ID: 902404938

View in Genome Browser
Species Human (GRCh38)
Location 1:16177444-16177466
Sequence CCCCTTGGTGGTGGCATCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902404938_902404953 29 Left 902404938 1:16177444-16177466 CCCCAGATGCCACCACCAAGGGG No data
Right 902404953 1:16177496-16177518 TGTCAAAGGTGCACTTTCTTGGG No data
902404938_902404952 28 Left 902404938 1:16177444-16177466 CCCCAGATGCCACCACCAAGGGG No data
Right 902404952 1:16177495-16177517 TTGTCAAAGGTGCACTTTCTTGG No data
902404938_902404949 15 Left 902404938 1:16177444-16177466 CCCCAGATGCCACCACCAAGGGG No data
Right 902404949 1:16177482-16177504 ACCTGGTGCACCATTGTCAAAGG No data
902404938_902404946 -2 Left 902404938 1:16177444-16177466 CCCCAGATGCCACCACCAAGGGG No data
Right 902404946 1:16177465-16177487 GGAGAGGTGCCACCATGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902404938 Original CRISPR CCCCTTGGTGGTGGCATCTG GGG (reversed) Intergenic
No off target data available for this crispr