ID: 902404661

View in Genome Browser
Species Human (GRCh38)
Location 1:16175995-16176017
Sequence GGTGACTTGTCCCCAGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902404661_902404665 8 Left 902404661 1:16175995-16176017 CCAGTGTCTGGGGACAAGTCACC No data
Right 902404665 1:16176026-16176048 GGCTGCGGAGAGCAAAGCCCAGG No data
902404661_902404663 -7 Left 902404661 1:16175995-16176017 CCAGTGTCTGGGGACAAGTCACC No data
Right 902404663 1:16176011-16176033 AGTCACCGTGTCAGAGGCTGCGG No data
902404661_902404666 11 Left 902404661 1:16175995-16176017 CCAGTGTCTGGGGACAAGTCACC No data
Right 902404666 1:16176029-16176051 TGCGGAGAGCAAAGCCCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902404661 Original CRISPR GGTGACTTGTCCCCAGACAC TGG (reversed) Intergenic
No off target data available for this crispr