ID: 902404941

View in Genome Browser
Species Human (GRCh38)
Location 1:16177446-16177468
Sequence CTCCCCTTGGTGGTGGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902404941_902404946 -4 Left 902404941 1:16177446-16177468 CCAGATGCCACCACCAAGGGGAG No data
Right 902404946 1:16177465-16177487 GGAGAGGTGCCACCATGACCTGG No data
902404941_902404949 13 Left 902404941 1:16177446-16177468 CCAGATGCCACCACCAAGGGGAG No data
Right 902404949 1:16177482-16177504 ACCTGGTGCACCATTGTCAAAGG No data
902404941_902404952 26 Left 902404941 1:16177446-16177468 CCAGATGCCACCACCAAGGGGAG No data
Right 902404952 1:16177495-16177517 TTGTCAAAGGTGCACTTTCTTGG No data
902404941_902404953 27 Left 902404941 1:16177446-16177468 CCAGATGCCACCACCAAGGGGAG No data
Right 902404953 1:16177496-16177518 TGTCAAAGGTGCACTTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902404941 Original CRISPR CTCCCCTTGGTGGTGGCATC TGG (reversed) Intergenic
No off target data available for this crispr