ID: 902404665

View in Genome Browser
Species Human (GRCh38)
Location 1:16176026-16176048
Sequence GGCTGCGGAGAGCAAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902404656_902404665 21 Left 902404656 1:16175982-16176004 CCTCAGACCTGAGCCAGTGTCTG No data
Right 902404665 1:16176026-16176048 GGCTGCGGAGAGCAAAGCCCAGG No data
902404655_902404665 22 Left 902404655 1:16175981-16176003 CCCTCAGACCTGAGCCAGTGTCT No data
Right 902404665 1:16176026-16176048 GGCTGCGGAGAGCAAAGCCCAGG No data
902404661_902404665 8 Left 902404661 1:16175995-16176017 CCAGTGTCTGGGGACAAGTCACC No data
Right 902404665 1:16176026-16176048 GGCTGCGGAGAGCAAAGCCCAGG No data
902404660_902404665 14 Left 902404660 1:16175989-16176011 CCTGAGCCAGTGTCTGGGGACAA No data
Right 902404665 1:16176026-16176048 GGCTGCGGAGAGCAAAGCCCAGG No data
902404654_902404665 29 Left 902404654 1:16175974-16175996 CCTGTGACCCTCAGACCTGAGCC No data
Right 902404665 1:16176026-16176048 GGCTGCGGAGAGCAAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902404665 Original CRISPR GGCTGCGGAGAGCAAAGCCC AGG Intergenic
No off target data available for this crispr