ID: 902403938

View in Genome Browser
Species Human (GRCh38)
Location 1:16173003-16173025
Sequence CCTAGCAATCCGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902403938_902403950 17 Left 902403938 1:16173003-16173025 CCCTCCACCTTCGGATTGCTAGG No data
Right 902403950 1:16173043-16173065 CGAGTGGGTGAGGCCAGCCGAGG No data
902403938_902403943 -9 Left 902403938 1:16173003-16173025 CCCTCCACCTTCGGATTGCTAGG No data
Right 902403943 1:16173017-16173039 ATTGCTAGGAGATCAATGTCTGG No data
902403938_902403946 7 Left 902403938 1:16173003-16173025 CCCTCCACCTTCGGATTGCTAGG No data
Right 902403946 1:16173033-16173055 TGTCTGGCCCCGAGTGGGTGAGG No data
902403938_902403944 1 Left 902403938 1:16173003-16173025 CCCTCCACCTTCGGATTGCTAGG No data
Right 902403944 1:16173027-16173049 GATCAATGTCTGGCCCCGAGTGG No data
902403938_902403951 28 Left 902403938 1:16173003-16173025 CCCTCCACCTTCGGATTGCTAGG No data
Right 902403951 1:16173054-16173076 GGCCAGCCGAGGTCACTTGAAGG No data
902403938_902403952 29 Left 902403938 1:16173003-16173025 CCCTCCACCTTCGGATTGCTAGG No data
Right 902403952 1:16173055-16173077 GCCAGCCGAGGTCACTTGAAGGG No data
902403938_902403945 2 Left 902403938 1:16173003-16173025 CCCTCCACCTTCGGATTGCTAGG No data
Right 902403945 1:16173028-16173050 ATCAATGTCTGGCCCCGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902403938 Original CRISPR CCTAGCAATCCGAAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr