85690825-85690847 CTGCTGAGGGATGGGTAGGAGGG + Intronic
1141988996 16:87599591-87599613 CTGTTGAGGGAGTGCTTTGGGGG - Intergenic
1142566817 17:845524-845546 CTTATGAGGGAGAGGTGAGATGG - Intronic
1143370791 17:6437798-6437820 CTGTTTAGGGTGAGGGTGGTGGG - Intergenic
1144383824 17:14730277-14730299 CTTTTGGGAGAGAGGGTGGAGGG - Intergenic
1145091241 17:19987865-19987887 CTATTGAGGAAGAGGTCAGAAGG - Intergenic
1145116000 17:20211187-20211209 CTGCTGCTGGAGAGGTGGGAAGG + Intronic
1145770838 17:27491921-27491943 CTGTTAAGGGAGCAGTTGGTAGG + Intronic
1146488866 17:33265502-33265524 CTGTTGGGGGAGTGGTGGGAGGG + Intronic
1146580025 17:34029068-34029090 GTGTTGTGGGGGAGGTAGGAGGG - Intronic
1147836753 17:43338319-43338341 CTGTGGAGGGATAGGGTTGAGGG + Intergenic
1148485529 17:47988356-47988378 CTGTGGAGGCTGAGGTGGGAGGG + Intergenic
1148810285 17:50285967-50285989 CTGTAGAGGCAGAGTCTGGAGGG - Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1151429365 17:74052162-74052184 CTCTTGAGGCTGAGGTGGGAGGG - Intergenic
1151818096 17:76481433-76481455 ATGGTGATGGAGAGGTTGGGTGG + Exonic
1152378246 17:79929585-79929607 CGGCTGAGGGTGAGGGTGGAGGG + Intergenic
1152533318 17:80934464-80934486 CTGGGGAGGAAGAGGTGGGAGGG - Intronic
1152667637 17:81580508-81580530 CTGCTGGGGTAGAGGTGGGAGGG - Intronic
1153784858 18:8525790-8525812 CTGTTCGGGGACAGGTAGGATGG - Intergenic
1154954115 18:21239025-21239047 CTGTTATGGGAGAGAGTGGAGGG + Intergenic
1155107782 18:22684709-22684731 CCGTGGAGGCAGAGGTTGCAGGG + Intergenic
1155353847 18:24931855-24931877 CTGTTGTGGGGGACATTGGAAGG - Intergenic
1155526426 18:26720695-26720717 CTGTTGAGGGGAAGGTGAGAAGG + Intergenic
1155859344 18:30877395-30877417 CTATTTAGGGAGAGAGTGGATGG + Intergenic
1156121875 18:33854246-33854268 CTGTGGAGGTAGAGGGTGGAGGG - Intronic
1157540431 18:48499220-48499242 CTGTTAATGGTGAGGTTAGATGG - Intergenic
1157798439 18:50598092-50598114 GTGTTGTGGTAGTGGTTGGAGGG - Intronic
1158069763 18:53456930-53456952 CTGCTGTGGTAGAGGTTGGAGGG + Intronic
1159442913 18:68504761-68504783 CTGTTGAGAGAGAGAGAGGAAGG + Intergenic
1159545415 18:69835085-69835107 ATGTTGAGGGAGAGACTTGACGG - Intronic
1159690089 18:71476790-71476812 CTGTTGTGGGATAGGGGGGAGGG + Intergenic
1159949741 18:74474337-74474359 TTGGTGTGGGAGAGGTTGGGGGG - Intergenic
1160429853 18:78803921-78803943 TGGTGGAGGGAGAGGCTGGAAGG - Intergenic
1160617895 18:80147818-80147840 CTATTGAGGTAGAGGCGGGACGG + Intergenic
1161897934 19:7096665-7096687 TTGTTTGGGGAGAGGATGGAGGG - Intergenic
1162947847 19:14054539-14054561 CTGCTGGTGGAGGGGTTGGAAGG - Exonic
1163290527 19:16376669-16376691 CTGTTGGGGGTGAGGGTGGCAGG - Intronic
1163496247 19:17648014-17648036 CTGTGGAGGGGGGGATTGGAAGG - Intronic
1164514344 19:28921442-28921464 CTGTGGAGTGAGAGGCTGGAGGG + Intergenic
1164583522 19:29450217-29450239 GTGTTGAGAGAGAGATTGGGAGG - Intergenic
