ID: 902404656

View in Genome Browser
Species Human (GRCh38)
Location 1:16175982-16176004
Sequence CAGACACTGGCTCAGGTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902404656_902404665 21 Left 902404656 1:16175982-16176004 CCTCAGACCTGAGCCAGTGTCTG No data
Right 902404665 1:16176026-16176048 GGCTGCGGAGAGCAAAGCCCAGG No data
902404656_902404666 24 Left 902404656 1:16175982-16176004 CCTCAGACCTGAGCCAGTGTCTG No data
Right 902404666 1:16176029-16176051 TGCGGAGAGCAAAGCCCAGGCGG No data
902404656_902404663 6 Left 902404656 1:16175982-16176004 CCTCAGACCTGAGCCAGTGTCTG No data
Right 902404663 1:16176011-16176033 AGTCACCGTGTCAGAGGCTGCGG No data
902404656_902404662 0 Left 902404656 1:16175982-16176004 CCTCAGACCTGAGCCAGTGTCTG No data
Right 902404662 1:16176005-16176027 GGGACAAGTCACCGTGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902404656 Original CRISPR CAGACACTGGCTCAGGTCTG AGG (reversed) Intergenic
No off target data available for this crispr