ID: 902404943

View in Genome Browser
Species Human (GRCh38)
Location 1:16177453-16177475
Sequence GGCACCTCTCCCCTTGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902404943_902404955 28 Left 902404943 1:16177453-16177475 CCACCACCAAGGGGAGAGGTGCC No data
Right 902404955 1:16177504-16177526 GTGCACTTTCTTGGGTGTCCGGG No data
902404943_902404956 29 Left 902404943 1:16177453-16177475 CCACCACCAAGGGGAGAGGTGCC No data
Right 902404956 1:16177505-16177527 TGCACTTTCTTGGGTGTCCGGGG No data
902404943_902404954 27 Left 902404943 1:16177453-16177475 CCACCACCAAGGGGAGAGGTGCC No data
Right 902404954 1:16177503-16177525 GGTGCACTTTCTTGGGTGTCCGG No data
902404943_902404953 20 Left 902404943 1:16177453-16177475 CCACCACCAAGGGGAGAGGTGCC No data
Right 902404953 1:16177496-16177518 TGTCAAAGGTGCACTTTCTTGGG No data
902404943_902404949 6 Left 902404943 1:16177453-16177475 CCACCACCAAGGGGAGAGGTGCC No data
Right 902404949 1:16177482-16177504 ACCTGGTGCACCATTGTCAAAGG No data
902404943_902404952 19 Left 902404943 1:16177453-16177475 CCACCACCAAGGGGAGAGGTGCC No data
Right 902404952 1:16177495-16177517 TTGTCAAAGGTGCACTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902404943 Original CRISPR GGCACCTCTCCCCTTGGTGG TGG (reversed) Intergenic
No off target data available for this crispr