ID: 902404584

View in Genome Browser
Species Human (GRCh38)
Location 1:16175697-16175719
Sequence TCTCCAGAGCAGGAACGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902404566_902404584 24 Left 902404566 1:16175650-16175672 CCACCTCAGGGGCCCTGGGCCTG No data
Right 902404584 1:16175697-16175719 TCTCCAGAGCAGGAACGGAGGGG No data
902404578_902404584 5 Left 902404578 1:16175669-16175691 CCTGGGGCAGCAGGGGCCGGGAT No data
Right 902404584 1:16175697-16175719 TCTCCAGAGCAGGAACGGAGGGG No data
902404565_902404584 25 Left 902404565 1:16175649-16175671 CCCACCTCAGGGGCCCTGGGCCT No data
Right 902404584 1:16175697-16175719 TCTCCAGAGCAGGAACGGAGGGG No data
902404573_902404584 12 Left 902404573 1:16175662-16175684 CCCTGGGCCTGGGGCAGCAGGGG 0: 3
1: 1
2: 14
3: 104
4: 907
Right 902404584 1:16175697-16175719 TCTCCAGAGCAGGAACGGAGGGG No data
902404575_902404584 11 Left 902404575 1:16175663-16175685 CCTGGGCCTGGGGCAGCAGGGGC No data
Right 902404584 1:16175697-16175719 TCTCCAGAGCAGGAACGGAGGGG No data
902404564_902404584 26 Left 902404564 1:16175648-16175670 CCCCACCTCAGGGGCCCTGGGCC No data
Right 902404584 1:16175697-16175719 TCTCCAGAGCAGGAACGGAGGGG No data
902404569_902404584 21 Left 902404569 1:16175653-16175675 CCTCAGGGGCCCTGGGCCTGGGG No data
Right 902404584 1:16175697-16175719 TCTCCAGAGCAGGAACGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902404584 Original CRISPR TCTCCAGAGCAGGAACGGAG GGG Intergenic
No off target data available for this crispr