ID: 902404170

View in Genome Browser
Species Human (GRCh38)
Location 1:16174038-16174060
Sequence GCTGATGCTGAGCCCCAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902404170_902404172 -7 Left 902404170 1:16174038-16174060 CCCGTCTGGGGCTCAGCATCAGC No data
Right 902404172 1:16174054-16174076 CATCAGCCTGCCTCACCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902404170 Original CRISPR GCTGATGCTGAGCCCCAGAC GGG (reversed) Intergenic
No off target data available for this crispr