1164656510 19:29925766-29925788 GTGTTGGGGGTGGGGTTGGAGGG + Intronic
1165143187 19:33714975-33714997 CTGTGGAGGGAGGGGCTGGCTGG - Intronic
1165433630 19:35785383-35785405 CAGGAGAGGGAGAGGTAGGAGGG - Intronic
1165819636 19:38666284-38666306 CTGTTAGGGGAGAGGCTGGGAGG - Intronic
1166949639 19:46417988-46418010 CTTTTTGGGGAGAGGCTGGAAGG - Intergenic
1167081587 19:47279795-47279817 CTGGTGAGGGTGAGGCTGGCAGG + Intergenic
1167103284 19:47416986-47417008 AGGTTGAGGGAGAGGCTGGGAGG + Intronic
1167201813 19:48070737-48070759 CTGTTGAGGGGGCGGTGGGAGGG + Intronic
925531416 2:4867330-4867352 AGGTTGAGGGAGAGGGTGTAGGG + Intergenic
925867847 2:8244663-8244685 CTGGGAAGGGAGAGGTTGGTGGG - Intergenic
927173608 2:20390378-20390400 CTGGAGAGGCAGAGGTTGCAAGG - Intergenic
927576876 2:24207818-24207840 CTGCAAAGGGAGAGGGTGGATGG + Intronic
929572115 2:43029230-43029252 CTGTTGCGGGAGAGGTGAGGTGG - Intergenic
930826194 2:55699404-55699426 CTGAGGAGGGAGAGGCTGCATGG + Intergenic
934033099 2:88065357-88065379 CTCATGAGGCAGAGGTTGCAGGG - Intergenic
935176813 2:100655945-100655967 GTGTTGAGGGAGTGGTTGGTAGG + Intergenic
935203843 2:100881176-100881198 CTGTTGGGGCCGAGGTAGGATGG - Intronic
938261104 2:129895645-129895667 CTGTGGAAGGAGAGATTGGTGGG + Intergenic
938287240 2:130128551-130128573 CTGTGGAGGGGGTGGTTGGGGGG - Intronic
938308228 2:130268676-130268698 GTGTGGAGGGAAAGGCTGGAGGG + Intergenic
938447101 2:131388160-131388182 GTGTGGAGGGAAAGGCTGGAGGG - Intergenic
938469260 2:131544322-131544344 CTGTGGAGGGGGTGGTTGGGGGG + Intergenic
939618010 2:144381906-144381928 CTGTGGGTAGAGAGGTTGGATGG + Intergenic
939800258 2:146699326-146699348 CTGGTGATGAAGAGGTTGAATGG - Intergenic
941134968 2:161703859-161703881 CTGTTGAGGCAGATGTTGTAGGG - Intronic
941492476 2:166159466-166159488 CTGTTAAAGGAAAGGTAGGAAGG + Intergenic
942812042 2:180010910-180010932 CTGTAGAGGGAGAAGTTGCCCGG - Intergenic
943593197 2:189823420-189823442 CTGTTGAGGGGGTGGGAGGAAGG - Intronic
944897258 2:204177812-204177834 CTGGTGAGGGTGAGGGTGGAGGG + Intergenic
945341764 2:208664508-208664530 CAGTTGAGAAAGAGGTTGGTTGG + Intronic
946149536 2:217754977-217754999 CTGGTGAGAGAGAGGATGGGCGG - Intronic
946621499 2:221568742-221568764 CTGTTCAGGGAGAACTTGGGTGG - Exonic
946754845 2:222933562-222933584 CTGCTGAGGGACAGGTAGGTAGG - Intronic
947242833 2:228015067-228015089 CTGTTGTGGGGGAGGGGGGAGGG - Intronic
947438110 2:230090857-230090879 CTGTTCAGCAAGAGGCTGGAGGG - Intergenic
947848349 2:233263804-233263826 CTGTTGAAGGACAGCTTGGCTGG - Intronic
948076092 2:235166332-235166354 CTGTCCAGGGAGAGGGTGCAGGG - Intergenic
948088118 2:235267500-235267522 CTGTGGCAGGAGAGGTTGGAAGG - Intergenic
948119952 2:235522612-235522634 CTGATGAGGGAGCGATTGCAGGG + Intronic
948374376 2:237511854-237511876 CTTTTCAGGGAGAGGGTGGGAGG + Intronic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
