ID: 902404951

View in Genome Browser
Species Human (GRCh38)
Location 1:16177492-16177514
Sequence AGAAAGTGCACCTTTGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902404951_902404956 -10 Left 902404951 1:16177492-16177514 CCATTGTCAAAGGTGCACTTTCT No data
Right 902404956 1:16177505-16177527 TGCACTTTCTTGGGTGTCCGGGG No data
902404951_902404963 20 Left 902404951 1:16177492-16177514 CCATTGTCAAAGGTGCACTTTCT No data
Right 902404963 1:16177535-16177557 AGGATTCATGCAGGGATAGGAGG No data
902404951_902404957 0 Left 902404951 1:16177492-16177514 CCATTGTCAAAGGTGCACTTTCT No data
Right 902404957 1:16177515-16177537 TGGGTGTCCGGGGTCATGCCAGG No data
902404951_902404961 17 Left 902404951 1:16177492-16177514 CCATTGTCAAAGGTGCACTTTCT No data
Right 902404961 1:16177532-16177554 GCCAGGATTCATGCAGGGATAGG No data
902404951_902404959 11 Left 902404951 1:16177492-16177514 CCATTGTCAAAGGTGCACTTTCT No data
Right 902404959 1:16177526-16177548 GGTCATGCCAGGATTCATGCAGG No data
902404951_902404965 22 Left 902404951 1:16177492-16177514 CCATTGTCAAAGGTGCACTTTCT No data
Right 902404965 1:16177537-16177559 GATTCATGCAGGGATAGGAGGGG No data
902404951_902404964 21 Left 902404951 1:16177492-16177514 CCATTGTCAAAGGTGCACTTTCT No data
Right 902404964 1:16177536-16177558 GGATTCATGCAGGGATAGGAGGG No data
902404951_902404960 12 Left 902404951 1:16177492-16177514 CCATTGTCAAAGGTGCACTTTCT No data
Right 902404960 1:16177527-16177549 GTCATGCCAGGATTCATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902404951 Original CRISPR AGAAAGTGCACCTTTGACAA TGG (reversed) Intergenic