ID: 902404946

View in Genome Browser
Species Human (GRCh38)
Location 1:16177465-16177487
Sequence GGAGAGGTGCCACCATGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902404941_902404946 -4 Left 902404941 1:16177446-16177468 CCAGATGCCACCACCAAGGGGAG No data
Right 902404946 1:16177465-16177487 GGAGAGGTGCCACCATGACCTGG No data
902404938_902404946 -2 Left 902404938 1:16177444-16177466 CCCCAGATGCCACCACCAAGGGG No data
Right 902404946 1:16177465-16177487 GGAGAGGTGCCACCATGACCTGG No data
902404940_902404946 -3 Left 902404940 1:16177445-16177467 CCCAGATGCCACCACCAAGGGGA No data
Right 902404946 1:16177465-16177487 GGAGAGGTGCCACCATGACCTGG No data
902404935_902404946 12 Left 902404935 1:16177430-16177452 CCTGTGTGCAAGGGCCCCAGATG No data
Right 902404946 1:16177465-16177487 GGAGAGGTGCCACCATGACCTGG No data
902404933_902404946 14 Left 902404933 1:16177428-16177450 CCCCTGTGTGCAAGGGCCCCAGA No data
Right 902404946 1:16177465-16177487 GGAGAGGTGCCACCATGACCTGG No data
902404932_902404946 20 Left 902404932 1:16177422-16177444 CCTTGTCCCCTGTGTGCAAGGGC No data
Right 902404946 1:16177465-16177487 GGAGAGGTGCCACCATGACCTGG No data
902404934_902404946 13 Left 902404934 1:16177429-16177451 CCCTGTGTGCAAGGGCCCCAGAT No data
Right 902404946 1:16177465-16177487 GGAGAGGTGCCACCATGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902404946 Original CRISPR GGAGAGGTGCCACCATGACC TGG Intergenic
No off target data available for this crispr