ID: 902404940

View in Genome Browser
Species Human (GRCh38)
Location 1:16177445-16177467
Sequence TCCCCTTGGTGGTGGCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902404940_902404953 28 Left 902404940 1:16177445-16177467 CCCAGATGCCACCACCAAGGGGA No data
Right 902404953 1:16177496-16177518 TGTCAAAGGTGCACTTTCTTGGG No data
902404940_902404946 -3 Left 902404940 1:16177445-16177467 CCCAGATGCCACCACCAAGGGGA No data
Right 902404946 1:16177465-16177487 GGAGAGGTGCCACCATGACCTGG No data
902404940_902404952 27 Left 902404940 1:16177445-16177467 CCCAGATGCCACCACCAAGGGGA No data
Right 902404952 1:16177495-16177517 TTGTCAAAGGTGCACTTTCTTGG No data
902404940_902404949 14 Left 902404940 1:16177445-16177467 CCCAGATGCCACCACCAAGGGGA No data
Right 902404949 1:16177482-16177504 ACCTGGTGCACCATTGTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902404940 Original CRISPR TCCCCTTGGTGGTGGCATCT GGG (reversed) Intergenic
No off target data available for this crispr