1168953501 20:1818452-1818474 TTGTGGGGGGAGAGGTGGGAGGG - Intergenic
1168984468 20:2036322-2036344 ATATTGATGGAGAGGATGGAAGG + Intergenic
1169299081 20:4426598-4426620 CTGTTGAGGGAGATCTAGGTTGG - Intergenic
1170530710 20:17288215-17288237 CTGCTGAGGTAGAGGTTAGATGG - Intronic
1171174373 20:23040432-23040454 CTTTTCAGGGAGGGGTTGGCAGG + Intergenic
1171455565 20:25270067-25270089 CTGCTGAGGGAGAGGGATGATGG - Intronic
1172212011 20:33206686-33206708 CTCTGGAGGCAGAGGTTGCAGGG - Intergenic
1172799587 20:37566543-37566565 CAGTGGTGGGAGAGTTTGGAGGG + Intergenic
1173335980 20:42112704-42112726 GTGTTTAGGGAGAGTTTGCAGGG - Intronic
1173373534 20:42461427-42461449 CTGGAGAGGGTGAGGTGGGAGGG + Intronic
1173411188 20:42810630-42810652 CTGTTCAAGTACAGGTTGGATGG + Intronic
1173686085 20:44924330-44924352 CTGCTGGGCGAGAGGGTGGAGGG - Intronic
1174402753 20:50284775-50284797 CTGATGAGGGTGGGATTGGATGG - Intergenic
1174570879 20:51500628-51500650 GTGGTGAGGGTGAGGGTGGAGGG - Intronic
1174863833 20:54116463-54116485 CTGGGGAGGGAGAGGTTGTAGGG + Intergenic
1175409146 20:58754518-58754540 CTGTAGGGGGAGAGGTTGGTGGG + Intergenic
1175943159 20:62547176-62547198 CTGCTGAGGGTGAGGGTGGAGGG - Intergenic
1176141854 20:63548376-63548398 CTGTCCAGGGAGAGGGTGGGAGG - Intronic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1177204717 21:17997802-17997824 GTGTTGTGGGAGGGGCTGGAGGG - Intronic
1177276250 21:18916571-18916593 CTGTGGCAGTAGAGGTTGGATGG - Intergenic
1178194978 21:30334350-30334372 CTGTAGAGGGATAGGATTGACGG - Intergenic
1178972851 21:37196310-37196332 CTCGGGAGGGAGAGGTTGCAGGG - Intronic
1179767159 21:43582442-43582464 CTGTTGAGGGAGATGAGGGCCGG + Intronic
1179925028 21:44529554-44529576 CTGTCGTGGGAGTGCTTGGAGGG + Intronic
1180004002 21:45011587-45011609 TTGTTGCTGGAGAGGTTGGAAGG - Intergenic
1180139986 21:45887419-45887441 CTGATGCTGGAGAGGCTGGAGGG - Intronic
1182007670 22:26974838-26974860 CAGTGGAGGGAGGGGTGGGAAGG + Intergenic
1182414605 22:30213225-30213247 TTGGTGAGGGAGAGGCTGAATGG + Intergenic
1183002417 22:34872424-34872446 GTGTTCAAGGAGAGGCTGGATGG - Intergenic
1183340582 22:37278552-37278574 CCTTTGAGGGAGAGATAGGAAGG - Intergenic
1183718131 22:39546217-39546239 CTGTGGAGGGAGAGGTGGTAGGG - Intergenic
1183971321 22:41479659-41479681 CTGGTGGGGGAGAGGCTAGAGGG + Intronic
1184276680 22:43412693-43412715 GTGTTGAGTGAGTGGATGGATGG - Intronic
1184435039 22:44467701-44467723 CTGGAGAGGCAGAGGTTGCAGGG - Intergenic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949979754 3:9494714-9494736 CTGTTCAGGGAGAGAGTGGGAGG - Intergenic
950240931 3:11369420-11369442 CTGTTGAGGGGATGGCTGGAGGG - Intronic
951097513 3:18649134-18649156 CTCTGGAGGCAGAGGTTGCAGGG + Intergenic
952893216 3:38058257-38058279 CTGTTGAGGGATGGGATGAAGGG + Intronic
953085736 3:39664948-39664970 CTCTTGAGTAAGAGGTTGAAAGG + Intergenic
