ID: 902399176

View in Genome Browser
Species Human (GRCh38)
Location 1:16148518-16148540
Sequence CCGGCCACAGTGGCCAGGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 341}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902399167_902399176 9 Left 902399167 1:16148486-16148508 CCGGTGGCACCACGGCATGGTCC 0: 1
1: 0
2: 2
3: 9
4: 95
Right 902399176 1:16148518-16148540 CCGGCCACAGTGGCCAGGGAAGG 0: 1
1: 0
2: 2
3: 33
4: 341
902399163_902399176 12 Left 902399163 1:16148483-16148505 CCCCCGGTGGCACCACGGCATGG 0: 1
1: 0
2: 0
3: 5
4: 71
Right 902399176 1:16148518-16148540 CCGGCCACAGTGGCCAGGGAAGG 0: 1
1: 0
2: 2
3: 33
4: 341
902399165_902399176 11 Left 902399165 1:16148484-16148506 CCCCGGTGGCACCACGGCATGGT 0: 1
1: 0
2: 0
3: 2
4: 63
Right 902399176 1:16148518-16148540 CCGGCCACAGTGGCCAGGGAAGG 0: 1
1: 0
2: 2
3: 33
4: 341
902399162_902399176 13 Left 902399162 1:16148482-16148504 CCCCCCGGTGGCACCACGGCATG 0: 1
1: 0
2: 0
3: 5
4: 62
Right 902399176 1:16148518-16148540 CCGGCCACAGTGGCCAGGGAAGG 0: 1
1: 0
2: 2
3: 33
4: 341
902399169_902399176 0 Left 902399169 1:16148495-16148517 CCACGGCATGGTCCACACAGGTG 0: 1
1: 0
2: 0
3: 3
4: 96
Right 902399176 1:16148518-16148540 CCGGCCACAGTGGCCAGGGAAGG 0: 1
1: 0
2: 2
3: 33
4: 341
902399166_902399176 10 Left 902399166 1:16148485-16148507 CCCGGTGGCACCACGGCATGGTC 0: 1
1: 0
2: 1
3: 6
4: 67
Right 902399176 1:16148518-16148540 CCGGCCACAGTGGCCAGGGAAGG 0: 1
1: 0
2: 2
3: 33
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902399176 Original CRISPR CCGGCCACAGTGGCCAGGGA AGG Exonic