ID: 902404947

View in Genome Browser
Species Human (GRCh38)
Location 1:16177474-16177496
Sequence AATGGTGCACCAGGTCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902404947_902404953 -1 Left 902404947 1:16177474-16177496 CCACCATGACCTGGTGCACCATT No data
Right 902404953 1:16177496-16177518 TGTCAAAGGTGCACTTTCTTGGG No data
902404947_902404957 18 Left 902404947 1:16177474-16177496 CCACCATGACCTGGTGCACCATT No data
Right 902404957 1:16177515-16177537 TGGGTGTCCGGGGTCATGCCAGG No data
902404947_902404954 6 Left 902404947 1:16177474-16177496 CCACCATGACCTGGTGCACCATT No data
Right 902404954 1:16177503-16177525 GGTGCACTTTCTTGGGTGTCCGG No data
902404947_902404960 30 Left 902404947 1:16177474-16177496 CCACCATGACCTGGTGCACCATT No data
Right 902404960 1:16177527-16177549 GTCATGCCAGGATTCATGCAGGG No data
902404947_902404955 7 Left 902404947 1:16177474-16177496 CCACCATGACCTGGTGCACCATT No data
Right 902404955 1:16177504-16177526 GTGCACTTTCTTGGGTGTCCGGG No data
902404947_902404956 8 Left 902404947 1:16177474-16177496 CCACCATGACCTGGTGCACCATT No data
Right 902404956 1:16177505-16177527 TGCACTTTCTTGGGTGTCCGGGG No data
902404947_902404952 -2 Left 902404947 1:16177474-16177496 CCACCATGACCTGGTGCACCATT No data
Right 902404952 1:16177495-16177517 TTGTCAAAGGTGCACTTTCTTGG No data
902404947_902404959 29 Left 902404947 1:16177474-16177496 CCACCATGACCTGGTGCACCATT No data
Right 902404959 1:16177526-16177548 GGTCATGCCAGGATTCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902404947 Original CRISPR AATGGTGCACCAGGTCATGG TGG (reversed) Intergenic
No off target data available for this crispr