953158049 3:40392955-40392977 TTGTTGAGGGAAGTGTTGGAAGG - Intronic
954501346 3:51019620-51019642 CTGTTGGAGGTGAGGGTGGAAGG - Intronic
956011680 3:64838369-64838391 CTGTGGAGGGAGGGGTGGGCTGG - Intergenic
956754067 3:72368167-72368189 CTGTGGAGTGCGAGGTAGGAAGG + Intergenic
957296983 3:78344905-78344927 ATGTTAAGGTAGAGGTTAGAGGG + Intergenic
960429979 3:117557373-117557395 CTGATGAAGTAGAGGTTGGGAGG - Intergenic
960650779 3:119946670-119946692 CTGAAGAGAAAGAGGTTGGAAGG + Intronic
961477494 3:127157815-127157837 CTGTTCCTGGAGAGGTGGGAGGG - Intergenic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
962729539 3:138267675-138267697 TTGTTTGGGGAGGGGTTGGATGG + Intronic
962778498 3:138687799-138687821 ATGTTGGGGGAGATGTAGGAAGG + Intronic
962901957 3:139769208-139769230 CTGTTGGGGGAGAGGGGGCAAGG + Intergenic
963498210 3:146095897-146095919 CTGTGGAGGGAGAGGGGGGAGGG - Intronic
963655993 3:148050593-148050615 TTGTTGTGGTAGAGGTTGAAAGG - Intergenic
964194734 3:154049492-154049514 GTGTTGTGGGAGCGGGTGGAGGG + Intergenic
965604490 3:170485090-170485112 ATGTTGAGGGAGGGGTTGCGGGG - Intronic
968614771 4:1572511-1572533 GTGATAAGGGAGAGGTTGGGGGG + Intergenic
969183731 4:5460611-5460633 CGGAAGAGGGAGAGGTGGGATGG + Intronic
969393556 4:6906794-6906816 CTGGGGAGGCAGAGGTTGCAGGG - Intergenic
969421997 4:7102989-7103011 TTGCTCAGGGTGAGGTTGGATGG - Intergenic
969647960 4:8444289-8444311 GGGTTGGGGGAGAGGTGGGATGG + Intronic
969871166 4:10106088-10106110 CTGCTGGGGGTGAGGGTGGAAGG + Intronic
971317094 4:25576674-25576696 CTGCTGTGAGAGAGGTTGGAAGG - Intergenic
971318343 4:25585641-25585663 CTCTGGAGGTAGAGGTTGCAGGG - Intergenic
972379997 4:38510648-38510670 CTGTGGAGGAAAAGGTTGAAAGG + Intergenic
972804054 4:42509362-42509384 CTGTTGAGGAAGAAGGGGGATGG + Intronic
974764734 4:66329035-66329057 ATGTTCAGGGGGAGGTAGGAAGG - Intergenic
975378337 4:73670561-73670583 CTGTGGAGGGATAGGGTTGAGGG + Intergenic
975482648 4:74898729-74898751 CTGTTTAGGAAGATGTGGGAAGG + Intergenic
976858079 4:89628474-89628496 ATGAAGAGGGAGAGGTAGGAAGG - Intergenic
977397315 4:96486770-96486792 CTGTTCAGGGAGGGGATGGAAGG + Intergenic
978082252 4:104607709-104607731 CAGTGGAGAGAGAGGTTGTAGGG - Intergenic
978367477 4:107997330-107997352 CTGTTGAGGGAGGAGATGGGAGG + Intronic
978793541 4:112686914-112686936 CTGTTGTGGGGAAGATTGGAGGG + Intergenic
981682038 4:147410315-147410337 CTGTTGCGGGAGGGGCCGGATGG - Intergenic
983389674 4:167113598-167113620 CTATTAAGGGAGAAGTTGGCAGG + Intronic
983540197 4:168901107-168901129 AGGTTGAGGGAGAGGAAGGAGGG - Intronic
984453834 4:179939682-179939704 TTTTTGAGGGAGTGGTTTGAGGG - Intergenic
984740342 4:183155515-183155537 GTGTTGCTGGAGAGGTTGAAAGG + Intronic
985818492 5:2144391-2144413 CTGTTGAGGGAGAGGGAGGTGGG - Intergenic
986263141 5:6166653-6166675 CTGGAGAGTGAGAGGTAGGAAGG - Intergenic
986709365 5:10477480-10477502 CTGTTGATGGACAGGAAGGAAGG + Intergenic
