ID: 902404950

View in Genome Browser
Species Human (GRCh38)
Location 1:16177483-16177505
Sequence ACCTTTGACAATGGTGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902404950_902404960 21 Left 902404950 1:16177483-16177505 CCTGGTGCACCATTGTCAAAGGT No data
Right 902404960 1:16177527-16177549 GTCATGCCAGGATTCATGCAGGG No data
902404950_902404953 -10 Left 902404950 1:16177483-16177505 CCTGGTGCACCATTGTCAAAGGT No data
Right 902404953 1:16177496-16177518 TGTCAAAGGTGCACTTTCTTGGG No data
902404950_902404954 -3 Left 902404950 1:16177483-16177505 CCTGGTGCACCATTGTCAAAGGT No data
Right 902404954 1:16177503-16177525 GGTGCACTTTCTTGGGTGTCCGG No data
902404950_902404959 20 Left 902404950 1:16177483-16177505 CCTGGTGCACCATTGTCAAAGGT No data
Right 902404959 1:16177526-16177548 GGTCATGCCAGGATTCATGCAGG No data
902404950_902404963 29 Left 902404950 1:16177483-16177505 CCTGGTGCACCATTGTCAAAGGT No data
Right 902404963 1:16177535-16177557 AGGATTCATGCAGGGATAGGAGG No data
902404950_902404956 -1 Left 902404950 1:16177483-16177505 CCTGGTGCACCATTGTCAAAGGT No data
Right 902404956 1:16177505-16177527 TGCACTTTCTTGGGTGTCCGGGG No data
902404950_902404955 -2 Left 902404950 1:16177483-16177505 CCTGGTGCACCATTGTCAAAGGT No data
Right 902404955 1:16177504-16177526 GTGCACTTTCTTGGGTGTCCGGG No data
902404950_902404961 26 Left 902404950 1:16177483-16177505 CCTGGTGCACCATTGTCAAAGGT No data
Right 902404961 1:16177532-16177554 GCCAGGATTCATGCAGGGATAGG No data
902404950_902404957 9 Left 902404950 1:16177483-16177505 CCTGGTGCACCATTGTCAAAGGT No data
Right 902404957 1:16177515-16177537 TGGGTGTCCGGGGTCATGCCAGG No data
902404950_902404964 30 Left 902404950 1:16177483-16177505 CCTGGTGCACCATTGTCAAAGGT No data
Right 902404964 1:16177536-16177558 GGATTCATGCAGGGATAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902404950 Original CRISPR ACCTTTGACAATGGTGCACC AGG (reversed) Intergenic
No off target data available for this crispr