ID: 902404944

View in Genome Browser
Species Human (GRCh38)
Location 1:16177456-16177478
Sequence GGTGGCACCTCTCCCCTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902404944_902404949 3 Left 902404944 1:16177456-16177478 CCACCAAGGGGAGAGGTGCCACC No data
Right 902404949 1:16177482-16177504 ACCTGGTGCACCATTGTCAAAGG No data
902404944_902404954 24 Left 902404944 1:16177456-16177478 CCACCAAGGGGAGAGGTGCCACC No data
Right 902404954 1:16177503-16177525 GGTGCACTTTCTTGGGTGTCCGG No data
902404944_902404956 26 Left 902404944 1:16177456-16177478 CCACCAAGGGGAGAGGTGCCACC No data
Right 902404956 1:16177505-16177527 TGCACTTTCTTGGGTGTCCGGGG No data
902404944_902404955 25 Left 902404944 1:16177456-16177478 CCACCAAGGGGAGAGGTGCCACC No data
Right 902404955 1:16177504-16177526 GTGCACTTTCTTGGGTGTCCGGG No data
902404944_902404952 16 Left 902404944 1:16177456-16177478 CCACCAAGGGGAGAGGTGCCACC No data
Right 902404952 1:16177495-16177517 TTGTCAAAGGTGCACTTTCTTGG No data
902404944_902404953 17 Left 902404944 1:16177456-16177478 CCACCAAGGGGAGAGGTGCCACC No data
Right 902404953 1:16177496-16177518 TGTCAAAGGTGCACTTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902404944 Original CRISPR GGTGGCACCTCTCCCCTTGG TGG (reversed) Intergenic
No off target data available for this crispr