987626413 5:20406427-20406449 CTGTTGTGGGGGAGGGGGGAGGG + Intronic
988166761 5:27601365-27601387 CTCTTGAAGTACAGGTTGGAGGG - Intergenic
990110952 5:52323799-52323821 CTGTTGAGGGAGAACTTTAAAGG - Intergenic
991114141 5:62934634-62934656 CTGTTGAAGGTGGGGTGGGATGG - Intergenic
991660541 5:68946354-68946376 CTGTGTAGAGAAAGGTTGGAGGG + Intergenic
991974006 5:72168208-72168230 CTGTTGCTGGAGAAGCTGGAAGG - Intronic
993100987 5:83539387-83539409 CTGTTGCAGGAGAGTTTTGAGGG - Exonic
993313546 5:86369539-86369561 ATGTTGAGGGAGAGGTCTGGAGG - Intergenic
993407341 5:87527919-87527941 CTGTTAAGGTATATGTTGGAAGG - Intergenic
993558813 5:89377417-89377439 CTGTTGAGATGGAGGTTGGTGGG - Intergenic
995523302 5:113031156-113031178 CTTTTGGGAGAGAGGATGGAAGG + Intronic
995881402 5:116848232-116848254 AGGTTGAAGGAGAGGCTGGAAGG - Intergenic
996356285 5:122599747-122599769 GTGTTGAGGGAGAGATCTGATGG - Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997793271 5:136782324-136782346 GGGTTGAGGGATGGGTTGGAAGG - Intergenic
997854521 5:137361436-137361458 CTGTTGAGTGAGTGGATGCATGG + Intronic
998166523 5:139847483-139847505 CTGTTGGGGGCGAGGGTGGGGGG - Intronic
998742561 5:145221428-145221450 CTGTGAAGGATGAGGTTGGAAGG + Intergenic
999414687 5:151384772-151384794 CTAATGAGTGAGAGGTTTGAGGG - Intergenic
999797905 5:155005242-155005264 CTGGGGAGTGAGAGGTAGGAGGG + Intergenic
1000145566 5:158450007-158450029 TTGTTGAGGGAGAGTTTGGAAGG - Intergenic
1001284388 5:170411921-170411943 ATGGAGAGAGAGAGGTTGGAGGG + Intronic
1002178587 5:177417340-177417362 CTGTTCAAGGAGACGTTGGGGGG + Intronic
1002276831 5:178109318-178109340 CTGTCCAGGCAGATGTTGGAGGG + Intergenic
1002466707 5:179412117-179412139 CGGTTGTGGGGGAGGGTGGAAGG - Intergenic
1002645954 5:180654806-180654828 CTTTTGAGGAACAGGTTGGAAGG - Intergenic
1002665471 5:180820600-180820622 CTGTTGAGGGATGGGGTGTAGGG + Intergenic
1004110522 6:12713715-12713737 CTTTCGAGGGAGGGGTTGGGAGG + Intergenic
1005997544 6:30940577-30940599 CTGATGCGGGAGAGGTGGGAGGG + Intergenic
1006261314 6:32873940-32873962 CTGTCTGGGGCGAGGTTGGAGGG - Intergenic
1006599447 6:35215762-35215784 CTGTGAAAGGACAGGTTGGAGGG - Intronic
1006730516 6:36232840-36232862 CTGTTGAGGAGGAGGCTGTAGGG - Intergenic
1007694523 6:43723924-43723946 CTAATGAGGAAGAGGCTGGAGGG + Intergenic
1007987153 6:46218267-46218289 CAGTTTAGGATGAGGTTGGAAGG - Intergenic
1010155086 6:72783181-72783203 CTGTAGAGAGAGATGGTGGAGGG + Intronic
1010744247 6:79542668-79542690 GCATTTAGGGAGAGGTTGGAAGG + Intergenic
1011518709 6:88180874-88180896 ATGATTAGGGAGAGCTTGGAAGG + Intergenic
1011833329 6:91401072-91401094 CTGTTGTGGGAGAGGGGAGAGGG - Intergenic
1012291528 6:97461212-97461234 CTGTGGAGTGAGAGGTTTGGAGG + Intergenic
1012948137 6:105489506-105489528 CTTTTGAGGGAGAGGGCGTAGGG + Intergenic
1014358529 6:120444418-120444440 CTGTTGAGGCAGAGGTGAAATGG + Intergenic
