ID: 902404949

View in Genome Browser
Species Human (GRCh38)
Location 1:16177482-16177504
Sequence ACCTGGTGCACCATTGTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902404934_902404949 30 Left 902404934 1:16177429-16177451 CCCTGTGTGCAAGGGCCCCAGAT No data
Right 902404949 1:16177482-16177504 ACCTGGTGCACCATTGTCAAAGG No data
902404940_902404949 14 Left 902404940 1:16177445-16177467 CCCAGATGCCACCACCAAGGGGA No data
Right 902404949 1:16177482-16177504 ACCTGGTGCACCATTGTCAAAGG No data
902404935_902404949 29 Left 902404935 1:16177430-16177452 CCTGTGTGCAAGGGCCCCAGATG No data
Right 902404949 1:16177482-16177504 ACCTGGTGCACCATTGTCAAAGG No data
902404945_902404949 0 Left 902404945 1:16177459-16177481 CCAAGGGGAGAGGTGCCACCATG No data
Right 902404949 1:16177482-16177504 ACCTGGTGCACCATTGTCAAAGG No data
902404943_902404949 6 Left 902404943 1:16177453-16177475 CCACCACCAAGGGGAGAGGTGCC No data
Right 902404949 1:16177482-16177504 ACCTGGTGCACCATTGTCAAAGG No data
902404941_902404949 13 Left 902404941 1:16177446-16177468 CCAGATGCCACCACCAAGGGGAG No data
Right 902404949 1:16177482-16177504 ACCTGGTGCACCATTGTCAAAGG No data
902404944_902404949 3 Left 902404944 1:16177456-16177478 CCACCAAGGGGAGAGGTGCCACC No data
Right 902404949 1:16177482-16177504 ACCTGGTGCACCATTGTCAAAGG No data
902404938_902404949 15 Left 902404938 1:16177444-16177466 CCCCAGATGCCACCACCAAGGGG No data
Right 902404949 1:16177482-16177504 ACCTGGTGCACCATTGTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902404949 Original CRISPR ACCTGGTGCACCATTGTCAA AGG Intergenic
No off target data available for this crispr