1015854253 6:137606533-137606555 CTGATGAGGGAGATGCTGGGAGG - Intergenic
1017720656 6:157241014-157241036 TTGCTGAGGAAGAGGGTGGAGGG + Intergenic
1018834620 6:167473602-167473624 ATGATGAGGGAGAGGCTGAATGG + Intergenic
1018962259 6:168457347-168457369 GTGTTGAAGGTGGGGTTGGATGG - Intronic
1019112980 6:169732435-169732457 CTGTTGGGGGTGAGAGTGGAGGG - Intergenic
1019659947 7:2218608-2218630 CTGCTGAGGGCTAGGTTGAAAGG - Intronic
1022508801 7:30922481-30922503 GAGAGGAGGGAGAGGTTGGAGGG - Intronic
1022585583 7:31605527-31605549 CTTTTCAGGGACATGTTGGAAGG + Intronic
1022829991 7:34056231-34056253 CTGTTGGGGGGTAGGGTGGAGGG + Intronic
1023316726 7:38945141-38945163 ATGTTGAGGCAGAGGATGCAGGG + Intergenic
1023370825 7:39510523-39510545 CTGTTGTGGGGGAGGTGGGGGGG + Intergenic
1024019183 7:45349481-45349503 CTGTGGAGGAGGAGGTTTGAAGG + Intergenic
1026068080 7:67093057-67093079 CTGAGGAGGCAGAGGTGGGAGGG + Intronic
1026134359 7:67646511-67646533 GTGTTGGGGGAGAGGAGGGAAGG + Intergenic
1026954579 7:74368967-74368989 CTTGGGAGGGAGAGGTGGGAGGG + Intronic
1028776759 7:94685811-94685833 CTGTTGAGGGGGCGGATGGAGGG + Intergenic
1029487657 7:100853112-100853134 GGGTTGAGGGAGAGGATTGACGG + Intronic
1030652176 7:112128022-112128044 CTGTCGGGGGTGAGGGTGGAGGG + Intronic
1031594232 7:123629601-123629623 TTTTTGGGGGAGAGGTTGGGGGG - Intronic
1031833574 7:126655427-126655449 GTGTTGAGGGAGAGATCTGATGG + Intronic
1032187830 7:129742542-129742564 CTGGTGGGGGAGGGGCTGGAGGG + Intronic
1032242431 7:130174387-130174409 CTGTTGAGGGTAGGGGTGGAGGG + Intronic
1032786202 7:135201978-135202000 CAGTTGAGGTGGGGGTTGGAGGG + Intronic
1032824271 7:135553993-135554015 CTCTTGAGGAAGAGTGTGGAAGG + Intergenic
1032826628 7:135576065-135576087 GTGTTTAGGGATAAGTTGGATGG + Intronic
1033050177 7:137997030-137997052 CTTTAGGGGGAGAGGTTGGCAGG - Intronic
1033326413 7:140382371-140382393 CTTTTGAGGGAGATATTGCATGG - Intronic
1034274418 7:149817802-149817824 CAGTGGAGGGAGGGGTTAGAGGG + Intergenic
1034292299 7:149942479-149942501 CTGATGTGGGAAAGGTGGGAAGG + Intergenic
1034362324 7:150511108-150511130 CTCTGGAGGCAGAGATTGGAAGG + Intergenic
1035429495 7:158807971-158807993 CTCTGGAGAGAGAGGCTGGACGG - Intronic
1036500456 8:9309349-9309371 CTGCTAGGGGAGAGGTTGGGAGG - Intergenic
1036605936 8:10305745-10305767 CTGGTAAGTGAGAGATTGGAAGG + Intronic
1036987458 8:13551482-13551504 CTATTGTGAAAGAGGTTGGAGGG - Intergenic
1037915555 8:22770708-22770730 CTGATCAAGGAGAGGTGGGATGG - Intronic
1038343970 8:26714998-26715020 CTGGGGAGGGTGAGGTGGGAGGG + Intergenic
1039906300 8:41788921-41788943 GTGTTGAGGGACAGGTGGGGTGG - Intronic
1039944611 8:42118674-42118696 CTGTAGTGGGAGGGGGTGGACGG - Intergenic
1041170499 8:55137290-55137312 ATCTTTAGGGAGAGGTTGAAAGG - Intronic
1041539264 8:58964464-58964486 CTGGTCAGGGTGTGGTTGGACGG - Intronic
1043948017 8:86275996-86276018 CTGTTGTGGAAGAGGTGGGCTGG - Intronic
1044224330 8:89702496-89702518 CTCATAAGGGGGAGGTTGGAAGG - Intergenic
1045920407 8:107522270-107522292 CTGTTCAGGGAGAGGGTGGAAGG + Intergenic
1045934761 8:107666260-107666282 GTGTAGAGGGTAAGGTTGGATGG + Intergenic
1046082941 8:109394507-109394529 CTGTTGCGGGGGTGGTGGGAAGG + Intronic
1047970734 8:130082100-130082122 CTGAAGAGGGAGAGGCTGGCAGG + Intronic
1048524618 8:135190693-135190715 CTGTTGGGTGAGAGGTTCTATGG + Intergenic
1048903238 8:139060531-139060553 CTGTGGAAGCAGAGATTGGAGGG - Intergenic
1049418983 8:142508541-142508563 CTGCTCAGGGAGAGGGTGGAAGG + Intronic
1049549206 8:143248936-143248958 CTCATGAGGGAGAGGAGGGAAGG + Intronic
1050308485 9:4329512-4329534 CTGGTGAGGGTGAGGTAGGTGGG - Intronic
1050656485 9:7834014-7834036 TTATGGAGGGAGAGGTTTGATGG + Intronic
1051174459 9:14348433-14348455 CTATTTCGGGAGAAGTTGGAGGG + Intronic
1052376566 9:27724255-27724277 TTGTGTAGGGAGAGGTGGGAGGG + Intergenic
1052745828 9:32440374-32440396 CTGGTGAGGGCGGGGCTGGATGG - Intronic
1052995093 9:34547713-34547735 CAGTTTGGGGAGAGGCTGGAAGG - Intergenic
1054345489 9:63910655-63910677 GTGTTAAGGGGGATGTTGGAAGG + Intergenic
1056485077 9:87047737-87047759 CTGTTGTGGGGGAGGGGGGAAGG + Intergenic
1056531561 9:87492765-87492787 CAGTGGAGGGTGAGGGTGGAGGG - Intergenic
1056934194 9:90903355-90903377 CTGCAGAGGGACAGGTTTGAGGG - Intergenic
1059375004 9:113875069-113875091 CAGTTGTGGGAGATGTAGGATGG + Intergenic
1059702150 9:116785678-116785700 CTGATGAGGGAGAGAAAGGAGGG - Intronic
1060007873 9:120016408-120016430 GTGTTGAGGGAGGGGCTGGGTGG - Intergenic
1060227630 9:121804086-121804108 GTGTTGAGGGTGAGGGTGGACGG - Intergenic
1060227804 9:121806080-121806102 GTGTTGAGGGTGAGGGTGGACGG + Intergenic
1060520068 9:124289319-124289341 CTGCAGAGGCAGAGCTTGGATGG - Intronic
1060676576 9:125520740-125520762 CTTTGGAGGAAGAGGTAGGATGG - Intronic
1061277714 9:129579026-129579048 TTGTTGGGGGAGAGGGAGGATGG - Intergenic
1061846358 9:133390691-133390713 CTGATGAGGATGATGTTGGAGGG - Exonic
1186671700 X:11773598-11773620 TTGTTGAGGAAGAGGCTGGGAGG - Intronic
1186860549 X:13668285-13668307 CTGATGATGGAGAGATTGGGAGG + Intronic
1189436608 X:40998366-40998388 CTGTCCAGAGAGAGGTTGGCAGG - Intergenic
1189824092 X:44899184-44899206 CTGTGGAGGGAGGGGGAGGAAGG + Intronic
1190056706 X:47185419-47185441 CTGTAGAGGGTGAGGGTGGGCGG - Intronic
1192468027 X:71371655-71371677 CTGTTGAGTGAGAGGCAGGATGG + Intronic
1192800825 X:74463111-74463133 CTGCAGAGGGAGAGGATGGATGG + Intronic
1195313932 X:103659397-103659419 ATATTGTGGGAGAGGGTGGAGGG + Intergenic
1196399655 X:115300559-115300581 CTCTTGATGGAGAGGTTTGTGGG + Intronic
1197769284 X:130079721-130079743 GGGTGGAGGGATAGGTTGGAAGG + Intronic
1198480585 X:137036126-137036148 CTGTATAGGGAGATGTTTGAGGG + Intergenic
1201636247 Y:16126285-16126307 AGGTAGAGTGAGAGGTTGGATGG - Intergenic